Human Molecular Genetics, 2001, Vol. 10, No. 19 2013-2023
© 2001 Oxford University Press
Oxidative stress causes abnormal accumulation of familial amyotrophic lateral sclerosis-related mutant SOD1 in transgenic Caenorhabditis elegans
Department of Neurology, Graduate School of Medicine, Kyoto University, 54 Shogoin-Kawaharacho, Sakyo-ku, Kyoto 606-8507, Japan and 1Department of Molecular Life Science, Tokai University School of Medicine, Isehara, Kanagawa 259-1193, Japan
Received May 21, 2001; Revised and Accepted July 22, 2001.
| ABSTRACT |
|---|
|
|
|---|
Mutations in the Cu/Zn superoxide dismutase (SOD1) genes are present in
20% of families suffering from familial amyotrophic lateral sclerosis (FALS). Results from several transgenic studies in which FALS-related SOD1 mutations have been expressed have suggested that mutant SOD1 proteins induce cytotoxicity through a toxic gain of function, although the specific mechanism of this has not been fully clarified. To investigate the mechanism of toxicity induced by the mutant SOD1 associated with FALS, we generated transgenic Caenorhabditis elegans strains that contain wild-type and mutant human A4V, G37R and G93A SOD1 recombinant plasmids. The transgenic strains expressing mutant human SOD1 showed greater vulnerability to oxidative stress induced by 0.2 mM paraquat than a control that contained the wild-type human SOD1. In the absence of oxidative stress, mutant human SOD1 proteins were degraded more rapidly than the wild-type human SOD1 protein in C.elegans. In the presence of oxidative stress, however, this rapid degradation was inhibited, and the transgenic C.elegans co-expressing mutant human SOD1 and green fluorescent proteins (GFPs) in muscle tissues demonstrated discrete aggregates in the adult stage. These results suggest that oxidative damage inhibits the degradation of FALS-related mutant human SOD1 proteins, resulting in an aberrant accumulation of mutant proteins that might contribute to the cytotoxicity. | INTRODUCTION |
|---|
|
|
|---|
Amyotrophic lateral sclerosis (ALS) is a fatal progressive degenerative disorder that affects mainly the motor neurons in the cortex, brainstem and spinal cord. Approximately 10% of ALS patients are familial cases exhibiting an autosomal dominant inheritance (1). More than 70 different mutations in the gene coding for Cu/Zn superoxide dismutase (SOD1) have been identified in
20% of familial ALS (FALS) families (2). SOD1 is a ubiquitously expressed homodimeric cytosolic enzyme that catalyzes the conversion of O2 into O2 and H2O2, which is then further metabolized by glutathione peroxidase (3). Several lines of transgenic mice overexpressing mutant human SOD1 developed a progressive degeneration of motor neurons and a phenotype closely resembling human FALS (4). In contrast, in SOD1 knockout mice, development of motor neurons was normal (5). These findings suggest that it is not a loss of SOD1 activity that causes motor neuron disease, but a toxic gain of function (6). Several hypotheses have been proposed to explain the toxic gain of function, including the formation of peroxynitrite (7), enhanced peroxidase activity (8), copper-unshielded (9) or zinc-depleted (10) toxicity, aggregation of the enzyme (11) and inhibition of glial glutamate uptake (12). However, the exact cause of this toxic gain of function induced by mutant SOD1 remains to be clarified.
A number of studies have established an association between neuronal oxidative stress and FALS. For example, an increase in the indices of oxidative damaged macromolecules in neuronal tissues was demonstrated in SOD1-related FALS patients and transgenic mice (1315). In vitro studies have also demonstrated an enhanced vulnerability to exogenously applied oxidative stress (1618). Although these studies suggest that oxidative stress is important in the etiology of FALS, there is still controversy as to whether oxidative stress plays an early role in the disease and whether it is of secondary importance in FALS.
Caenorhabditis elegans is a transparent, free-living soil nematode
1 mm long. This animal model offers several experimental advantages: (i) it is easily grown and maintained on agar medium; (ii) it has a short life cycle (3.5 days at 20°C) and proliferates rapidly by self-fertilization; (iii) the complete cell lineage has been elucidated (19); and (iv) its entire genome has been sequenced, thus facilitating genetic analyses (20). Recently, it was proposed that C.elegans can be productively employed to improve our understanding of human diseases, including neurodegenerative disorders such as Huntingtons disease and Alzheimer disease (for a review see 21).
In this study, we addressed the role of oxidative stress for FALS-related mutant SOD1 by generating transgenic C.elegans strains containing wild-type or mutant human SOD1 recombinant plasmids. We focused our analysis on oxidative damage and degradation of the SOD1 enzyme. The degradation of mutant human SOD1 was inhibited in the presence of oxidative stress. Discrete aggregates were seen in the transgenic nematodes co-expressing mutant human SOD1 and green fluorescent protein (GFP) in the adult stage, which may explain the decreased viability of the FALS-related mutant C.elegans after oxidative stress.
| RESULTS |
|---|
|
|
|---|
Generation of transgenic C.elegans strains expressing human SOD1
The wild-type human SOD1 gene was cloned and mutagenized in vitro to obtain three mutant alleles that encode the FALS-related SOD1 proteins A4V, G37R and G93A. Each fragment was expressed in C.elegans using the promoters of the hsp16-2 and myo-3 genes. Expression of the hsp16-2 gene can be induced using a heat shock procedure in almost all tissues, including neurons, muscle, intestine and hypodermis, but not in germ lines (22,23). The myo-3 gene is expressed in all muscle cells except for those of the pharynx (24). The plasmid constructs injected are shown in Figure 1A and B. Transgenic C.elegans retains injected DNA in the form of extrachromosomal, multicopy arrays of variable mitotic and meiotic stability. The transmitting lines established in our study had a meiotic stability of 3652% and 3046% in lines with the hsp16-2 and myo-3 promoter, respectively. All transgenic animals showed the Roller phenotype caused by the co-injected marker rol-6 gene. The worms expressing wild-type or mutant human SOD1 showed no difference in appearance from the vector control strain (data not shown).
|
We first examined the expression of human SOD1 proteins under the control of the promoters in C.elegans. Mixed populations of transgenic animals with the hsp16-2 promoter were disrupted after 2 h heat shock treatment at 33°C, and the lysates were subjected to SDSPAGE. The human SOD1 proteins expressed in C.elegans were examined by immunoblotting with anti-human SOD1 (Fig. 1C, lanes 16) and anti-FLAG antibodies (Fig. 1C, lanes 712). Specific 2021 kDa protein bands, which correspond to the electrophoretic mobility of human SOD1, were detected in the lysates of strains expressing the wild-type human SOD1 (Fig. 1C, lanes 3 and 9), A4V (Fig. 1C, lanes 4 and 10), G37R (Fig. 1C, lanes 5 and 11) and G93A (Fig. 1C, lanes 6 and 12) mutant human SOD1. In contrast, neither the control strain in which only the vector was injected nor the transgenic strain not subjected to heat shock treatment showed any specific bands (Fig. 1C, lanes 1, 2, 7 and 8). The expression of wild-type and A4V human SOD1 proteins under constant heat shock conditions at 27°C was also confirmed by immunoblotting (data not shown). The expression of human SOD1 driven by the myo-3 promoter was also detected with an anti-SOD1 antibody (Fig. 1D).
