Human Molecular Genetics, 2001, Vol. 10, No. 10 1071-1076
© 2001 Oxford University Press
Defect of histone acetyltransferase activity of the nuclear transcriptional coactivator CBP in Rubinstein–Taybi syndrome
1Department of Pediatrics, Graduate School of Medicine, University of Tokyo, Tokyo 113-8655, Japan, 2Divisions of Cellular and Molecular Medicine and Endocrinology and Metabolism, Department of Medicine, University of California, San Diego, La Jolla, CA 92093-0651, USA, 3Howard Hughes Medical Institute, Department of Medicine, University of California, San Diego, La Jolla, CA 92093-0651, USA, 4Division of Medical Genetics, Kanagawa Children’s Medical Center, Kanagawa 232-8555, Japan and 5Division of Medical Genetics, Saitama Children’s Medical Center, Saitama 339-0077, Japan
Received 17 January 2001; Revised and Accepted 12 March 2001.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
CREB-binding protein (CBP) is a transcriptional coactivator that has intrinsic histone acetyltransferase (HAT) activity. CBP is the causative gene of Rubinstein–Taybi syndrome (RTS). To investigate the relationships between CBP HAT activity and RTS, we analyzed 16 RTS patients. A microdeletion was identified in one patient by fluorescent in situ hybridization analysis. Heteroallelic mutations were identified in five patients by reverse transcriptase–polymerase chain reaction–single-strand conformation polymorphism analysis and sequencing. These included a 2 bp deletion between nucleotides 4319 and 4320, an 11 bp deletion between nucleotides 4898 and 4908, a 14 bp insertion (CCTCGGTCCTGCAC) between nucleotides 5212 and 5213, a 2 bp deletion between nucleotides 5222 and 5223, and a missense mutation from guanine (G) to cytosine (C) at nucleotide 4951 that changed codon 1378 from CGG (arginine) to CCG (proline). The identical missense mutation was introduced into the recombinant mouse CBP. It abolished the HAT activity of CBP and the ability of CBP to transactivate cyclic AMP-response element binding protein (CREB), in HAT assays and in microinjection experiments, respectively. These results suggest that the loss of the HAT activity of CBP may cause RTS, as the first example of a defect of HAT activity in a human disease. Our findings raise the possibility that treatment of RTS patients with histone deacetylase inhibitors might have beneficial effects.
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Rubinstein–Taybi syndrome (RTS) is a congenital malformation syndrome that is characterized by facial anomalies (beaked nose, down-slanting palpebral fissures and hypoplastic maxilla), broad thumbs, broad big toes, short stature and mental retardation. This syndrome was originally described by Rubinstein and Taybi in 1963, and the criteria of the diagnosis are well established (1,2).
RTS is inherited in autosomal dominant manner (2). The gene encoding the CREB-binding protein (CBP), located on 16p13.3, was reported as the causative gene of RTS (3,4). Until now, little was known about the relationship between RTS and the functions of the CBP protein.
Human CBP is a nuclear protein consisting of 2442 amino acids (5,6). CBP was first identified as a protein that worked as a coactivator to cyclic AMP (cAMP)-response element binding protein (CREB) (7). CREB mediates the genomic effects of cAMP by binding to the cAMP-response element (CRE) on DNA. CBP acts as a transcriptional coactivator that transactivates CREB-regulated transcription when bound to CREB via its CREB-binding domain.
CBP also interacts with many other transcriptional factors such as nuclear receptors (NRs), Jun, Fos, E1A, p300/CBP-associated factor (P/CAF), signal transducers and activators of transcription (STATs), SRC-1 and p/CIP (8–11).
One of the most important functions of CBP is histone acetyltransferase (HAT) activity (12,13). The acetylation of histones takes place at the lysine residues in the N-terminus (14,15). Lysine itself has a positive charge; however, it is neutralized when acetylated. Under current understanding, this electrical change is considered to play an important role in transcriptional regulations (14,15). The HAT domain of CBP was determined by generating truncated CBPs, and amino acids 1099–1758 of mouse CBP were required to have full HAT activity (12,13). Truncated CBP lacking part of the HAT domain could not acetylate histones (12,13).
