Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (36)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Morey, C.
Right arrow Articles by Clerc, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Morey, C.
Right arrow Articles by Clerc, P.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2001, Vol. 10, No. 13 1403-1411
© 2001 Oxford University Press

Tsix-mediated repression of Xist accumulation is not sufficient for normal random X inactivation

Céline Morey, Danielle Arnaud, Philip Avner and Philippe Clerc+

Génétique Moléculaire Murine, Institut Pasteur, 25 rue du Docteur Roux, Paris 75015, France

Received March 15, 2001; Revised and Accepted April 27, 2001.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
During the X inactivation process, one X chromosome in each female embryonic cell is chosen at random to become coated by Xist RNA and silenced. Tsix, a transcript anti-sense to Xist, participates in the choice of the inactive X and in Xist regulation through as yet unknown mechanisms. Undifferentiated female ES cells, which have two active Xs, recapitulate random X inactivation when induced to differentiate. A 65 kb deletion targeted to one of the two Xs in a female ES cell line, and including both the end of the Xist gene and the site of initiation of Tsix, resulted in the exclusive inactivation of the deleted X in differentiated ES cells. We have re-examined the phenotype of the 65 kb deletion and targeted Tsix and the terminal exons of Xist back to the deleted locus using a cre/loxP site-specific re-insertion strategy. We show that prior to inactivation the deleted X is associated in undifferentiated ES cells with both increased Xist expression and diffusion of the Xist transcript away from its site of synthesis. Restoration of Tsix repressed the steady-state level of Xist expression and restricted Xist RNA to its transcription site. At the onset of inactivation in differentiated ES cells, restoration of Tsix failed to restore random X-inactivation, even though the levels of Xist RNA accumulation in cis were markedly reduced. These results identify for the first time a dual function for Tsix as both a repressor of the steady-state level of Xist expression and as a regulator of the distribution of Xist RNA within the nucleus. They also establish that random inactivation requires mechanisms additional to the in cis repression of Xist.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In mammals, X chromosome inactivation has as its main function the control of the transcriptional status of X-linked genes during and after development, depending on the sex of the individual (1; for review see 2). A counting process results in the inactivation of a single X in female diploid cells (two Xs), and in an absence of inactivation in the male cells (one X). Random choice of the inactive elect X occurs in each cell of the female embryo proper, whereas imprinting mechanisms result in exclusive inactivation of the paternal X in female extra-embryonic tissues. Counting and choice, as well as the silencing process itself, are dependent on an X-linked locus, the X inactivation centre (Xic). The dominant function of the Xic as an inducer of silencing in cis has been established by transgenesis (37). Another genetic element termed X controlling element (Xce) (8), maps within the Xic and affects the randomness of X inactivation through as yet uncharacterized mechanisms.

The X inactive specific transcript gene (Xist), which maps within the Xic, produces a large untranslated nuclear RNA (9). Targeted deletions have shown that Xist expression is necessary for silencing in cis, but not for counting (10,11). Sequences within the Xist gene have also been associated with choice (12). Xist metabolism can be studied in vitro using female ES cells which have two active Xs and recapitulate random X inactivation upon differentiation (11,13,14). In the nuclei of female ES cells, low levels of unstable Xist RNA are detected by RNA-fluorescence in situ hybridization (RNA-FISH) as single dots or ‘pinpoints’ which correspond to the sites of Xist transcription (13,15,16). At the onset of X inactivation in differentiating female ES cells, Xist RNA from the inactive elect X accumulates and coats this X chromosome (15,16), whereas Xist expression from the active X is progressively extinguished (15,16). The coating by Xist RNA of the inactive elect X is currently interpreted as resulting from the accumulation of Xist transcripts consecutive to both increased RNA expression and stabilization (1517).

The role of the region downstream of the Xist gene was initially established by studies on a 65 kb cre-loxP deletion lying 3' to Xist exon 7 (14). The proximal part of this deletion contains the end of the Xist gene (16,18) which have been suggested to be functionally important (19), and the site of initiation for a large transcript named Tsix which extends antisense through the entire Xist gene (20). The initiation site of Tsix is associated with a CpG island and a 34mer minisatellite termed DXPas34 (18,21). Deletions centred on these three elements in ES cells (22,23) resulted in exclusive Xist RNA coating and silencing of the chromosome bearing the deletion at the onset of X inactivation (22,23), similar to the 65 kb deletion (14). These results suggest that the Tsix antisense transcript is necessary for normal random choice of the inactive X (23). However, the mechanism through which Tsix acts on choice remains unknown. Differences in the phenotype of the 65 kb deletion and of that confered by deletion of the Tsix initiation site alone, suggest that factors encoded within the 65 kb deletion other than Tsix may be necessary for normal random X inactivation. Whilst the Tsix deleted X remained active in the absence of a second Xic element in differentiating male ES cells, the 65 kb deleted X underwent inactivation in similar circumstances in an essentially XO cell line (14,23).

Tsix was recently shown to control Xist expression during imprinted X inactivation in the extra-embryonic lineages (24,25). However, in the embryonic lineages, the effects of Tsix on Xist expression during random X inactivation remain unclear. Tsix has been proposed to control Xist, since extinction of the antisense RNA-FISH signal within the core of the Xist gene was reported to precede the accumulation of Xist RNA at the onset of inactivation, (23). However, a more complex regulation is suggested by the observation that extinction of the antisense transcription does not always necessarily precede the accumulation of Xist RNA (22). A complex regulation is also suggested by the differences in phenotype of the various 3' to Xist mutations studied so far. Prior to X inactivation, both the 65 kb deletion of the endogenous Xic in female ES cells and deletion of the Tsix initiation site in the context of a transgenic Xic array resulted in a dramatically reduced expression of Xist as estimated by RNA-FISH (14,22). Targeted deletion of the Tsix initiation site of one of the endogenous Xics in a female ES cell line, however, resulted in a modest increase in Xist expression prior to inactivation, as estimated by semi-quantitative RT–PCR, and had no effect at the level of RNA-FISH (23).