SOD1 activity and alteration of electrophoretic mobility of mutant human SOD1s in C.elegans
To examine whether the wild-type and mutant human SOD1s show enzymatic activity in C.elegans, we analyzed them using non-denatured SOD1 activity assay gels. Free radical scavenging activity was detected in the strains expressing wild-type and mutant human SOD1s (Fig. 2, lanes 36; G93A, G37R, A4V and wild-type, respectively) under the control of hsp16-2 gene promoter. Wild-type human SOD1 from transgenic C.elegans showed a similar electrophoretic mobility to that of purified human SOD1 from red blood cells. However, each mutant enzyme exhibited a different electrophoretic mobility from that of purified human SOD1. The intrinsic C.elegans SOD1 activity was not detected and was probably negligible compared with the activity of the recombinant human SOD1s (Fig. 2, lanes 1 and 2).
|
Increased paraquat sensitivity in transgenic C.elegans expressing FALS-related mutant human SOD1
To investigate the response of our C.elegans model to oxidative stress, we examined the survival of each transgenic strain containing hsp16-2 promoter plasmid constructs after the administration of paraquat (1,1'-dimethyl-4,4'-bipyridinium), a herbicide commonly used to generate oxidative stress in vivo by redox cycling (25,26). The animals expressing mutant A4V, G37R and G93A human SOD1 proteins under constant heat shock conditions (27) showed increased sensitivity to paraquat compared with that of the vector control. Conversely the transgenic strain expressing the wild-type human SOD1 did not show any significant difference in its sensitivity to paraquat treatment compared with the vector control (Fig. 3). In the presence of 0.2 mM paraquat, the nematodes looked pale, lost turgor pressure, and appeared flaccid and decrepit at the end of the experiment. Using Nomarski optics, the individual cells and nuclei appeared indistinct and mottled. However, the transgenic animals expressing either mutant human SOD1 or wild-type human SOD1 and the vector controls were indistinguishable in this regard.
|
Oxidative damage to macromolecules induced by paraquat treatment in C.elegans
Paraquat is metabolically reduced to the stable paraquat radical (PQ+) in a NAD(P)H-dependent reaction catalyzed by NADPH-cytochrome P-450 reductase. The paraquat radical produces superoxide radicals and inflicts cellular injury by the damaged biological macromolecules mediated by reactive oxygen species (25,26). To confirm that paraquat induced oxidative stress in C.elegans, we examined two molecular indices of oxidation status in the soluble fraction of the lysate. Carbonylization of protein residues, which is an index of the oxidation status of proteins (27), was measured using the immunoblotting technique of protein-bound 2,4-dinitrophenylhydrazones (DNPH). Accumulation of reactive carbonyl derivatives (RCDs) was substantial in all transgenic animals subjected to 0.2 mM paraquat (Fig. 4A; P) compared with the controls (Fig. 4A; C). Malondialdehyde (MDA), which is an index of lipid peroxidation (28), was also measured. The amount of MDA was raised by paraquat in a dose-dependent manner in all transgenic C.elegans (Fig. 4B). There was no significant difference in the levels of increased RCD and MDA between the transgenic strains (Fig. 4A and B).
|
Instability of mutant human SOD1 proteins in C.elegans
We investigated the degradation of the human SOD1 proteins expressed in C.elegans. After subjecting the transgenic nematodes containing hsp16-2 promoter plasmid constructs to heat shock treatment, followed by immunoblotting, the human SOD1 proteins induced were detected within 1 h after heat shock, reached a maximum at 2448 h, and then disappeared gradually (data not shown). The representative profiles after peak time (0 h) are shown in Figure 5A. The A4V, G37R and G93A mutant human SOD1 proteins expressed were rapidly degraded, compared with wild-type human SOD1, when analyzed on immunoblots using anti-SOD1 or anti-FLAG antibodies (Fig. 5B). The degradation indices of the A4V, G37R and G93A SOD1 proteins, obtained with an anti-SOD1 antibody, were 20 ± 3.5, 24 ± 6.5 and 28 ± 6.0 h, respectively. These values were significantly lower than that of wild-type human SOD1 (44 ± 4.5 h, P < 0.01). We obtained similar degradation index results using an anti-FLAG antibody (Fig. 5D).
|
Paraquat delayed the degradation of mutant human SOD1 proteins in C.elegans
To investigate whether oxidative stress influences the degradation of the human SOD1 expressed, we examined the time course of the degradation of expression of these proteins in the presence of 0.2 mM paraquat. We used this concentration of paraquat because the difference in sensitivity to paraquat between wild-type and mutant human SOD1s was most remarkable at this concentration (Fig. 3). Representative profiles seen after the peak time are shown in Figure 6A. The human SOD1 product induced by 0.2 mM paraquat stress without heat shock was below the sensitivity of immunoblotting (data not shown). The expression of the A4V, G37R and G93A mutant human SOD1 proteins was degraded more slowly than wild-type human SOD1 when analyzed on immunoblots using anti-SOD1 or anti-FLAG antibodies (Fig. 6B). The degradation index of the A4V, G37R and G93A mutant SOD1 proteins exhibited prolonged values of 54 ± 8.5, 52 ± 7.0 and 55 ± 9.4 h, respectively; values that were more than twice those observed in the absence of paraquat treatment (Figs 5D and 6C). In contrast, the degradation index of wild-type human SOD1 (42 ± 5.5 h) did not differ significantly from the value in the absence of paraquat treatment (44 ± 4.5 h) (Figs 5D and 6C).