Some other transcriptional coactivators, such as P/CAF, also have intrinsic HAT activity (5). The acetyltransferase activities of CBP and other HAT-containing coactivators appear to be differentially required for the transcriptional activities of sequence-specific activators. For example, the HAT activity of CBP was required to enhance the transcription regulated by CREB, but not by retinoic acid receptor (RAR) or STAT-1, whereas the HAT activity of the coactivator p/CAF was required by RAR but not CREB (16,17).
To investigate the relationships between the defect of CBP HAT activity and RTS, we analyzed 16 RTS patients. We performed chromosome analysis, fluorescent in situ hybridization (FISH) analysis, reverse transcriptase–polymerase chain reaction–single-strand conformation polymorphism (RT–PCR–SSCP) analysis and sequencing. We identified a microdeletion in one patient and heteroallelic mutations in five patients. A CBP missense mutation R1378P identified in one RTS patient was analyzed by HAT assays and microinjection experiments. Our results suggested a relationship between RTS and a defect of CBP HAT activity, and raised the possibility of a new therapy for RTS patients.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Genetic analyses of CBP
Chromosome analysis revealed no abnormalities in any of the 16 RTS patients. One patient had a microdeletion in FISH using RT-1 probe that covered the 3' region of CBP.
RT–PCR–SSCP analysis revealed abnormal band shifts in five patients, all of whom also had a wild-type band (Fig. 1A). Sequencing of the abnormal bands revealed heteroallelic mutations of CBP in all of them (Fig. 1B; Table 1). In patient 1, a 2 bp deletion between nucleotides 4319 and 4320 was identified, leading to a nonsense mutation with a stop codon at codon 1167 (Fig. 1C, RTS 1). In patient 2, an 11 bp deletion between nucleotides 4898 and 4908 was identified, leading to a frame-shift mutation with abnormal amino acids between codons 1361 and 1379, and a stop codon appeared at codon 1380 (Fig. 1C, RTS 2). In patient 3, a 14 bp insertion (CCTCGGTCCTGCAC) between nucleotides 5212 and 5213 was identified, leading to a frame-shift mutation with abnormal amino acids between codons 1466 and 1471, and a stop codon appeared at codon 1472 (Fig. 1C, RTS 3). In patient 4, a 2 bp deletion between nucleotides 5222 and 5223 was identified, leading to a frame-shift mutation with abnormal amino acids between codons 1469 and 1476, and a stop codon appeared at codon 1477 (Fig. 1C, RTS 4). In patient 5, guanine (G) at nucleotide 4951 was changed to cytosine (C), leading to a missense mutation from CGG (arginine) to CCG (proline) at codon 1378 (Fig. 1C, RTS 5). We termed this mutation R1378P. Further analysis of the parents and the siblings of patient 5 revealed that no other family member had the same mutation as patient 5 (Fig. 1A-5 and B). This mutation was also confirmed in the genomic DNA of patient 5. Patient 5 had no other mutation in CBP. We could not detect aberrations of CBP in the remaining 10 RTS patients.
|
|
Functional characterization of the R1378P mutation
The arginine at codon 1378 of human CBP was conserved across species, and it corresponded to the arginine at codon 1379 of mouse CBP (Fig. 1D). This mutation lay within a region of CBP that is required for HAT activity, suggesting that it might have altered their enzymatic function (12,13). To test this possibility, (R1379P) the identical mutation to that of patient 5 was introduced into GST–CBP-HAT containing the HAT domain of mouse CBP, and HAT assays were performed. This mutation was observed to abolish the HAT activity of the CBP HAT domain (Fig. 2A).
|
The HAT activity of CBP has been previously demonstrated to be required for transcriptional activity of CREB (16,17). In microinjection experiments, we measured the transcriptional coactivation potency of CBPR1379P, which was a mutant mouse CBP with the identical mutation to that of patient 5. CRE–LacZ reporter gene expression was stimulated from 1.4 to 68% of cells by forskolin treatment, reflecting CREB-regulated transcription. It decreased to 7.5% of cells when anti-CBP antibody was injected in order to suppress the intrinsic CBP. Overexpression of wild-type CBP largely reduced the effect of anti-CBP antibody, with the percentage of the blue cells increasing to 47.6%. CBPL1690K,C1691L was a known mutant CBP that lacked HAT activity and was unable to transactivate CREB (16). Like CBPL1690K,C1691L, CBPR1379P was unable to overcome the inhibitory effects of anti-CBP antibody, indicating that it was defective in coactivator function to CREB (Fig. 2B).