We wished to address the role of the terminal Xist exon and of Tsix in the regulation of Xist and X inactivation. We demonstrate that in undifferentiated ES cells, the original 65 kb deleted X produces substantially reduced amounts of antisense transcript and increased steady-state levels of Xist RNA as measured by quantitative RT–PCR, whilst showing reduced amounts of Xist transcript associated with the site of synthesis as judged by RNA-FISH. This suggests that retention of Xist RNA at its site of synthesis is altered on the deleted X in undifferentiated ES cells, a result confirmed by the presence of scattered weakly detectable Xist RNA in some nuclei. Both the steady-state levels of Xist RNA, and the retention of Xist transcripts at their site of synthesis, were returned to normal in undifferentiated ES cells following the restoration of antisense transcription through cre/loxP site-specific complementation. In contrast, re-insertion of the end of the Xist gene alone was without effect. Tsix may therefore control in cis both the expression level and the nuclear distribution of Xist RNA in undifferentiated ES cells. Random X inactivation was not restored after differentiation of ES cell lines in which Tsix activity was re-established, despite a marked repression of Xist accumulation in cis. Our results suggest that Tsix represses the initiation of X inactivation in cis but is insufficient for normal random choice.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cre/loxP re-insertions into the {Delta}X chromosome
The 65 kb genomic deletion that we generated in one of the two Xs of the D102 female ES cell line (14) left in place a loxP site into which a circular DNA molecule, also bearing a loxP site, could be targeted via a cre reverse reaction (Fig. 1). The re-insertion strategy we have used to generate the complemented alleles, introduces mouse sequences surrounded by a neomycin resistance transcription unit in 5' and the Bluescript backbone in 3'. It is unlikely that the neomycin cassette interferes with regulatory mechanisms in the region, since it is present in exactly the same position in the fL (undeleted and floxed) allele which shows a normal pattern of Xist expression and X inactivation (14 and this study). The Bluescript backbone and the distal phleomycin cassette lacking a promoter sequence, can similarly be excluded as a potential sources of artifacts since they are common to add-backs which show different phenotypes (see below).



View larger version (14K):
[in this window]
[in a new window]
 
Figure 1. Strategy for the selection and screening of cre/loxP site-specific re-insertions. N, neomycin resistance orf; H, hygromycin resistance gene; P, phleomycin resistance ORF; black triangles, loxP sites; striped boxes surmounted by an arrow, promoter. The proximal loxP site in L1 is located between the cap site and the first ATG of the neomycin resistance gene. Site specific re-insertion at the loxP site in L3 is obtained through co-transfection of a cre-expression plasmid and of a plasmid bearing a loxP site fused to the neomycin resistance ORF, mouse DNA sequences of interest (thick gray line) and the bluescript backbone (thick black line). Cells bearing a site-specific insertion become neomycin resistant and positive for the PCR assay am1-ph2. L4 differs from L1 only by an ISceI site (i) used for analytical purposes.

 
In order to examine the function of the terminal Xist exon and of the Tsix transcription unit, sequences spanning up to 16 kb 3' to Xist exon 7, were added back to the {Delta}X (deleted X) (Fig. 2A). The {Delta}+5 X in the c5.1 ES cell line is complemented for the end of the Xist gene plus 2.8 kb of downstream sequence. The {Delta}+16 X in the c.16.1 ES cell line is complemented for the end of the Xist gene plus 14 kb of sequence extending 517 bp distal of the Tsix initiation site (20). Two ES cell clones (Fig. 2B) were analysed for each re-insertion. Only data for a single clone is presented as the independent clones gave essentially identical results. The structure of the complemented regions in the ES cell lines was verified by Southern blot analysis (Fig. 2C).



View larger version (24K):
[in this window]
[in a new window]
 
Figure 2. Complementation of the 65 kb deletion 3' to Xist exon 7. (A) Structure of the floxed (fL), deleted ({Delta}), and complemented X chromosomes ({Delta}+5 and {Delta}+16). The fL and {Delta} X chromosomes were described previously under the names LbPa and {Delta}bPa, respectively (14). 2, 7 and 8, Xist exons; 17, 17mer minisatellite; 34, 34mer minisatellite constitutive of the DXPas34 element; CpG, CpG island; is, initiation site for Tsix; Boxed u, v and w, DNA probes. Dotted lines represent missing regions. A, ApaI; al, ApaLI; n, NdeI; i, ISceI; h, HindIII. Only restriction sites relevant to the analysis in (C) are shown. (B) The female ES cell lines described in this study contain a bPa X chromosome derived from Mus musculus musculus (14) and an X chromosome of 129/Sv origin. The mutations have all been targeted to the bPa X chromosome, the 129/Sv X was left unmutated (wt, wild-type). Two ES cell clones for each re-insertion were analysed. (C) Expected size of the restriction fragments detected with the u, v and w probes, and Southern blot analysis of the ES cell lines. Asterisks mark the bands originating from the unmutated 129 X chromosome.

 
Xist RNA expression is repressed by the region lying 3' to Xist in ES cells
The 65 kb region lying 3' to Xist exon 7 has been suggested, on the basis of a highly reduced Xist pinpoint on the {Delta}X, to contain an activator element for Xist expression in undifferentiated ES cells (14). We were therefore surprised that allele-specific RT–PCR analysis of the D102 ES cell line detected an excess of Xist RNA expressed from the {Delta}X compared to that expressed from the intact 129 X (Fig. 3A). To clarify this, allele-specific quantification of Xist RNA was performed by real-time quantitative RT–PCR in undifferentiated ES cells. The steady-state level of Xist RNA transcribed from the {Delta}X was ~3-fold higher than that transcribed from the fL X (Fig. 3B). This suggests that the 65 kb region lying 3' to Xist exon 7 contains a repressor element for Xist expression acting in the undifferentiated ES cell. The loxP-associated cassettes by themselves had no effect on Xist expression since the fL X in the E3.4 ES cell line expressed levels of Xist RNA closely similar to those of the unfloxed bPa allele in the wild-type parental ES cell line (data not shown). The re-insertion of the Xist terminal exon plus 2.8 kb of downstream sequence did not restore Xist RNA steady-state levels to normal (Fig. 3B). The larger re-insertion in the {Delta}+16 X was however sufficient to restore the normal and low levels of Xist expression which characterize the floxed X (Fig. 3B). Since significant X aneuploidy was not detected in any of the ES cell populations (allelic quantification at the genomic level, Fig. 3B), we conclude that the region 3' to Xist extending up to and including the Tsix initiation site acts as a repressor of Xist expression. The capacity of this region to restore to normal the steady-state level of Xist RNA suggests that it is likely to be the only repressor element within the 65 kb genomic span.