|
Transgenic C.elegans co-expressing mutant human SOD1 and GFP showed discrete aggregates in the muscle tissues under oxidative stress
Morphological abnormalities were not detectable in the transgenic nematodes transformed with the construct depicted in Figure 1A. In order to more rigorously examine the tissues of C.elegans, we generated transgenic C.elegans that co-expressed human SOD1 protein and GFP in the muscles because body wall muscles were convenient to observe abnormal structures (29). Both transgenes were controlled by the myo-3 gene promoter, which constitutively induces high-level protein expression in all of the muscle tissues except for the pharynx (24). We chose the A4V transgenic strain as a representative because the clinical manifestation of patients with A4V SOD1 mutation is most prominent (2). An adult transgenic nematode that co-expressed the A4V mutant human SOD1 protein and GFP in the body wall muscles is shown in Figure 7A. The fluorescence was localized in the muscles, and no abnormal structures were observed in the muscle cells. Conversely, when the nematodes were raised on plates containing 0.2 mM paraquat, the GFP formed discrete aggregates in the body wall muscles, especially in the adults (Fig. 7B). Immunofluorescent staining with anti-human SOD1 antibody revealed that these aggregates contained A4V mutant human SOD1 (Fig. 7C). These abnormal structures were observed in 11.7% of 11- to 12-day-old animals (adults; n = 111), 6.2% of 7- to 8-day-old animals (adults; n = 97) and 1% of 3- to 4-day-old animals (L4/young adult; n = 98), showing a distinct age-dependent increase. Neither the transgenic nematodes expressing GFP alone nor those co-expressing GFP and wild-type human SOD1 showed abnormal structures, even when using the same paraquat concentration (Fig. 7D).
|
| DISCUSSION |
|---|
|
|
|---|
In the present study, we introduced human SOD1 genes into wild-type nematodes and generated transgenic C.elegans expressing wild-type and FALS-related mutant human SOD1 (A4V, G37R and G93A) to assess the effect of oxidative stress on FALS-related SOD1 proteins. We found that transgenic nematodes expressing FALS-related mutant SOD1 proteins showed a reduced resistance to paraquat-induced oxidative stress. Under oxidative stress, the degradation of FALS-related mutant human SOD1 proteins was significantly inhibited and the aberrant accumulation of mutant human SOD1 proteins was observed in C.elegans.
We have also succeeded in making transgenic C.elegans expressing wild-type or FALS-related mutant human SOD1 proteins with enzymatic activity. Native gel activity assay in this study indicated that FALS-related mutant human SOD1 exhibited a different electrophoretic mobility from that of purified human SOD1, whereas wild-type human SOD1 showed an experimentally identical mobility, suggesting that there are significant structural changes in the mutant SOD1 proteins.
Although the electrophoretic mobility of each mutant human SOD1 is different from that of wild-type human SOD1, transgenic C.elegans expressing FALS-related mutant human SOD1 did not show any detectable altered phenotype in the absence of paraquat. These results are different from studies in which transgenic mice expressing FALS-related mutant human SOD1 have been produced (6), but similar to a study in which a Drosophila model expressing FALS-related human SOD1 also did not show any detectably changed phenotype (30). We suggest that this difference may be due to the short lifespan of these animals; 1420 days for C.elegans and 23 months for Drosophila. In considering the pathogenesis of FALS, it is puzzling that its onset in patients with a mutant SOD1 linked to FALS is usually observed in middle age, even though the expression of SOD1 is detected constitutively from an early stage of development throughout life (31). We hypothesize that the accumulation of oxidative macromolecular damage during aging might have a role in exhibiting the FALS-related phenotype. Therefore, transgenic C.elegans was subjected to oxidative stress induced by paraquat.
Paraquat-induced oxidative stress to macromolecules in C.elegans was confirmed by carbonylization of protein residues and an increase in lipid peroxidation. Although paraquat produced almost the same level of oxidated macromolecules in the transgenic strains expressing the wild-type and FALS-related mutant human SOD1, only those expressing FALS-related mutant SOD1 showed an enhanced vulnerability to paraquat-induced oxidative stress compared with the vector control. These results suggest that the vulnerability to paraquat is not simply the result of an increase in intrinsic cellular oxidative damage. It is possible that FALS-related mutant human SOD1 proteins are changed by oxidative stress such that they have toxic character in C.elegans. The transgenic C.elegans strain expressing wild-type human SOD1 did not show a significant change in its sensitivity to paraquat treatment compared with the vector controls, although there is a study showing that overexpression of human SOD1 causes oxidative stress-mediated impairment in cell culture transfected with wild-type SOD1 (32). Paraquat treatment may induce the intrinsic C.elegans oxidative stress-response genes, including sod-1, which encodes Cu/Zn SOD, and sod-2 and -3, which encode Mn SOD (33). However, as all of the transgenic strains were treated equally, it is unlikely that the intrinsic C.elegans Cu/Zn SOD and Mn SOD influenced the present results.
Little is known about the catabolism of FALS-related mutant human SOD1. We generated temperature-inducible SOD1 constructs to analyze the degradation of human SOD1 proteins in C.elegans. After 2 h heat shock treatment on transgenic nematodes, we examined time course profiles of the human SOD1s by a western blotting method with anti-SOD1 antibody and also confirmed the results with anti-FLAG antibody, which detected the FLAG that was tagged to C-terminals of human SOD1 proteins. Our results showed that, in the absence of paraquat, mutant A4V, G37R or G93A human SOD1 proteins were degraded more rapidly compared with wild-type human SOD1 in C.elegans. These findings are compatible with an in vitro study measuring the half-life of FALS-related mutant human SOD1 proteins using a pulsechase assay (34,35). As discussed previously, FALS-related mutant human SOD1 exhibited an aberrant electrophoretic mobility, suggesting the presence of higher structured changes in the mutant SOD1 proteins. Such abnormal proteins are generally eliminated to maintain normal cell function in eukaryotic cells. The multicatalytic proteolytic complex, proteasome, plays a key role in the degradation of misfolded or oxidatively damaged proteins (36,37). Indeed, Hoffman et al. (38) have shown, in an in vitro study, that mutant SOD1 proteins are degraded by the proteasome complex.