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
In this study, one patient had a microdeletion of CBP, one had a nonsense mutation, three had frame-shift mutations and one had a missense mutation R1378P. The mutations identified in patients 1, 3, 4 and 5 were novel, and there have been no reports of a missense mutation of CBP in RTS patients until now (3,4). It remains unclear what kind of genetic disorders the remaining 10 RTS patients have. There are several possibilities that may account for this. Firstly, these RTS patients might have mutations in the regions of CBP where RT–PCR–SSCP analysis could not be successfully performed due to the instability of the single-strand conformation of the RT–PCR product or an extremely GC-rich nucleic acid sequence (Fig. 3). Secondly, due to the limitation of the sensitivity of RT–PCR–SSCP analysis, we might have missed some mutations within the screened regions. Thirdly, they might have mutations in the non-coding region of CBP that may affect the amount or stability of CBP mRNA. Fourthly, they might have microdeletions of CBP in 5' side that was not covered by the RT-1 probe used in this study. Finally, they might have aberrations in some other genes that cause RTS.
|
In the RT–PCR–SSCP experiment, all five patients with a shifted band also had a normal band, meaning both the wild-type allele and the mutant allele were expressed (Fig. 1A). At the same time, there was no significant difference in clinical presentation between the patients with a microdeletion of CBP detected by RT-1 probe that covered the 3' region, a missense mutation, a nonsense mutation and frame-shift mutations. Previously, it was reported that there was no significant difference in clinical presentations between the patients with protein truncating mutations and those with microdeletions of CBP in the 3' region, the 5' region and the whole CBP (4). Thus, our observation appears to be compatible with the current understanding of the haploinsufficiency mechanism in RTS.
With regard to patients 1–4, truncated CBPs lacking part of the HAT domain were predicted. In the literature, all the previously reported RTS patients were predicted to have truncated CBPs lacking all or part of the HAT domain (3,4). As such truncated CBPs did not have HAT activity in vitro, all these truncated CBPs in RTS patients are supposed to lack HAT activity (12,13). With regard to patient 5, the identical mutation R1379P in recombinant mouse CBP abolished both HAT activity and transcriptional coactivation potency to CREB, as shown in HAT assays and in microinjection experiments, respectively. In concert, these findings suggest that the defect of the HAT activity of CBP may cause RTS. To the extent of our knowledge, this is the first report showing a relationship between a defect of HAT activity and a disease in humans.
Furthermore, our findings may lead to a possible new therapy for RTS patients. The acetylation of histones is reversible, and histones can be deacetylated by a histone deacetylase. In this respect, one of the best studied activators is RAR. RAR binds to the retinoic acid-response element (RARE) on DNA and regulates gene transcription in a ligand-dependent manner. When the agonist is present, RAR forms a coactivator complex with CBP and P/CAF (5,18). Conversely, when the agonist is absent, RAR forms a corepressor complex with histone deacetylase and a NR corepressor, NCoR (5,18). Thus, the balance of histone acetylation and deacetylation is very important in transcriptional regulation.
Histone deacetylase inhibitors were already used in clinical trials against acute promyelocytic leukemia (APL) with resistance against all-trans retinoic acid (ATRA) therapy. Sodium butyrate and trichostatin A (TSA) are known to act as histone deacetylase inhibitors. In most APL patients, RAR was fused to PML but, in a small number of patients, RAR was fused to PLZF (19,20). APL with PLZF–RAR was resistant to ATRA therapy but it was shown that both sodium butyrate and TSA were able to recover its sensitivity to ATRA in cultured cells (19,20). Sodium butyrate proved effective in obtaining clinical remission when applied to a refractory case of an APL patient combined with ATRA therapy (21). These results suggested a therapeutic effect of compensating for a relative excess of histone deacetylase activity.