View larger version (39K):
[in this window]
[in a new window]
 
Figure 3. Allelic quantification and RNA-FISH analysis of Xist RNA expression in undifferentiated ES cells. (A) The allelic ratio of Xist RNA in the indicated ES cell lines was evaluated by Southern blot detection (probe Xex6Up, open box) and HindIII digestion of random-primed MIX20/MX23b RT–PCR products. h, HindIII site; h*, polymorphic HindIII site absent from the bPa X chromosome (14,28). Location and size of the bPa and 129 specific products detected in this assay are shown under a partial map of the Xist cDNA. The Southern blot shows the HindIII restriction profiles of the PCR products. u, uncut; c, cut. The amount of bPa Xist RNA expressed from the {Delta} X exceeds that of 129 Xist RNA in the D102 ES cells. (B) Allelic quantification of Xist RNA in ES cells. The partial map of Xist cDNA shows the allele-specific primers obPa and o129, the TaqMan probe TMxe5 (open line), and the primer Xc1 which crosses exonic junction V–VI. Duplex RT–PCR for Xist and for 18S were performed on randomly-primed cDNAs using real-time PCR (Perkin-Elmer). Columns and bars show the means ± SD (n = 4), expressed in arbitrary units, of the amount of Xist transcript of each allelic form standardized over 18S RNA. The elevated amounts of bPa Xist RNA in the D102 ES cell line is returned to normal in the c16.1 but not in the c5.1 ES cell lines. Similar results were obtained with at least two additional independent cultures per cell line. The allelic ratios at the cDNA and genomic levels are indicated under the graph. The allelic genomic ratios were determined on DNA samples by duplex real-time PCR for Xist and for 18S using the o129 or obPa allelic Xist primers and genomic Xist primer Xg1. (C) Xist and neomycin double RNA-FISH on undenatured DAPI-stained ES cell nuclei. The Xist RNA signal alone (left panel, probe L510 spanning most of the Xist gene, green), or merged with the neomycin red signal (right panel) are shown for a single nucleus of each indicated cell line. The red neomycin signals identify the mutated Xist locus of the complemented X chromosomes (bPa alleles). L510 shows a faint signal on the {Delta}+5 X (bPa) in the c5.1 cell line and a restored signal on the {Delta}+16 X (bPa) in the c16.1 cell line. (DF) After increasing detection sensitivity, very faint sparkles of Xist RNA were observed in 15% (n = 500) of the c5.1 ES cell nuclei using the double-stranded Xist probe L510 (D and E) and sense-specific probe ExMS (F) in green. As shown in (D), the Xist sparkles were scattered around the {Delta}+5 Xist locus, with some fluorescent particles drifting away. Note that although Xist sparkles are present, the site of transcription of Xist (physically located by the neomycin red signal) does not show a significant Xist RNA pinpoint. (E) The cells presenting Xist sparkles were undifferentiated on the basis of Oct3/4 expression (red signal).

 
Xist RNA localization is dependent on the region lying 3' to Xist in ES cells
The discrepancies between our RNA-FISH and quantitative RT–PCR data for the D102 ES cell line led us to undertake an RNA-FISH analysis of the complemented ES cell lines. Using the double-stranded L510 FISH probe, a highly reduced Xist pinpoint was detected from the {Delta}+5 X (Fig. 3C, c5.1), similar to that previously detected from the {Delta} X (14). On the other hand, the Xist RNA pinpoint on the {Delta}+16 X presented an aspect and intensity similar to that of the 129 Xist RNA pinpoint (Fig. 3C, c16.1). Essentially identical results were obtained when using the sense-specific RNA-FISH probe ExMS (spanning the end of Xist exon 1 and Xist intron 1; data not shown) : a reduced pinpoint was observed from the {Delta}+5 X and a restored pinpoint from the {Delta}+16 X. Surprisingly, when comparing quantitative RT–PCR and RNA-FISH results in all our cell lines, we observe an inverse correlation between the intensity of the Xist pinpoint and the amount of Xist RNA. A weak pinpoint is associated with high steady-state level of Xist expression. A strong pinpoint is associated with low steady-state levels of Xist RNA expression. Interestingly, the region distal to Xist extending up to and including the Tsix initiation site promotes the presence of elevated amounts of Xist RNA at or close to its transcription site while repressing overall Xist RNA expression in undifferentiated ES cells.

Our quantitative RT–PCR results imply that significant amounts of Xist RNA must have remained undetected by RNA-FISH in undifferentiated ES cells of the lines D102 and c5.1. We re-examined this issue by increasing camera acquisition times and investigating areas of the nucleus outside of the immediate Xist transcription site. Under these conditions, faint dots scattered around the Xist locus of the {Delta} and {Delta}+5 Xs could be detected in ~15% of the nuclei of the D102 and c5.1 ES cell lines using either the double-stranded L510 or the sense-specific ExMS RNA-FISH probes (Fig. 3D and F; D102 not shown). The ES cells in which such scattered Xist RNA signals could be detected were fully undifferentiated as estimated by their expression of the Oct3/4 gene (26) (Fig. 3E). We conclude that Xist RNA expressed from the {Delta} and {Delta}+5 Xs in undifferentiated ES cells diffuses away from the transcription site, hampering its detection by RNA-FISH. Since such patterns of Xist RNA signals were not observed with the {Delta}+16 X, Xist retention at its site of synthesis must be dependent on the larger region extending to and including the Tsix initiation site.