Importantly, the rapid degradation of the mutant human SOD1 proteins was remarkably inhibited in the presence of paraquat. We can propose two possible mechanisms to explain this result. The first is that paraquat-induced oxidative stress impairs the proteasome activity, resulting in the reduction of catabolism of the mutant SOD1 proteins. Reinheckel et al. (39) have shown that H2O2 stress causes inactivation of the 20S and 26S proteasomes in an in vitro study. Secondly, it is possible that the mutant protein itself becomes resistant to degradation during the oxidative rearrangement of secondary and tertiary protein structures. Davies et al. (40) have demonstrated that relatively mild oxidative damage increases proteolytic susceptibility and degradation, whereas extensive oxidative damage causes decreased proteolysis due to covalent cross-linking reactions, increased surface hydrophobicity and aggregation. Aggregates of modified mutant proteins could be beyond the capacity of the proteasome complex due to their bizarre structure and accumulation in cells. In fact, the present study clearly showed that, under oxidative stress, discrete aggregates, including A4V mutant SOD1 and GFP, were observed in the transgenic strain that co-expressed these proteins in the muscle tissues. Cytoplasmic protein aggregation containing mutant human SOD1 is a possible mechanism contributing to the neurodegeneration in FALS (11,4143). Johnston et al. (44) have shown that aggregation of SOD1 into high molecular weight, insoluble protein complexes (IPCs) is an early event in SOD1G93A transgenic mice. Also, in transfection studies, SOD1 IPCs are sequestered into inclusion bodies resembling aggresomes, structures assembled from small aggregates of misfolded proteins, with inhibition of the proteasome (44). In the present degradation assay system in C.elegans, human SOD1 proteins were transiently expressed by the hsp16-2 promoter after heat shock treatment. However, in FALS patients, mutant SOD1 proteins are produced constitutively and the inhibition of degradation is thought to cause aberrant accumulation of the mutant SOD1 proteins in cells, which may lead to neurodegeneration.
A reduction in vascular perfusion during aging causes hypoxia and increases steady-state concentrations of free radicals in mammalian tissues (45). Recently, Oosthuyse et al. (46) demonstrated that impairing the hypoxia-inducible response of vascular endothelial growth factor caused adult-onset progressive motor neuron degeneration in mice. Our present C.elegans study also suggests a possibility that FALS-related mutant SOD1 proteins inhibit a normal protective response against oxidative stress and cause vulnerability to paraquat-induced oxidative stress mimicking hypoxia during aging.
In conclusion, we found that oxidative damage inhibits the degradation of FALS-related mutant human SOD1 proteins, resulting in the aberrant accumulation of mutant proteins and aggregate formation. This could explain the hypersensitivity of transgenics that harbor gain of function SOD1 alleles. The onset of FALS in middle-aged patients with a SOD1 mutation could be attributed to the accumulation of oxidative damage with aging. The transgenic C.elegans expressing FALS-related mutant human SOD1 is a useful tool for investigating the precise molecular mechanism of the disease and for developing therapeutic strategies against ALS.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmid constructs
Two cDNA copies of human SOD1 genes were obtained from the white blood cells of a healthy human by reverse transcription-coupled PCR amplification using primers: sense primer that contained the SacI site, CGGGAGCTCCCGTTCCGTTGCAGTCCTCGGAA; antisense primer that included the BamHI site, CGGGATCCTTCTACAGCTAGCAGGATAACA, or another antisense primer that also included the terminal stop codon (underlined) and FLAG tag sequence, CGGGATCCTTATTTATCGTCATCATCTTTATAATCTTGGGCGATCCCAATTACACC. The PCR product was inserted between the unique BamHI and SacI sites of pKF19k (GenBank accession no. D63847) and was verified by sequencing. Mutations (A4V, GCC
GTC; G37R, GGA
AGA; and G93A, GGT
GCT) were engineered by oligonucleotide-directed mutagenesis, using a kit purchased from Takara (Tokyo, Japan). The entire open reading frame of each mutant was confirmed by sequencing. Wild-type and mutant human SOD1 genes were cloned into the vectors pPD49.78, which includes the hsp16-2 gene promoter, and pPD18.49, which includes the myo-3 gene promoter. The GFP gene was inserted into pPD18.49. All of the constructs were verified by sequencing. The constructs that were used for micro-injection are illustrated in Figure 1.
Generation of transgenic C.elegans
Wild-type C.elegans strain Bristol N2 hermaphrodites were transformed according to standard techniques (47). Extrachromosomal transgenic lines were established by injecting the construct into C.elegans syncytial gonads together with the rol-6 (pRF4) (48) dominant marker. Standard DNA concentrations were 10 ng/µl for pRF4 and 90 ng/µl for the human SOD1 expression plasmid, or a mixture of 45 ng/µl of each of the SOD1 expression plasmid and the GFP expression plasmid. Transmitting lines were established and maintained by selection for the Roller marker phenotype. Three independent lines were selected and analyzed.
General handling techniques of C.elegans such as strain maintenance and culture were carried out according to a method described by Brenner (49). In particular, nematodes were grown at 20°C on nematode growth medium (NGM) agar plates and live bacteria (Escherichia coli strain OP50) were provided as nutrients.
SDS gels and immunoblotting
Cultures on NGM agar plates were harvested and washed several times with M9 buffer (49), and then were disrupted by sonication on ice. The cytosolic fractions were obtained by centrifugation at 14 000 g for 15 min at 4°C. Protein concentrations were determined by the method of Bradford (50). Protein samples were diluted with sample buffer (50 mM TrisHCl pH 6.8, 2% SDS, 2% 2-mercaptoethanol, 5% glycerol, 1% NP-40 and 0.01% bromophenol blue) and denatured at 95°C for 5 min. Samples containing equal amounts of protein (10 µg) were electrophoresed on polyacrylamide gradient gels (816%) in the presence of SDS. Immunoblotting was carried out by transferring the proteins to polyvinylidene difluoride microporous membrane, blocking this membrane with 5% skimmed milk in 10 mM phosphate-buffered saline (PBS) containing 0.1% Tween 20 (PBST), and incubating overnight at 4°C with the primary antibodies [anti-human SOD1 polyclonal antibody (1:5000) (Stressgen, British Columbia, Canada); anti-FLAG M2 monoclonal antibody (1:2000) (Sigma, St Louis, MO)] in 4% bovine serum albumin in PBST. The membranes were then washed in PBST and incubated with a horseradish peroxidase-conjugated anti-rabbit IgG (Amersham Pharmacia Biotech, Buckinghamshire, UK), or anti-mouse IgG (Amersham Pharmacia Biotech) in PBST for 1 h at room temperature. The specific reaction was visualized using the enhanced chemiluminescence method (Amersham Pharmacia Biotech).