The defect in HAT activity in RTS may lead to a relative excess of histone deacetylase activity, considering that the HAT activity and histone deacetylase activity are balanced. Thus, our results raise the possibility that treatment of RTS patients with histone deacetylase inhibitors such as sodium butyrate and TSA might have beneficial effects, as these drugs may compensate for a relative excess of histone deacetylase activity.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Patients and clinical materials
Sixteen RTS patients diagnosed as typical RTS were analyzed. Peripheral blood samples from these patients were used in this study. The study protocol was in accordance with the standards of the ethics committee at the University of Tokyo (Tokyo, Japan). All patients’ parents gave informed consent after the purpose, nature and potential risks of the study were explained to them.
Chromosome analysis and FISH analysis
Chromosome analysis with regular G-banding was performed. FISH analysis was performed as previously described (22). The RT-1 probe covered the 3' region of CBP, and has been widely used for the FISH analysis of RTS (3,6,22).
RT–PCR–SSCP analysis
RT–PCR–SSCP analysis was performed to screen the mutations in CBP. Total RNA was isolated from peripheral blood lymphocytes or the Epstein-Barr virus-transformed lymphoblastoid cells of the RTS patients using the acid guanidine thiocyanate–phenol–chloroform method (23). cDNA was synthesized using Ready to Go You Prime First-Strand Beads (Amersham Pharmacia Biotech) and a random hexamer (Amersham Pharmacia Biotech), and the final volume of cDNA solution was 33 µl (23). RT–PCR was performed using the primers shown in Table 2. These primers were designed based on the human CBP cDNA sequence (GenBank accession no. U85962). Total reaction volumes were 10 µl containing 0.1 µl of cDNA solution,10 mM Tris–HCl pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 250 µM of each deoxynucleotide triphosphate, 0.01% gelatin, 2.4 pM of each primer, 1.14 µCi of [
-32P]dCTP (Amersham Pharmacia Biotech) and 1 U AmpliTaq Gold (Applied Biosystems). RT–PCR was performed with Gene Amp PCR system 9700 (Applied Biosystems) for 34 cycles consisting of denaturation at 94°C for 30 s, annealing at 55°C for 30 s and extension at 72°C for 1 min with initial denaturation at 94°C for 9 min.
|
SSCP analysis was performed using TME buffer pH 6.8 as previously described (23,24). The constitution of TME buffer was as follows: 30 mM Tris, 35 mM MES [2-(N-morpholino) ethanesulfonic acid; Dojin Chemicals] and 1 mM Na2EDTA. RT–PCR products were heated in denaturing buffer to generate the single-stranded DNA, then applied to the 5% polyacrylamide (99:1 acrylamide:bisacrylamide) gel for electrophoresis at 25°C. Gels were dried and exposed to X-ray film for 4–12 h at 25°C.
Mutation analysis
The abnormal bands in the SSCP analysis were cut out from the polyacrylamide gel and soaked in 20 µl of distilled water. One microliter of the supernatant was used as the template for the secondary PCR, using the same primers and conditions as the first RT–PCR. Sequencing was performed using ABI Prism 310 (Applied Biosystems) and the same primers as the first RT–PCR (23,25,26). The results were confirmed by sequencing with anti-sense primers. The mutation at nucleotide 4951 was confirmed by direct sequencing of the PCR product amplified from the genomic DNA. The following primers were used for this purpose: TATCAGCCTGTGCTGCAAAG and TTCGCTGCTGCAAAGTCTTG. These primers were designed based on the partial sequence of chromosome 16 that contained part of CBP (GenBank accession nos AC004495, AC004509, AC004651 and AC004760).
HAT assays
The effect of a missense mutation R1378P on HAT activity was assessed by HAT assays (17,27). As it was impossible to purify the mutant CBP protein from the wild-type CBP protein by conventional methods, we used recombinant mouse CBP with the identical mutation R1379P. Mouse CBP was used for this purpose based on the high homology between human CBP and mouse CBP (95.3% identical at protein level) (6). The GST expression vector for complete HAT domain of wild-type mouse CBP was named GST–CBP-HAT (17). GST–CBP-HATR1379P, in which Arg1379 was replaced by Pro1379, was generated from GST–CBP-HAT. A QuickChange mutagenesis kit (Stratagene) and the mutagenesis primer, GGAGGTCAAGCCAGGAATGAAGTCACCGTTTGTGGATTCTGG, were used. This nucleotide sequence corresponded to the mouse CBP cDNA sequence from nucleotides 4110 to 4151. There was a marker site for the restriction enzyme BcnI (Takara) for screening purposes. BcnI recognizes the DNA sequence CCGGG within the wild-type construct, and the mutant construct is designed to be resistant against BcnI digestion. The HAT assays were performed as previously described (16,17).