Antisense transcription is restored by the 16 kb add-back
Antisense transcription within the Xist gene was analysed by allele-specific strand-specific RT–PCR (Fig. 4A). Antisense transcription was found to be markedly reduced from the {Delta} and {Delta}+5 Xs in the undifferentiated D102 and c5.1 ES cells as compared with the fL X in the E3.4 ES cell line (Fig. 4B). In agreement with the previous mapping of Tsix initiation distal to the 34mer minisatellite (20), antisense transcription was restored on the {Delta}+16 X of the c16.1 ES cell line to a level comparable to that found in the E3.4 ES cell line (Fig. 4B).



View larger version (59K):
[in this window]
[in a new window]
 
Figure 4. Allele-specific RT–PCR and RNA-FISH analysis of antisense transcription within the Xist gene in undifferentiated ES cells. (A) An allele-specific assay for antisense transcription within the Xist gene based on strand-specific reverse transcription initiated using the intronic primer IntII, HindIII restriction of the MIX20/MX23b RT–PCR products, and detection of the polymorphic restriction products by Southern blot hybridization using probe Xin3Nlo (open box). H, HindIII site; h*, polymorphic HindIII site absent from the bPa X chromosome (14,28). Shaded boxes, Xist exons 2–6. Location and size of the bPa and 129 specific products detected in this assay are shown under the map. (B) Southern blot showing the HindIII restriction profiles of the MIX20/MX23b PCR products. u, uncut; c, cut. The bPa allelic form is highly reduced in the D102 and c5.1 ES cell lines, and restored in the c16.1 ES cell lines. Three cell culture samples for each cell line provided essentially identical results. The results presented here correspond to the same cell culture samples as in Figure 2B which have been shown devoid of significant X aneuploidy (Fig. 2B). (C) Double RNA-FISH on undenatured DAPI-stained nuclei of the indicated ES cell lines using antisense-specific probe ExMAS (in red), and a neomycin probe (in green). Two images of the same nucleus are presented : the Xist locus antisense signal is shown alone in the left panel and merged with the neomycin signal in the right panel. Green signals, which appear as yellow when superimposed on red signals, identify the neomycin transcription site of the {Delta}+16, and {Delta}+5 X chromosomes. Antisense transcription within the Xist gene is readily detected on the 129 and {Delta}+16 X chromosomes but not on the {Delta}+5 X chromosome. Duplicate experiments gave identical results.

 
Antisense transcription within the Xist gene was also analysed by strand-specific RNA-FISH. No antisense transcription could be detected in association with the {Delta}+5 (Fig. 4C) and {Delta} Xs (not shown). The levels of antisense transcription within the Xist gene associated with the 129 and {Delta}+16 Xs in the undifferentiated c16.1 ES cells were closely similar (Fig. 4C). We conclude from our RT–PCR and RNA-FISH analysis that Tsix transcription is restored in the {Delta}+16 X.

At the onset of X inactivation, Tsix represses Xist accumulation in cis but does not restore random choice
The complemented ES cell lines were differentiated and analysed by RNA-FISH. In c5.1 and c16.1 ES cells differentiated for 3 days, Xist RNA domains were never associated with the 129 X (Fig. 5A and B). Restoring the terminal Xist exon or restoring Tsix was therefore insufficient to ensure normal random choice. Based on the number of cells presenting a nuclear domain showing Xist RNA accumulation, the induction of X inactivation appeared more efficient in the D102 and c5.1 ES cell lines than in the c16.1 ES cell line (data not shown). In order to quantify these observations, we analysed the kinetics of Xist expression during ES cell differentiation. In the E3.4 ES cell line, random X inactivation is expected to be slightly biased in favor of the 129 X carrying the Xcea allele to the detriment of the fL X bearing the Xcec allele (11). In agreement with this, higher levels of 129-Xist RNA than of fL-Xist RNA were detected upon differentiation of the E3.4 ES cell line (Fig. 5C). Quantitative RT–PCR analysis confirmed the complete bias of inactivation towards the {Delta}, {Delta}+5 and {Delta}+16 Xs in the D102, c5.1 and c16.1 ES cell lines (Fig. 5C). Previous work have shown that the bias in the differentiated D102 ES cells is a primary event (14). Similarly, the bias of inactivation in the c5.1 and c16.1 differentiated ES cells is likely to be a primary event since no increase in the levels of Xist RNA expressed from the 129/Sv allele could be detected even at the earliest time points of differentiation (day 1 and day 2). Interestingly, the {Delta} X appeared significantly more efficient in the induction of Xist RNA expression upon ES cell differentiation than the fL X (Fig. 5C). This suggests that elements which normally mediate cis-repression of the initiation of X inactivation are located within the 65 kb deletion. The end of the Xist gene is apparently insufficient for this, since the {Delta}+5 X also shows increased levels of Xist RNA expression when compared to the fL X (Fig. 5C). We conclude that Tsix is likely to be responsible for much of this repressive function since induction of Xist RNA expression from the {Delta}+16 X is similar to that from the fL X.



View larger version (32K):
[in this window]
[in a new window]
 