Enzymatic assays of human SOD1 in transgenic animals
For the enzyme assays, transgenic animals were grown at 20°C with continuous shaking in a suspension of E.coli in S medium (51). The nutrient provided was the SOD-deficient E.coli strain QC774 (52). After 2 h heat shock treatment at 33°C the cultures were incubated at 20°C for 24 h, and then harvested by centrifugation at 1100 g for 10 min at 4°C. The worms were washed in cold 50 mM potassium phosphate at pH 7.8, resuspended in a minimal volume of 50% sucrose and centrifuged again. This approach pelleted debris while leaving the nematodes in suspension. The suspension in the 50% sucrose was decanted and diluted 5-fold with cold buffer followed by centrifugation at 3000 g for 10 min (53). After washing again with buffer, the pellet that included the worms was suspended in a minimal volume of the phosphate buffer and homogenized using 20 strokes of a Dounce homogenizer on ice. The cytosol was obtained by centrifugation at 14 000 g for 15 min at 4°C. Protein concentrations were determined by the method of Bradford (50).
Gel activity assay (54) was performed using native (non-SDS) 12% polyacrylamide slab gels. Gels and running buffer did not contain SDS, and the samples were not heated prior to electrophoresis. The gels were soaked in 2.45 x 103 M nitroblue tetrazolium for 20 min, followed by immersion for 15 min in a solution containing 0.028 M tetramethylenediamine, 2.8 x 105 M riboflavin and 0.036 M potassium phosphate at pH 7.8. The gels were illuminated for 515 min or until maximum contrast was reached. In this assay, when the gels were exposed to a fluorescent light source, the background became dark purple while the portions with free radical scavenging activity remained white. The enzymatic activity for SOD1 could be distinguished from that for Mn SOD2 by sensitivity to 10 mM KCN. We confirmed that the bands for SOD1 disappeared when the samples were assayed in the presence of 10 mM KCN (data not shown).
Sensitivity of transgenic C.elegans to paraquat
A synchronous culture of each strain was grown on NGM agar plates. Eggs were collected from these cultures, using sodium hydrochloride (55), and hatched by overnight incubation at 20°C in S buffer (51). The newly hatched L1 larvae were inoculated onto seeded NGM plates containing various concentrations of paraquat (00.2 mM). On the following day, Roller phenotype larvae (L2/3 stage) were picked up, transferred to new plates containing the same concentration of paraquat and incubated at 27°C. Taking care not to allow plate starvation, the number of worms surviving to adults was determined on the 5th day after hatching according to the method described previously (56).
Sample preparation for detection of oxidated molecules
Synchronous L2/3 stage cultures on NGM plates were transferred to new plates containing 0.01.0 mM paraquat (using the same method as above) and incubated at 27°C. Taking care not to allow plate starvation, the cultures were harvested on the 5th day after hatching and the worms were washed in cold 50 mM potassium phosphate at pH 7.8, resuspended in a minimal volume of 50% sucrose and centrifuged again. The suspension in the 50% sucrose was decanted, and then diluted 5-fold with cold buffer followed by centrifugation at 3000 g for 10 min (53). After washing with M9 buffer, the pellet, which included the worms, was disrupted by sonication on ice, and the cytosolic fractions were obtained by centrifugation at 14 000 g for 15 min at 4°C. Protein concentrations were determined by the method of Bradford (50).
RCD determination
Carbonylization of protein residues, which is an index of the oxidation status of proteins (27), was measured as RCD using immunodetection of protein-bound DNPH in a western blot technique, according to the protocol of the OxyblotTM protein oxidation detection kit (INTEROGEN, New York). An equal amount of protein (2 µg) that had been derived from DNPH was examined. Total proteins were visualized by Coomassie Brilliant Blue stain.
MDA determination
Lipid peroxidation was determined by measuring MDA, an index of lipid peroxidation, according to the method of Ohkawa et al. (28). Butylhydroxy toluene (0.01%) was added to each assay mixture in order to prevent undesirable autoxidation of the sample during the assay. The MDA in the sample was reacted with thiobarbituric acid (TBA) and the resulting chromophore was detected by fluorometric measurement (excitation: 515 nm; emission: 553 nm). The results were expressed as pmoles of MDA per mg of protein using a standard curve of tetraethoxypropane.
Expression profile of wild-type and mutant human SOD1 in C.elegans
A synchronous culture of each strain (55) was transferred to NGM plates containing 40 µM 5-fluorouracil-2'-deoxyribose (FUdR) with pre-grown E.coli OP50 and incubated at 20°C. FUdR, an inhibitor of DNA synthesis that prevents C.elegans from reproducing without interfering with development and life span (57), was added to maintain the number of worms during incubation. On the 7th day after hatching, the cultures were heated at 33°C for 2 h, then incubated at 20°C and harvested successively after 1, 3, 6, 24, 48, 72, 96 and 120 h. The worms were lysed, and equal amounts of protein (10 µg) were assayed by immunoblotting, using anti-human SOD1 or anti-FLAG antibodies. The amount of specific product was analyzed by quantitative densitometry, using a computerized image analysis program (NIH Image 1.51). The meiotic stability of each line was estimated before lysis (the Roller phenotype fraction was within 3652%), and every densitometric value was standardized according to the ratio of the fraction. For the examination of nematodes under paraquat stress, we used NGM plates containing 0.2 mM paraquat. The degradation index was calculated based on the data presented in Figure 4C. A line was fitted to a graph of the log [protein level], as a function of time, using Microsoft Excel to calculate the slope and the intercept at the time when half of the protein level would have decayed.
Indirect immunofluorescence
Indirect immunofluorescence histochemistry was used to stain the human SOD1 and GFP expressed in the muscle tissues of transgenic C.elegans. Animals (0.10.5 ml) were fixed for 24 h at 4°C in PBS (10.4 mM Na2HPO4, 1.8 mM KH2PO4, 137 mM NaCl, 4.4 mM KCl pH 7.2), 4% paraformaldehyde. The worms were washed three times in PBS, and then rocked gently overnight at 37°C in a solution of 5% ß-mercaptoethanol, 1% Triton X-100 in 0.125 M TrisHCl pH 6.9. The worms were washed three times in PBS, and 30 µl of worms was incubated at 37°C for 24 h in 0.4 ml of 100 mM TrisHCl pH 7.5, 1 mM CaCl2 and 2000 U/ml collagenase type IV (Sigma). The worms were then washed with PBS, 1% Triton X-100 (PBST) three times and pre-incubated for a few hours at room temperature with 1% bovine serum albumin (BSA) in PBST. The specimen was incubated overnight at room temperature in 0.5% rabbit anti-human SOD1 (Stressgen) and 0.5% mouse anti-GFP (Molecular Probes, Eugene, OR) antibodies in PBST and washed for 4 h at room temperature with PBST, 1% BSA. The worms were then incubated at room temperature for 4 h with 1% rhodamine-conjugated goat anti-rabbit IgG (Molecular Probes) and 1% fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG (Molecular Probes) in PBST. After washing three times with PBS, stained worms (5 µl) were mixed with 5 µl of 1 mg/ml p-phenylenediamine in 10% PBS pH 8.0 and 90% glycerol and viewed by fluorescence microscopy (AXIOPLANN, Zeiss) (modified method described in ref. 58). The percentage of GFP aggregate positive animals, defined as the percentage of the animals with over 30 discrete structures in the muscles visualized at x100 magnification, was counted. The overlapping image of double staining with anti-GFP and anti-human SOD1 antibodies was obtained by a computerized image program, Paint Shop Pro 6 (Jasc Software).