Microinjection experiments
Microinjection experiments were performed to assess the effect of the mutation on the transcriptional coactivation potency of CBP, following previously described methods (8,16). CBPR1379P, in which Arg1379 was replaced with Pro1379, was generated from mouse CBP construct containing full cDNA sequence by the same method as GST–CBP-HATR1379P. CBPL1690K,C1691L was a known mutant CBP lacking HAT activity, in which Leu1690 and Cys1691 were replaced by Lys1690 and Leu1691 (16). CBPL1690K,C1691L was able to transactivate RAR but not CREB (16). Anti-CBP antibody was used to suppress the intrinsic CBP (8). CBP, CBPR1379P and CBPL1690K,C1691L were injected into RAT-1 cells together with anti-CBP antibody. The percentage of the blue cells was counted, which indicates the intensity of the CREB-regulated transcription.
|
ACKNOWLEDGEMENTS |
|---|
We are grateful to Dr Yuko Miki (University of Tokyo, Tokyo, Japan), Drs Rikako Iwanaga and Yoriko Watanabe (University of Kurume, Fukuoka, Japan), Dr Kenji Ihara (University of Kyushu, Fukuoka, Japan), Drs Akio Hikima and Yoko Takano (University of Gunma, Gunma, Japan), Dr Tomoko Komatsu (Kanagawa Dental College, Yokosuka, Japan), Dr Hiroshi Kawame (Jikei University School of Medicine, Tokyo, Japan), Dr Yoshikazu Kuroki (Kanagawa Children’s Medical Center, Kanagawa, Japan), Dr Toshiro Nagai (Dokkyo University Koshigaya Hospital, Saitama, Japan) and Dr Kenji Kurosawa (Kanagawa-ken Eisei Kango Senmon-gakko Hospital, Kanagawa, Japan) for providing blood samples from RTS patients. Thanks must also go to Dr Fred Petrij (Leiden University, Leiden, The Netherlands) for generously providing cosmid clone RT-1 (D16S237). We also thank Dr Yasutomi Kamei (Osaka Bioscience Institute, Osaka, Japan), Dr Taro Okada (University of Kobe, Hyogo, Japan), Drs Sumito Ogawa, Junko Takita and Makiko Saito (University of Tokyo, Tokyo, Japan) for the indispensable advice and discussions about the RT–PCR–SSCP analysis and HAT assays of the mutant CBP. This study was supported by the Ministry of Health and Welfare of Japan (Grant-in-Aid for Cancer Research), the Ministry of Education, Science, Sports and Culture of Japan [Grant-in-Aid for Scientific Research on Priority Areas and Grant-in-Aid for Scientific Research (B) and (C)], the US National Institute of Health (Grant NIH 5 R01 DK 18477-24) to M.G.R.’s laboratory and the US National Institute of Health (Grant CA52599) to C.K.G.’s laboratory.
|
FOOTNOTES |
|---|
+ To whom correspondence should be addressed. Tel: +81 3 3815 5411; Fax: +81 3 3816 4108; Email: hayashiy-tky@umin.ac.jp
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
1 Rubinstein, J.H. and Taybi, H. (1963) Broad thumbs and toes and facial abnormalities. Am. J. Dis. Child., 105, 588–608.
2 Rubinstein, J.H. (1990) Broad thumb-hallux (Rubinstein–Taybi) syndrome 1957–1988. Am. J. Med. Genet., 6 (suppl.), 3–16.
3 Petrij, F., Giles, R.H., Dauwerse, H.G., Saris, J.J., Hennekam, R.C., Masuno, M., Tommerup, N., van Ommen, G.J., Goodman, R.H., Peters, D.J. et al. (1995) Rubinstein–Taybi syndrome is caused by mutations in the transcriptional co-activator CBP. Nature, 376, 348–351.[Medline]
4 Petrij, F., Dauwerse, H.G., Blough, R.I., Giles, R.H., van der Smagt, J.J., Wallerstein, R., Maaswinkel-Mooy, P.D., van Karnebeek, C.D., van Ommen, G.J., van Haeringen, A. et al. (2000) Diagnostic analysis of the Rubinstein–Taybi syndrome, five cosmids should be used for microdeletion detection and low number of protein truncating mutations. J. Med. Genet., 37, 168–176.