Figure 5. Exclusive Xist RNA coating of the deleted X is maintained following restoration of Tsix. (A and B) Two-color DNA–RNA-FISH on denatured DAPI-stained nuclei of ES cells differentiated for 3 days. Xist DNA and RNA were detected with probe L510 (in red) and the region distal to DXPas34 was detected with probe L23 (green) [L23 is a mixture of lambda genomic clones IB6 and IVC3 (31)]. Probe L23 did not detect a signal from the {Delta}+5 and {Delta}+16 X chromosomes which lack the corresponding sequences. Overlapping green and red signals appear as yellow. In the c5.1 (A) and c16.1 (B) ES cell lines, 97% (n = 200) of the Xist domains were unambiguously associated with the {Delta}+5 and {Delta}+16 X chromosomes, indicating completely biaised X inactivation. (C) Means ± SD (n = 4) of allelic quantification of Xist RNA (as described in Fig. 2) after ES cell differentiation in embryoid bodies. Data from a single experiment, in which the four cell lines were differentiated in parallel, are shown. A duplicate experiment showed similar differences between the ES cell lines. Similar results were also observed in cell cultures differentiated using an adherent cell differentiation model (not shown). The arbitrary units (a.u.) for expressing the normalized quantities of Xist RNA are the same as in Figure 2. These results show a complete bias of inactivation towards the {Delta}, {Delta}+5 and {Delta}+16 Xs (bPa alleles) in the D102, c5.1 and c16.1 ES cell lines. Upon ES cell differentiation, Xist expression from the {Delta} and {Delta}+5 X chromosomes in the D102 and c5.1 ES cell lines is significantly increased as compared to that from the fL and the {Delta}+16 X chromosomes in the E3.4 and c16.1 ES cell lines.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Our study addresses the function of the terminal Xist exon and of Tsix prior to and at the onset of X inactivation through the use of a cre/loxP site-specific re-insertion strategy able to target back elements to the original 65 kb deletion distal to Xist exon 7 that we had previously generated in a female ES cell line. Reanalysis of the original 65 kb deletion identified three modifications of Xist expression in undifferentiated ES cells: an increase in the steady-state expression of Xist RNA, a dramatic reduction in the amount of Xist RNA associated with the transcription site, and the occasional occurrence of scattered accumulations of nuclear Xist RNA. All three phenotypes were suppressed by the restoration of antisense transcription within Xist following re-insertion of material extending through the terminal Xist exon to the Tsix initiation site. In contrast, restoration of the end of the Xist gene alone was without effect. In differentiated ES cells, the presence of the 65 kb deletion in an XX cell line had previously been shown to be associated with a complete absence of inactivation of the unmutated X. Allele-specific quantitation of Xist expression now reveals this to be associated with an increase in the efficiency of the induction of Xist expression from the deleted X. Importantly, while re-insertion of material extending through the terminal Xist exon to the Tsix initiation site was associated with a return to normal in the efficiency of Xist RNA accumulation in cis, this did not restore random X inactivation.

The steady-state level of Xist RNA expression from the {Delta}X was increased some 3-fold in undifferentiated ES cells. Although statistically significant, this increase is relatively modest compared to the 20-fold increase in Xist expression from the {Delta}X observed during ES cell differentiation. The increase in Xist expression that we have observed is compatible with that seen by a semi-quantitative RT–PCR in ES cells deleted for the Tsix initiation site (23). Such results do not support the idea that DXPas34 element acts as an enhancer of Xist expression (22).

It was striking in our study to note that in undifferentiated ES cells, a reduction in the quantity of Xist transcripts associated with the transcription site on the deleted X accompanied the increase in steady-state level of Xist RNA. This result underlines the importance of parallel RNA-FISH and quantitative RT–PCR studies in analysing Xist expression. This altered relationship between the total amount of Xist RNA present in the nucleus and the amount associated with the transcription site might be a reflection of more rapid RNA export away from the transcription site. This would result in reduced amounts of Xist RNA being associated with the transcription site, and might cause indirectly an increase in the rate of transcription. The mechanism(s) which control the export of transcripts away from their site of synthesis, whilst poorly understood, are likely to include splicing. Indeed, trapping of ß-globin mRNA at the transcription site has been shown for mutations of the ß-globin gene with defective splicing (27). Alternatively, a large increase in the stability of the Xist RNA combined with a moderate reduction in the rate of transcription could result in the observed ’ weak pinpoint, high level of Xist RNA expression’ phenotype. However, preliminary data from an ongoing study of Xist half-life following transcriptional inhibition, suggest that the stability of Xist RNA is not modified in the ES cell mutants described here (data not shown). Distinguishing between the various hypotheses will require both transcription rates to be measured by run-on experiments and our evaluations of Xist RNA stability to be confirmed.

Faint Xist RNA signals were observed scattered around the Xist locus on the deleted X in ~15% of the nuclei. These faint signals are referred to as ‘Xist sparkles’. The apparent heterogeneity of the D102 and c5.1 ES cell nuclei for such Xist sparkles, might either reflect the difficulty in detecting very weak signals, or alternatively the real absence of scattered Xist RNA in some nuclei. Our attempts to further increase FISH detection sensitivity have been unsuccessful due to concomitant increases in background signal. It remains possible therefore that the Xist sparkles are the detectable fraction of a larger distribution of Xist RNA molecules in the nuclei. The inability of RNA-FISH to detect low concentrations of target molecules suggests that the Xist RNA pinpoint seen in normal undifferentiated ES cells might represent only a fraction of the total Xist nuclear RNA. If confirmed, this could have important implications for our understanding of the mechanisms of X inactivation. We believe in any case, that the Xist sparkles account, at least in part, for the elevated amounts of Xist RNA expressed from the {Delta} X that we detected by quantitative RT–PCR. The appearance of Xist sparkles must be both stochastic and reversible as no sustained variation or tendency in the levels of detectable ‘sparkles’ was observed during successive cell passages of the different cell lines. Moreover all the subclones of the D102 cell line lacking Tsix that we tested (c5.1 and c5.2 and other unpublished subclones) showed similar levels of heterogeneity for the Xist sparkles. Interestingly, profiles reminiscent of Xist sparkles have been observed in other experimental situations where transient and reversible or inappropriate initiation of X inactivation occurred: e.g. early differentiating ES cells carrying single or low-copy YAC transgenes (7), and human/mouse hybrid cells re-activated for XIST RNA expression from the human active X (28). In the D102 cell line the faint dots corresponding to the Xist RNA signal were often widely dispersed within the nuclei, suggesting a capacity for diffusion which differs markedly from the accumulation of Xist RNA associated with the inactive X in somatic female cells. Xist sparkles are clearly not associated with transcriptional silencing in ES cells, as shown by the continuing expression of both the neomycin (Fig. 2D) and Brx genes (not shown). We hypothesize therefore that the deleted X engages partially in the pathway leading to X inactivation initiation, but in an incomplete, stochastic and reversible manner. This partial and illegitimate initiation of X inactivation would be compatible with the relatively modest increase in the steady-state amount of Xist RNA that we observed in ES cells carrying the deletion.