| ACKNOWLEDGEMENTS |
|---|
We thank Drs I.Katsura and K.Ishihara (National Institute of Genetics, Mishima, Japan) and Drs M.Noda and H.Kitayama (Kyoto University Graduate School of Medicine, Kyoto, Japan) for technical support and for providing equipment; Dr A.Fire (Carnegie Institution of Washington, Baltimore, USA) for providing C.elegans expression vectors; Dr F.Yamakura (Department of Chemistry, Juntendo University School of Medicine) for providing the E.coli QC774 strain; and Dr S.Fujimoto (Kyoto Pharmaceutical University, Kyoto, Japan) for technical support. The nematode wild-type strain (N2) used in this work was obtained from the Caenorhabditis Genetics Center (CGC, St Paul, MN), which is funded by the NIH National Center for Research Resources (NCRR, Bethesda, MD). We are grateful to Dr P.S.Hartman (Texas Christian University, TX) and Ms M.Ohara for reading this manuscript. This work was supported by a Grant-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology, Japan.
| FOOTNOTES |
|---|
+ To whom correspondence should be addressed. Tel: +81 75 751 3767; Fax: +81 75 751 9541; Email: i53367@sakura.kudpc.kyoto-u.ac.jp
| REFERENCES |
|---|
|
|
|---|
1 Mulder, D.W., Kurland, L.T., Offord, K.P. and Beard, C.M. (1986) Familial adult motor neuron disease: amyotrophic lateral sclerosis. Neurology, 36, 511517.[Abstract]
2 Cudkowicz, M.E., McKenna-Yasek, D., Sapp, P.E., Chin, W., Geller, B., Hayden, D.L., Schoenfeld, D.A., Hosler, B.A., Horvitz, H.R. and Brown, R.H. (1997) Epidemiology of mutations in superoxide dismutase in amyotrophic lateral sclerosis. Ann. Neurol., 41, 210221.[Web of Science][Medline]
3 Fridovich, I. (1986) Superoxide dismutases. Adv. Enzymol. Relat. Areas Mol. Biol., 58, 6197.[Web of Science][Medline]
4 Gurney, M.E., Pu, H., Chiu, A.Y., Dal Canto, M.C., Polchow, C.Y., Alexander, D.D., Caliendo, J., Hentati, A., Kwon, Y.W., Deng, H.X. et al. (1994) Motor neuron degeneration in mice that express a human Cu, Zn superoxide dismutase mutation. Science, 264, 17721775.
5 Reaume, A.G., Elliott, J.L., Hoffman, E.K., Kowall, N.W., Ferrante, R.J., Siwek, D.F., Wilcox, H.M., Flood, D.G., Beal, M.F., Brown, R.H. et al. (1996) Motor neurons in Cu/Zn superoxide dismutase-deficient mice develop normally but exhibit enhanced cell death after axonal injury. Nat. Genet., 13, 4347.[Web of Science][Medline]
6 Gurney, M.E., Cutting, F.B., Zhai, P., Andrus, P.K. and Hall, E.D. (1996) Pathogenic mechanisms in familial amyotrophic lateral sclerosis due to mutation of Cu, Zn superoxide dismutase. Pathol. Biol. (Paris), 44, 5156.[Medline]
7 Beckman, J.S., Carson, M., Smith, C.D. and Koppenol, W.H. (1993) ALS, SOD and peroxynitrite. Nature, 364, 584.[Medline]
8 Yim, M.B., Kang, J.H., Yim, H.S., Kwak, H.S., Chock, P.B. and Stadtman, E.R. (1996) A gain-of-function of an amyotrophic lateral sclerosis-associated Cu,Zn-superoxide dismutase mutant: An enhancement of free radical formation due to a decrease in Km for hydrogen peroxide. Proc. Natl Acad. Sci. USA, 93, 57095714.
9 Wiedau-Pazos, M., Goto, J.J., Rabizadeh, S., Gralla, E.B., Roe, J.A., Lee, M.K., Valentine, J.S. and Bredesen, D.E. (1996) Altered reactivity of superoxide dismutase in familial amyotrophic lateral sclerosis. Science, 271, 515518.[Abstract]
10 Estevez, A.G., Crow, J.P., Sampson, J.B., Reiter, C., Zhuang, Y., Richardson, G.J., Tarpey, M.M., Barbeito, L. and Beckman, J.S. (1999) Induction of nitric oxide-dependent apoptosis in motor neurons by zinc-deficient superoxide dismutase. Science, 286, 24982500.
11 Durham, H.D., Roy, J., Dong, L. and Figlewicz, D.A. (1997) Aggregation of mutant Cu/Zn superoxide dismutase proteins in a culture model of ALS. J. Neuropathol. Exp. Neurol., 56, 523530.[Web of Science][Medline]
12 Trotti, D., Rolfs, A., Danbolt, N.C., Brown, R.H. and Hediger, M.A. (1999) SOD1 mutants linked to amyotrophic lateral sclerosis selectively inactivate a glial glutamate transporter. Nat. Neurosci., 2, 427433.[Web of Science][Medline]
13 Ferrante, R.J., Browne, S.E., Shinobu, L.A., Bowling, A.C., Baik, M.J., MacGarvey, U., Kowall, N.W., Brown, R.H. and Beal, M.F. (1997) Evidence of increased oxidative damage in both sporadic and familial amyotrophic lateral sclerosis. J. Neurochem., 69, 20642074.[Web of Science][Medline]
14 Hall, E.D., Andrus, P.K., Oostveen, J.A., Fleck, T.J. and Gurney, M.E. (1998) Relationship of oxygen radical-induced lipid peroxidative damage to disease onset and progression in a transgenic model of familial ALS. J. Neurosci. Res., 53, 6677.[Web of Science][Medline]
15 Andrus, P.K., Fleck, T.J., Gurney, M.E. and Hall, E.D. (1998) Protein oxidative damage in a transgenic mouse model of familial amyotrophic lateral sclerosis. J. Neurochem., 71, 20412048.[Web of Science][Medline]
16 Mena, M.A., Khan, U., Togasaki, D.M., Sulzer, D., Epstein, C.J. and Przedborski, S. (1997) Effects of wild-type and mutated copper/zinc superoxide dismutase on neuronal survival and L-DOPA-induced toxicity in postnatal midbrain culture. J. Neurochem., 69, 2133.[Web of Science][Medline]
17 Aguirre, T., Van Den Bosch, L., Goetschalckx, K., Tilkin, P., Mathijs, G., Cassiman, J.J. and Robberecht, W. (1998) Increased sensitivity of fibroblasts from amyotrophic lateral sclerosis patients to oxidative stress. Ann. Neurol., 43, 452457.[Web of Science][Medline]
18 Gabbianelli, R., Ferri, A., Rotilio, G. and Carri, M.T. (1999) Aberrant copper chemistry as a major mediator of oxidative stress in a human cellular model of amyotrophic lateral sclerosis. J. Neurochem., 73, 11751180.[Web of Science][Medline]