5 Xu, L., Glass, C.K. and Rosenfeld, M.G. (1999) Coactivator and corepressor complexes in nuclear receptor function. Curr. Opin. Genet. Dev., 9, 140–147.[Web of Science][Medline]
6 Giles, R.H., Petrij, F., Dauwerse, H.G., den Hollander, A.I., Lushnikova, T., van Ommen, G.J., Goodman, R.H., Deaven, L.L., Doggett, N.A., Peters, D.J. et al. (1997) Construction of a 1.2-Mb contig surrounding, and molecular analysis of the human CREB-binding protein (CBP/CREBBP) gene on chromosome 16p13.3. Genomics, 42, 96–114.[Web of Science][Medline]
7 Chrivia, J.C., Kwok, R.P., Lamb, N., Hagiwara, M., Montminy, M.R. and Goodman, R.H. (1993) Phosphorylated CREB binds specifically to the nuclear protein CBP. Nature, 365, 855–859.[Medline]
8 Kamei, Y., Xu, L., Heinzel, T., Torchia, J., Kurokawa, R., Gloss, B., Lin, S.C., Heyman, R.A., Rose, D.W., Glass, C.K. et al. (1996) A CBP integrator complex mediates transcriptional activation and AP-1 inhibition by nuclear receptors. Cell, 85, 403–414.[Web of Science][Medline]
9 Horvai, A.E., Xu, L., Korzus, E., Brard, G., Kalafus, D., Mullen, T.M., Rose, D.W., Rosenfeld, M.G. and Glass, C.K. (1997) Nuclear integration of JAK/STAT and Ras/AP-1 signaling by CBP and p300. Proc. Natl Acad. Sci. USA, 94, 1074–1079.
10 Yang, X.J., Ogryzko, V.V., Nishikawa, J., Howard, B.H. and Nakatani, Y. (1996) A p300/CBP-associated factor that competes with the adenoviral oncoprotein E1A. Nature, 382, 319–324.[Medline]
11 Torchia, J., Rose, D.W., Inostroza, J., Kamei, Y., Westin, S., Glass, C.K. and Rosenfeld, M.G. (1997) The transcriptional co-activator p/CIP binds CBP and mediates nuclear-receptor function. Nature, 387, 677–684.[Medline]
12 Ogryzko, V.V., Schiltz, R.L., Russanova, V., Howard, B.H. and Nakatani, Y. (1996) The transcriptional coactivators p300 and CBP are histone acetyltransferases. Cell, 87, 953–959.[Web of Science][Medline]
13 Bannister, A.J. and Kouzarides, T. (1996) The CBP co-activator is a histone acetyltransferase. Nature, 384, 641–643.[Medline]
14 Grunstein, M. (1997) Histone acetylation in chromatin structure and transcription. Nature, 389, 349–352.[Medline]
15 Kouzarides, T. (2000) Acetylation, a regulatory modification to rival phosphorylation? EMBO J., 19, 1176–1179.[Web of Science][Medline]
16 Korzus, E., Torchia, J., Rose, D.W., Xu, L., Kurokawa, R., McInerney, E.M., Mullen, T.M., Glass, C.K. and Rosenfeld, M.G. (1998) Transcription factor-specific requirements for coactivators and their acetyltransferase functions. Science, 279, 703–707.
17 Kurokawa, R., Kalafus, D., Ogliastro, M.H., Kioussi, C., Xu, L., Torchia, J., Rosenfeld, M.G. and Glass, C.K. (1998) Differential use of CREB binding protein-coactivator complexes. Science, 279, 700–703.