Interestingly, the three Xist expression phenotypes associated with the {Delta} X in undifferentiated ES cells, were all fully suppressed following restoration of the Tsix transcription. This observation underlines the importance of Tsix sequences in the regulation of Xist metabolism. Tsix may therefore not only function as a repressor of the steady-state level of Xist expression, but also as a regulator of Xist RNA distribution within the nucleus. Could a direct causal relationship exist between increased Xist expression, decreased Xist association with its site of transcription and the occurrence of Xist sparkles? This would suggest that Tsix acts through a single target instead of acting at multiple levels of Xist metabolism. It has recently been suggested that an increase in Xist expression may trigger the stabilization and accumulation of Xist RNA in undifferentiated ES cells (17). It is tempting to speculate that association of Xist RNA with its transcription site might promote its local degradation thereby preventing its diffusion into neighbouring nuclear territories. A physical interaction between Xist RNA and the antisense RNA has not as yet been reported, but could similarly result in spatial confinement of both transcripts and in local regulation of their stability through mechanisms similar to RNAi.

In differentiated ES cells, the induction of Xist expression was significantly more efficient from the {Delta} X than from the parental floxed X. Re-insertion of Tsix resulted in back-to-normal levels of Xist expression following differentiation. The end of the Xist gene does not account for this effect since re-insertion of this element alone was without effect. Our results are the first experimental demonstration of the existence of a repressive effect of Tsix in cis on Xist expression during X inactivation. This represssive effect was previously postulated in order to explain the role of Tsix in choice (23). Exclusive choice of an X lacking Tsix was hypothesized to result from a lack of repression of the initiation of inactivation from the mutated X. Restoration of Tsix antisense expression in the {Delta}+16 X would have in this case been expected to restore at least partially, the capacity of the unmutated 129 X to be elected as the inactive X in differentiated ES cells. This was not observed for two independent cell clones. We conclude that expression of the Tsix antisense transcript from both Xs in female ES cells is insufficient for normal random choice. Our result in no way contradicts previous reports which have shown that Tsix expression is necessary for random X inactivation. The dissociation that we have observed between random choice and cis-repression, however, suggests that the former is not dependent solely on either Tsix or at least on its repressive effect. The functional element missing from our re-insertions and necessary for normal random choice, must either lie within the more distal part of the 65 kb deletion or be constituted by an epigenetic mark which cannot be restored by naked DNA. The former hypothesis is supported by the phenotypic differences existing between the {Delta}X and {Delta}CpG deletions in male or XO- differentiated ES cells (14,23). It is moreover possible that distal elements involved in the regulation of Tsix itself might be functionally important for choice. Such complexities underlying the process of random X inactivation can be addressed by the successive and reiterative use of the site-specific re-insertion strategy described here.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Site-specific cre/loxP re-insertion
The D102 ES cell line was electroporated using a mixture of the cre-expressing pOG231plasmid and the pLON plasmid to be inserted (see below). Thirty to 40 h later, neomycin was added to the cultures (0.25 mg/ml for the first 2 days, then 0.4 mg/ml). Colonies were picked and PCR screened using primers am1 and ph2. After preliminary FISH analysis for X aneuploidy, two positive clones for each transfection were extended and characterized. pLON5 was obtained by deleting the previously described pC3Nleo plasmid (14) for the 3.7 kb BsmBI–MluI fragment. In order to generate pLON16, a 11.3 kb ApaI–Acc65I fragment from a BAC clone encompassing DXPas34 was cloned into pLON5 cut by ApaI–Acc65I double digestion.

FISH
Preparation of nuclei, hybridization and washings were as described previously (14). For RNA-FISH nuclei were hybridized directly. For DNA-FISH or DNA–RNA-FISH, nuclei were first denatured. Double-stranded fluorescent probes were generated by nick translation with spectrum-green- or spectrum-red-dUTP (Vysis). Biotin-labelled strand-specific probes were obtained by random-priming of single-stranded plasmids purified from bacterial culture infected with helper phage. The strand-specificity was verified by Southern blot using oligonucleotide probes. Texas red-avidin or fluorescein-avidin (Vector Laboratories) were used to detect biotinylated probes. A Quantix CCD camera (Photometrix) was used for image acquisition.

Allele-specific RT–PCR
Total RNA was isolated from ES cell cultures with RNazolB (Bioprobe) and routinely verified by electrophoresis. Random-primed RT was performed at 42°C with Superscript II reverse transcriptase (Gibco BRL). Strand-specific RT were carried out at 50°C in the presence of 0.5 µM of selected primer and 5 µg total RNA re-purified on a cesium chloride gradient. Control reactions lacking enzyme or primer were verified negative. MIX20/MX23b PCR (37 cycles) was performed as described (29) with an elongation time of 1.5 min for amplification of antisense transcripts and 50 s for amplification of spliced Xist RNA. PCR products were purified, digested by HindIII, Southern-blotted and hybridized with a 32P-labeled probe.

Real-time quantitative allele-specific PCR and RT–PCR
Quantitative real-time PCR measurements using TaqMan fluorescent probes were performed using an ABI Prism 7700 (Perkin-Elmer Applied Biosystems). Xist DNA and cDNA quantitations were internally standardized against the endogenous 18S gene or cDNA (18S detection kit; Perkin-Elmer) by running duplex PCR reactions and dual channel detection. Semi-quantitative estimates showed that the amount of 18S RNA as normalized to total RNA was not significantly different in undifferentiated and differentiated ES cells. Xist primers obPa or o129, and Xc1 or Xg1, and TaqMan probe TMxe5 (fluorophore, FAM; quencher, TAMRA) were used at 200 nM; 18S primers and TaqMan probe (fluorophore, VIC; quencher, TAMRA) were used at 40 nM. PCR reactions (in TaqMan Universal PCR Mix; Perkin-Elmer) were fluorescently scanned over 40 cycles (95°C, 15 s; 60°C, 60 s). In each reaction, the difference between the cycle threshold (ct) for the Xist and 18S targets was used to measure the standardized Xist concentration. Allelic specificity was verified on monoallelic samples amplified in parallel with homologous and heterologous PCR. The effect of cross-talk on the allelic quantifications was calculated to be <1% of the measured values. For RNA quantitation, the lack of signal was verified on RT reaction lacking enzyme. Serial dilutions of monoallelic cDNAs and genomic DNAs were used to compare the efficiencies of the Xist allelic PCRs. These were found to be closely similar. The lack of any significant bias in our quantifications was further controlled by running allelic PCR quantification on a mixture of cloned allelic templates at various ratios. The lack of interference between the amplification and detection systems for Xist and for 18S targets was also verified.