19 Sulston, J. (1988) Cell Lineage. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.
20 The C. elegans Sequencing Consortium (1998) Genome sequence of the nematode C. elegans: a platform for investigating biology. Science, 282, 20122018.
21 Culetto, E. and Sattelle, D.B. (2000) A role for Caenorhabditis elegans in understanding the function and interactions of human disease genes. Hum. Mol. Genet., 9, 869877.
22 Stringham, E.G., Dixon, D.K., Jones, D. and Candido, E.P. (1992) Temporal and spatial expression patterns of the small heat shock (hsp16) genes in transgenic Caenorhabditis elegans. Mol. Biol. Cell, 3, 221233.[Abstract]
23 Fire, A., Harrison, S.W. and Dixon, D. (1990) A modular set of lacZ fusion vectors for studying gene expression in Caenorhabditis elegans. Gene, 93, 189198.[Web of Science][Medline]
24 Ardizzi, J.P. and Epstein, H.F. (1987) Immunochemical localization of myosin heavy chain isoforms and paramyosin in developmentally and structurally diverse muscle cell types of the nematode Caenorhabditis elegans. J. Cell Biol., 105, 27632770.
25 Fukushima, T., Yamada, K., Isobe, A., Shiwaku, K. and Yamane, Y. (1993) Mechanism of cytotoxicity of paraquat. I. NADH oxidation and paraquat radical formation via complex I. Exp. Toxicol. Pathol., 45, 345349.[Web of Science][Medline]
26 Yamada, K. and Fukushima, T. (1993) Mechanism of cytotoxicity of paraquat. II. Organ specificity of paraquat-stimulated lipid peroxidation in the inner membrane of mitochondria. Exp. Toxicol. Pathol., 45, 375380.[Web of Science][Medline]
27 Levine, R.L., Williams, J.A., Stadtman, E.R. and Shacter, E. (1994) Carbonyl assays for determination of oxidatively modified proteins. Methods Enzymol., 233, 346357.[Web of Science][Medline]
28 Ohkawa, H., Ohishi, N. and Yagi, K. (1979) Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal. Biochem., 95, 351358.[Web of Science][Medline]
29 Link, C.D. (1995) Expression of human ß-amyloid peptide in transgenic Caenorhabditis elegans. Proc. Natl Acad. Sci. USA, 92, 93689372.
30 Elia, A.J., Parkes, T.L., Kirby, K., St George-Hyslop, P., Boulianne, G.L., Phillips, J.P. and Hilliker, A.J. (1999) Expression of human FALS SOD in motorneurons of Drosophila. Free Radic. Biol. Med., 26, 13321338.[Web of Science][Medline]
31 Nishida, A., Misaki, Y., Kuruta, H. and Takashima, S. (1994) Developmental expression of copper, zinc-superoxide dismutase in human brain by chemiluminescence. Brain Dev., 16, 4043.[Web of Science][Medline]
32 Lee, M., Hyun, D.H., Jenner, P. and Halliwell, B. (2001) Effect of overexpression of wild-type and mutant Cu/Zn-superoxide dismutases on oxidative damage and antioxidant defences: relevance to Downs syndrome and familial amyotrophic lateral sclerosis. J. Neurochem., 76, 957965.[Web of Science][Medline]
33 Yanase, S. and Ishii, N. (1999) Cloning of the oxidative stress-responsive genes in Caenorhabditis elegans. J. Radiat. Res. (Tokyo), 40, 3947.[Medline]
34 Borchelt, D.R., Guarnieri, M., Wong, P.C., Lee, M.K., Slunt, H.S., Xu, Z.S., Sisodia, S.S., Price, D.L. and Cleveland, D.W. (1995) Superoxide dismutase 1 subunits with mutations linked to familial amyotrophic lateral sclerosis do not affect wild-type subunit function. J. Biol. Chem., 270, 32343238.
35 Nakano, R., Inuzuka, T., Kikugawa, K., Takahashi, H., Sakimura, K., Fujii, J., Taniguchi, N. and Tsuji, S. (1996) Instability of mutant Cu/Zn superoxide dismutase (Ala4Thr) associated with familial amyotrophic lateral sclerosis. Neurosci. Lett., 211, 129131.[Web of Science][Medline]
36 Grune, T., Reinheckel, T. and Davies, K.J. (1997) Degradation of oxidized proteins in mammalian cells. FASEB J., 11, 526534.[Abstract]
37 Hilt, W. and Wolf, D.H. (1996) Proteasomes: destruction as a programme. Trends Biochem. Sci., 21, 96102.[Web of Science][Medline]
38 Hoffman, E.K., Wilcox, H.M., Scott, R.W. and Siman, R. (1996) Proteasome inhibition enhances the stability of mouse Cu/Zn superoxide dismutase with mutations linked to familial amyotrophic lateral sclerosis. J. Neurol. Sci., 139, 1520.[Web of Science][Medline]
39 Reinheckel, T., Sitte, N., Ullrich, O., Kuckelkorn, U., Davies, K.J. and Grune, T. (1998) Comparative resistance of the 20S and 26S proteasome to oxidative stress. Biochem. J., 335, 637642.
40 Davies, K.J., Lin, S.W. and Pacifici, R.E. (1987) Protein damage and degradation by oxygen radicals. IV. Degradation of denatured protein. J. Biol. Chem., 262, 99149920.
41 Bruijn, L.I., Houseweart, M.K., Kato, S., Anderson, K.L., Anderson, S.D., Ohama, E., Reaume, A.G., Scott, R.W. and Cleveland, D.W. (1998) Aggregation and motor neuron toxicity of an ALS-linked SOD1 mutant independent from wild-type SOD1. Science, 281, 18511854.