18 Kurokawa, R., Söderström, M., Hörlein, A., Halachmi, S., Brown, M., Rosenfeld, M.G. and Glass, C.K. (1995) Polarity-specific activities of retinoic acid receptors determined by a co-repressor. Nature, 377, 451–454.[Medline]
19 Lin, R.J., Nagy, L., Inoue, S., Shao, W., Miller, W.H. and Evans, R.M. (1998) Role of the histone deacetylase complex in acute promyelocytic leukaemia Nature, 391, 811–814.[Medline]
20 Grignani, F., De Matteis, S., Nervi, C., Tomassoni, L., Gelmetti, V., Cioce, M., Fanelli, M., Ruthardt, M., Ferrara, F.F., Zamir, I. et al. (1998) Fusion proteins of the retinoic acid receptor- recruit histone deacetylase in promyelocytic leukaemia. Nature, 391, 815–818.[Medline]
21 Warrell, R.P., He, L.Z., Richon, V., Calleja, E. and Pandolfi, P.P. (1998) Therapeutic targeting of transcription in acute promyelocytic leukemia by use of an inhibitor of histone deacetylase. J. Natl Cancer Inst., 90, 1621–1625.
22 Masuno, M., Imaizumi, K., Kurosawa, K., Makita, Y., Petrij, F., Dauwerse, H.G., Breuning, M.H. and Kuroki, Y. (1994) Submicroscopic deletion of chromosome region 16p13.3 in a Japanese patient with Rubinstein–Taybi syndrome. Am. J. Med. Genet., 53, 352–354.[Web of Science][Medline]
23 Kong, X.T., Choi, S.H., Inoue, A., Xu, F., Chen, T., Takita, J., Yokota, J., Bessho, F., Yanagisawa, M., Hanada, R. et al. (1997) Expression and mutational analysis of the DCC, DPC4, and MADR2/JV18-1 genes in neuroblastoma. Cancer Res., 57, 3772–3728.
24 Kukita, Y., Tahira, T., Sommer, S. and Hayashi, K. (1997) SSCP analysis of long DNA fragments in low pH gel. Hum. Mutat., 10, 400–407.[Web of Science][Medline]
25 Taki, T., Sako, M., Tsuchida, M. and Hayashi, Y. (1997) The t(11, 16)(q23, p13) translocation in myelodysplastic syndrome fuses the MLL gene to the CBP gene. Blood, 89, 3945–3950.
26 Ida, K., Kitabayashi, I., Taki, T., Taniwaki, M., Noro, K., Yamamoto, M., Ohki, M. and Hayashi, Y. (1997) Adenoviral E1A-associated protein p300 is involved in acute myeloid leukemia with t(11;22)(q23;q13). Blood, 90, 4699–4704.
27 Brownell, J.E. and Allis, C.D. (1995) An activity gel assay detects a single, catalytically active histone acetyltransferase subunit in Tetrahymena macronuclei. Proc. Natl Acad. Sci. USA, 92, 6364–6368.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  E. D. Eliseeva, V. Valkov, M. Jung, and M. O. Jung Characterization of novel inhibitors of histone acetyltransferases Mol. Cancer Ther., September 1, 2007; 6(9): 2391 - 2398. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Forster, S. Gallinat, J. Jablonska, S. Weiss, H.-P. Elsasser, and W. Lutz p300 Protein Acetyltransferase Activity Suppresses Systemic Lupus Erythematosus-Like Autoimmune Disease in Mice J. Immunol., June 1, 2007; 178(11): 6941 - 6948. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Verdone, E. Agricola, M. Caserta, and E. Di Mauro Histone acetylation in gene regulation Brief Funct Genomic Proteomic, September 1, 2006; 5(3): 209 - 221. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Anderson, R. Bhandari, and J. P. Kumar A Genetic Screen Identifies Putative Targets and Binding Partners of CREB-Binding Protein in the Developing Drosophila Eye Genetics, December 1, 2005; 171(4): 1655 - 1672. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Kishimoto, T. Kohno, K. Okudela, A. Otsuka, H. Sasaki, C. Tanabe, T. Sakiyama, C. Hirama, I. Kitabayashi, J. D. Minna, et al. Mutations and Deletions of the CBP Gene in Human Lung Cancer Clin. Cancer Res., January 15, 2005; 11(2): 512 - 519. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Balasubramanyam, R. A. Varier, M. Altaf, V. Swaminathan, N. B. Siddappa, U. Ranga, and T. K. Kundu Curcumin, a Novel p300/CREB-binding Protein-specific Inhibitor of Acetyltransferase, Represses the Acetylation of Histone/Nonhistone Proteins and Histone Acetyltransferase-dependent Chromatin Transcription J. Biol. Chem., December 3, 2004; 279(49): 51163 - 51171. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. P. Kumar, T. Jamal, A. Doetsch, F. R. Turner, and J. B. Duffy CREB Binding Protein Functions During Successive Stages of Eye Development in Drosophila Genetics, October 1, 2004; 168(2): 877 - 893. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. H. Lund and M. van Lohuizen Epigenetics and cancer Genes & Dev., October 1, 2004; 18(19): 2315 - 2335. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Balasubramanyam, M. Altaf, R. A. Varier, V. Swaminathan, A. Ravindran, P. P. Sadhale, and T. K. Kundu Polyisoprenylated Benzophenone, Garcinol, a Natural Histone Acetyltransferase Inhibitor, Represses Chromatin Transcription and Alters Global Gene Expression J. Biol. Chem., August 6, 2004; 279(32): 33716 - 33726. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. S. Mitsiades, N. S. Mitsiades, C. J. McMullan, V. Poulaki, R. Shringarpure, T. Hideshima, M. Akiyama, D. Chauhan, N. Munshi, X. Gu, et al. Transcriptional signature of histone deacetylase inhibition in multiple myeloma: Biological and clinical implications PNAS, January 13, 2004; 101(2): 540 - 545. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H.T. BJORNSSON, H. CUI, D. GIUS, M.D. FALLIN, and A.P. FEINBERG The New Field Of Epigenomics: Implications for Cancer and Other Common Disease Research Cold Spring Harb Symp Quant Biol, January 1, 2004; 69(0): 447 - 456. [Abstract] [PDF]
|
|
|
|
|
|
Y.-L. Yao and W.-M. Yang The Metastasis-associated Proteins 1 and 2 Form Distinct Protein Complexes with Histone Deacetylase Activity J. Biol. Chem., October 24, 2003; 278(43): 42560 - 42568. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Balasubramanyam, V. Swaminathan, A. Ranganathan, and T. K. Kundu Small Molecule Modulators of Histone Acetyltransferase p300 J. Biol. Chem., May 23, 2003; 278(21): 19134 - 19140. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Mitsiades, C. S. Mitsiades, P. G. Richardson, C. McMullan, V. Poulaki, G. Fanourakis, R. Schlossman, D. Chauhan, N. C. Munshi, T. Hideshima, et al. Molecular sequelae of histone deacetylase inhibition in human malignant B cells Blood, May 15, 2003; 101(10): 4055 - 4062. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Kalkhoven, J. H. Roelfsema, H. Teunissen, A. den Boer, Y. Ariyurek, A. Zantema, M. H. Breuning, R. C.M. Hennekam, and D. J.M. Peters Loss of CBP acetyltransferase activity by PHD finger mutations in Rubinstein-Taybi syndrome Hum. Mol. Genet., February 15, 2003; 12(4): 441 - 450. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Lu, C. A. Pise-Masison, T. M. Fletcher, R. L. Schiltz, A. K. Nagaich, M. Radonovich, G. Hager, P. A. Cole, and J. N. Brady Acetylation of Nucleosomal Histones by p300 Facilitates Transcription from Tax-Responsive Human T-Cell Leukemia Virus Type 1 Chromatin Template Mol. Cell. Biol., July 1, 2002; 22(13): 4450 - 4462. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O Bartsch, K Locher, P Meinecke, W Kress, E Seemanova, A Wagner, K Ostermann, and G Rodel Molecular studies in 10 cases of Rubinstein-Taybi syndrome, including a mild variant showing a missense mutation in codon 1175 of CREBBP J. Med. Genet., July 1, 2002; 39(7): 496 - 501. [Full Text] [PDF]
|
|
|
|
|
|
E. Kalkhoven, H. Teunissen, A. Houweling, C. P. Verrijzer, and A. Zantema The PHD Type Zinc Finger Is an Integral Part of the CBP Acetyltransferase Domain Mol. Cell. Biol., April 1, 2002; 22(7): 1961 - 1970. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Hendrich and W. Bickmore Human diseases with underlying defects in chromatin structure and modification Hum. Mol. Genet., October 1, 2001; 10(20): 2233 - 2242. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||