ES cell culture and in vitro differentiation
ES cells were grown as decribed previously (14) on male embryonic feeders (EF) for two passages prior to FISH or RT–PCR analysis. For ES cell differentiation in embryoid bodies (EBs) (30), ES cells were depleted of EF by two adsorptions on gelatinized plates and further cultivated for 3 days under adherent culture conditions without EFs. ES cells were then mildly trypsinized to leave small aggregates, and transferred (day 0) to suspension culture conditions without LIF. For FISH, EBs were either returned to adherent culture conditions until fixation or mechanically dissociated before cytospinning and fixation. ES cell were alternatively differentiated under adherent culture conditions after plating at a low cell density (104 cells/cm2). Since the kinetics of ES cell differentiation are sensitive to variations between individual experiments, the cell lines to be compared were systematically differentiated in parallel.

Oligonucleotide sequences
am1, acaccacgatgcctgtagcaat; ph2, gaagtcgtcctccacgaagtcc; MIX20, MX23b (29); Xin3Nlo, cactggcaaggtgaatagcat; Xex6Up, aactgggtcttcagcgtgat; IntII, atttccgttacttggttgac; Xc1, tggtagatggcattgtgtattatatgg; Xg1, gctactcacttgtgtattatatggcatga; obPa, ggttctctctccagaagctaggagaa; o129, ggttctctctccagaagctaggaaag; TMxe5, tgccagctgtttacatacttcaagatgcactgc.


    ACKNOWLEDGEMENTS
 
We thank E. Heard and C. Rougeulle for fruitful discussions and critical reading of the manuscript. We are grateful to E. Martin (Perkin Elmer) for helping us with real-time PCR. C.M. is a doctoral fellow supported by the French ministry for scientific research. This work was supported by grants to P.A. from the Association pour la Recherche contre le Cancer (ARC).


    FOOTNOTES
 
+ To whom correspondence should be addressed. Tel: +33 1 45 68 86 25; Fax: +33 1 45 68 86 56; Email: pclerc@pasteur.fr Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
1 Lyon, M.F. (1961) Gene action in the X chromosome of the mouse (Mus musculus L.) Nature, 190, 372–373.[Medline]

2 Heard, E., Clerc, P. and Avner, P. (1997) X-chromosome inactivation in mammals. Annu. Rev. Genet., 31, 571–610.[Web of Science][Medline]

3 Herzing, L.B., Romer, J.T., Horn, J.M. and Ashworth, A. (1997) Xist has properties of the X-chromosome inactivation centre. Nature, 386, 272–375.[Medline]

4 Lee, J.T., Strauss, W.M., Dausman, J.A. and Jaenisch, R. (1996) A 450 kb transgene displays properties of the mammalian X-inactivation center. Cell, 86, 83–94.

5 Lee, J.T. and Jaenisch, R. (1997) Long-range cis effects of ectopic X-inactivation centres on a mouse autosome. Nature, 386, 275–279.[Medline]

6 Lee, J.T., Lu, N. and Han, Y. (1999) Genetic analysis of the mouse X inactivation center defines an 80-kb multifunction domain. Proc. Natl Acad. Sci. USA, 96, 3836–3841.[Abstract/Free Full Text]

7 Heard, E., Mongelard, F., Arnaud, D. and Avner, P. (1999) Xist yeast artificial chromosome transgenes function as X-inactivation centers only in multicopy arrays and not as single copies. Mol. Cell. Biol., 19, 3156–3166.

8 Cattanach, B.M., Perez, J.N. and Pollard, C.E. (1970) Controlling elements in the mouse X-chromosome. Genet. Res., 15, 189–195.

9 Brockdorff, N., Ashworth, A., Kay, G.F., McCabe, V.M., Norris, D.P., Cooper, P.J., Swift, S. and Rastan, S. (1992) The product of the mouse Xist gene is a 15kb inactive X-specific transcript containing no conserved ORF and located in the nucleus. Cell, 71, 515–526.[Web of Science][Medline]

10 Marahrens, Y., Panning, B., Dausman, J., Strauss, W. and Jaenisch, R. (1997) Xist-deficient mice are defective in dosage compensation but not spermatogenesis. Genes Dev., 11, 156–166.[Abstract/Free Full Text]

11 Penny, G.D., Kay, G.F., Sheardown, S.A., Rastan, S. and Brockdorff, N. (1996) Requirement for Xist in X chromosome inactivation. Nature, 379, 131–137.[Medline]

12 Marahrens, Y., Loring , J. and Jaenisch, R. (1998) Role of the Xist gene in X chromosome choosing. Cell, 92, 657–664.[Web of Science][Medline]

13 Panning, B. and Jaenisch, R. (1996) DNA hypomethylation can activate Xist expression and silence X-linked genes. Genes Dev., 10, 1991–2002.[Abstract/Free Full Text]

14 Clerc, P. and Avner, P. (1998) Role of the region 3' to Xist exon 6 in the counting process of X-chromosome inactivation. Nat. Genet., 19, 249–253.[Web of Science][Medline]

15 Panning, B., Dausman, J. and Jaenisch, R. (1997) X chromosome inactivation is mediated by Xist RNA stabilization. Cell, 90, 907–916.[Web of Science][Medline]

16 Sheardown, S.A., Duthie, S.M., Johnston, C.M., Newall, A.E., Formstone, E.J., Arkell, R.M., Nesterova, T.B., Alghisi, G.C., Rastan, S. and Brockdorff, N. (1997) Stabilization of Xist RNA mediates initiation of X chromosome inactivation. Cell, 91, 99–107.[Web of Science][Medline]

17 Wutz, A. and Jaenisch, R. (2000) A shift from reversible to irreversible X inactivation is triggered during ES cell differentiation. Mol. Cell, 5, 695–705.[Web of Science][Medline]

18 Simmler, M.C., Cunningham, D.B., Clerc, P., Vermat, T., Caudron, B., Cruaud, C., Pawlak, A., Szpirer, C., Weissenbach, J., Claverie, J.M. and Avner, P. (1996) A 94kb genomic sequence 3' to the murine Xist gene reveals an AT rich region containing a new testis specific gene Tsx. Hum. Mol. Genet., 11, 1713–1726.