42 Shibata, N., Hirano, A., Kato, S., Nagai, R., Horiuchi, S., Komori, T., Umahara, T., Asayama, K. and Kobayashi, M. (1999) Advanced glycation endproducts are deposited in neuronal hyaline inclusions: a study on familial amyotrophic lateral sclerosis with superoxide dismutase-1 mutation. Acta Neuropathol. (Berl.), 97, 240246.[Medline]
43 Stieber, A., Gonatas, J.O. and Gonatas, N.K. (2000) Aggregation of ubiquitin and a mutant ALS-linked SOD1 protein correlate with disease progression and fragmentation of the Golgi apparatus. J. Neurol. Sci., 173, 5362.[Web of Science][Medline]
44 Johnston, J.A., Dalton, M.J., Gurney, M.E. and Kopito, R.R. (2000) Formation of high molecular weight complexes of mutant Cu,Zn-superoxide dismutase in a mouse model for familial amyotrophic lateral sclerosis. Proc. Natl Acad. Sci. USA, 97, 1257112576.
45 Nohl, H., Staniek, K. and Gille, L. (1997) Imbalance of oxygen activation and energy metabolism as a consequence or mediator of aging. Exp. Gerontol., 32, 485500.[Web of Science][Medline]
46 Oosthuyse, B., Moons, L., Storkebaum, E., Beck, H., Nuyens, D., Brusselmans, K., Dorpe, J.V., Hellings, P., Gorselink, M., Heymans, S. et al. (2001) Deletion of the hypoxia-response element in the vascular endothelial growth factor promoter causes motor neuron degeneration. Nat. Genet., 28, 131138.[Web of Science][Medline]
47 Mello, C.C., Kramer, J.M., Stinchcomb, D. and Ambros, V. (1991) Efficient gene transfer in C.elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J., 10, 39593970.[Web of Science][Medline]
48 Kramer, J.M., French, R.P., Park, E.C. and Johnson, J.J. (1990) The Caenorhabditis elegans rol-6 gene, which interacts with the sqt-1 collagen gene to determine organismal morphology, encodes a collagen. Mol. Cell. Biol., 10, 20812089.
49 Brenner, S. (1974) The genetics of Caenorhabditis elegans. Genetics, 77, 7194.
50 Bradford, M.M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of proteindye binding. Anal. Biochem., 72, 248254.[Web of Science][Medline]
51 Sulston, J.E. and Brenner, S. (1974) The DNA of Caenorhabditis elegans. Genetics, 77, 95104.
52 Carlioz, A. and Touati, D. (1986) Isolation of superoxide dismutase mutants in Escherichia coli: is superoxide dismutase necessary for aerobic life? EMBO J., 5, 623630.[Web of Science][Medline]
53 Blum, J. and Fridovich, I. (1983) Superoxide, hydrogen peroxide, and oxygen toxicity in two free-living nematode species. Arch. Biochem. Biophys., 222, 3543.[Web of Science][Medline]
54 Beauchamp, C. and Fridovich, I. (1971) Superoxide dismutase: improved assays and an assay applicable to acrylamide gels. Anal. Biochem., 44, 276287.[Web of Science][Medline]
55 Emmons, S.W., Klass, M.R. and Hirsh, D. (1979) Analysis of the constancy of DNA sequences during development and evolution of the nematode Caenorhabditis elegans. Proc. Natl Acad. Sci. USA, 76, 13331337.
56 Ishii, N., Takahashi, K., Tomita, S., Keino, T., Honda, S., Yoshino, K. and Suzuki, K. (1990) A methyl viologen-sensitive mutant of the nematode Caenorhabditis elegans. Mutat. Res., 237, 165171.[Web of Science][Medline]
57 Hosono, R. (1978) Sterilization and growth inhibition of Caenorhabditis elegans by 5-fluorodeoxyuridine. Exp. Gerontol., 13, 369374.[Web of Science][Medline]
58 McIntire, S.L., Garriga, G., White, J., Jacobson, D. and Horvitz, H.R. (1992) Genes necessary for directed axonal elongation or fasciculation in C. elegans. Neuron, 8, 307322.[Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
H. Witan, A. Kern, I. Koziollek-Drechsler, R. Wade, C. Behl, and A. M. Clement Heterodimer formation of wild-type and amyotrophic lateral sclerosis-causing mutant Cu/Zn-superoxide dismutase induces toxicity independent of protein aggregation Hum. Mol. Genet., May 15, 2008; 17(10): 1373 - 1385. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Lemmens, A. Van Hoecke, N. Hersmus, V. Geelen, I. D'Hollander, V. Thijs, L. Van Den Bosch, P. Carmeliet, and W. Robberecht Overexpression of mutant superoxide dismutase 1 causes a motor axonopathy in the zebrafish Hum. Mol. Genet., October 1, 2007; 16(19): 2359 - 2365. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Furukawa, R. Fu, H.-X. Deng, T. Siddique, and T. V. O'Halloran From the Cover: Disulfide cross-linked protein represents a significant fraction of ALS-associated Cu, Zn-superoxide dismutase aggregates in spinal cords of model mice PNAS, May 2, 2006; 103(18): 7148 - 7153. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Di Noto, L. J. Whitson, X. Cao, P. J. Hart, and R. L. Levine Proteasomal Degradation of Mutant Superoxide Dismutases Linked to Amyotrophic Lateral Sclerosis J. Biol. Chem., December 2, 2005; 280(48): 39907 - 39913. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. G. Kirkinezos, S. R. Bacman, D. Hernandez, J. Oca-Cossio, L. J. Arias, M. A. Perez-Pinzon, W. G. Bradley, and C. T. Moraes Cytochrome c Association with the Inner Mitochondrial Membrane Is Impaired in the CNS of G93A-SOD1 Mice J. Neurosci., January 5, 2005; 25(1): 164 - 172. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. A. Nollen, S. M. Garcia, G. van Haaften, S. Kim, A. Chavez, R. I. Morimoto, and R. H. A. Plasterk From The Cover: Genome-wide RNA interference screen identifies previously undescribed regulators of polyglutamine aggregation PNAS, April 27, 2004; 101(17): 6403 - 6408. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Tiwari and L. J. Hayward Familial Amyotrophic Lateral Sclerosis Mutants of Copper/Zinc Superoxide Dismutase Are Susceptible to Disulfide Reduction J. Biol. Chem., February 14, 2003; 278(8): 5984 - 5992. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||