19 Hong, Y.K., Ontiveros, S.D., Chen, C. and Strauss, W.M. (1999) A new structure for the murine Xist gene and its relationship to chromosome choice/counting during X-chromosome inactivation. Proc. Natl Acad. Sci. USA, 96, 6829–6834.[Abstract/Free Full Text]

20 Lee, J.T., Davidow, L.S. and Warshawsky, D. (1999) Tsix, a gene antisense to Xist at the X-inactivation centre. Nat. Genet., 21, 400–404.[Web of Science][Medline]

21 Courtier, B., Heard, E., Arnaud, D. and Avner, P. (1995) Xce haplotypes show modified methylation in a region of the active X chromosome lying 3' to Xist. Proc. Natl. Acad. Sci. USA, 92, 3531–3535.

22 Debrand, E., Chureau, C., Arnaud, D., Avner, P. and Heard, E. (1999) Functional analysis of the DXPas34 locus, a 3' regulator of Xist expression. Mol. Cel. Biol., 19, 8513–8525.

23 Lee, J.T. and Lu, N. (1999) Targeted mutagenesis of Tsix leads to nonrandom X inactivation. Cell, 99, 47–57.[Web of Science][Medline]

24 Lee, J.T. (2001) Disruption of imprinted X inactivation by parent-of-origin effects at Tsix. Cell, 103, 17–27.

25. Sado, T., Wang, Z., Sakagi, H. and Li, E. (2001) Regulation of imprinted X chromosome inactivation in mice by Tsix. Development, 128, 1275–1286.

26. Nichols, J., Zevnik, B., Anastassiadis, K., Niwa, H., Klewe-Nebenius, D., Chambers, I., Scholer, H. and Smith, A. (1998) Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4. Cell, 95, 379–391.[Web of Science][Medline]

27. Custodio, N., Carmo-Fonseca, M., Geraghty, F., Pereira, H.S., Grosveld, F. and Antoniou, M. (1999) Inefficient processing impairs release of RNA from the site of transcription. EMBO J., 18, 2855–2866.[Web of Science][Medline]

28. Clemson, C.M., Chow, J.C., Brown, C.J. and Lawrence, J.B. (1998) Stabilization and localization of Xist RNA are controlled by separate mechanisms and are not sufficient for X inactivation. J. Cell Biol., 142, 13–23.[Abstract/Free Full Text]

29. Kay, G.F., Penny, G.D., Patel, D., Ashworth, A., Brockdorff, N. and Rastan, S. (1993) Expression of Xist during mouse development suggests a role in initiation of X chromosome inactivation. Cell, 72, 171–182.[Web of Science][Medline]

30 Robertson,E.J. (1987) Teratocarcinomas and Embryonic Stem Cells, a Practical Approach. IRL Press, Oxford, UK.

31 Rougeulle, C., Colleaux, L., Dujon, B. and Avner, P. (1994) Generation and characterisation of an ordered lambda clone array for the 460kb region surrounding the murine Xist sequence. Mamm. Genome, 5, 416–423.[Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
DevelopmentHome page
J. Starmer and T. Magnuson
A new model for random X chromosome inactivation
Development, January 1, 2009; 136(1): 1 - 10.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
E. Heard and C. M. Disteche
Dosage compensation in mammals: fine-tuning the expression of the X chromosome
Genes & Dev., July 15, 2006; 20(14): 1848 - 1867.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Vigneau, S. Augui, P. Navarro, P. Avner, and P. Clerc
An essential role for the DXPas34 tandem repeat and Tsix transcription in the counting process of X chromosome inactivation
PNAS, May 9, 2006; 103(19): 7390 - 7395.
[Abstract] [Full Text] [PDF]


Home page
Cold Spring Harb Symp Quant BiolHome page
M.C. ANGUERA, B.K. SUN, N. XU, and J.T. LEE
X-Chromosome Kiss and Tell: How the Xs Go Their Separate Ways
Cold Spring Harb Symp Quant Biol, January 1, 2006; 71(0): 429 - 437.
[Abstract] [PDF]


Home page
Mol. Cell. Biol.Home page
N. Stavropoulos, R. K. Rowntree, and J. T. Lee
Identification of Developmentally Specific Enhancers for Tsix in the Regulation of X Chromosome Inactivation
Mol. Cell. Biol., April 1, 2005; 25(7): 2757 - 2769.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
T. Kunath, D. Arnaud, G. D. Uy, I. Okamoto, C. Chureau, Y. Yamanaka, E. Heard, R. L. Gardner, P. Avner, and J. Rossant
Imprinted X-inactivation in extra-embryonic endoderm cell lines from mouse blastocysts
Development, April 1, 2005; 132(7): 1649 - 1661.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
S. Shibata and J. T. Lee
Characterization and quantitation of differential Tsix transcripts: implications for Tsix function
Hum. Mol. Genet., January 15, 2003; 12(2): 125 - 136.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
C. Chureau, M. Prissette, A. Bourdet, V. Barbe, L. Cattolico, L. Jones, A. Eggen, P. Avner, and L. Duret
Comparative Sequence Analysis of the X-Inactivation Center Region in Mouse, Human, and Bovine
Genome Res., June 1, 2002; 12(6): 894 - 908.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. F. Willard and L. Carrel
Making sense (and antisense) of the X inactivation center
PNAS, August 28, 2001; 98(18): 10025 - 10027.
[Full Text] [PDF]


Home page
ScienceHome page
Y. Park and M. I. Kuroda
Epigenetic Aspects of X-Chromosome Dosage Compensation
Science, August 10, 2001; 293(5532): 1083 - 1085.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (36)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Morey, C.
Right arrow Articles by Clerc, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Morey, C.
Right arrow Articles by Clerc, P.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?