Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (33)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Raben, N.
Right arrow Articles by Plotz, P.H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Raben, N.
Right arrow Articles by Plotz, P.H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2001, Vol. 10, No. 19 2039-2047
© 2001 Oxford University Press

Conditional tissue-specific expression of the acid {alpha}-glucosidase (GAA) gene in the GAA knockout mice: implications for therapy

N. Raben+, N. Lu, K. Nagaraju, Y. Rivera, A. Lee, B. Yan, B. Byrne1, P.J. Meikle2, K. Umapathysivam2, J.J. Hopwood2 and P.H. Plotz

Arthritis and Rheumatism Branch, NIAMS, 9000 Rockville Pike, Clinical Center Building 10/9N244, National Institutes of Health, Bethesda, MD 20892, USA, 1Gene Therapy Center and Departments of Medicine, Pediatrics, and Molecular Genetics, University of Florida College of Medicine, Gainesville, FL 32610, USA and 2Department of Chemical Pathology, Women’s and Children’s Hospital, North Adelaide, 5006 Australia

Received June 11, 2001; Revised and Accepted July 13, 2001.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Both enzyme replacement and gene therapy of lysosomal storage disorders rely on the receptor-mediated uptake of lysosomal enzymes secreted by cells, and for each lysosomal disorder it is necessary to select the correct cell type for recombinant enzyme production or for targeting gene therapy. For example, for the therapy of Pompe disease, a severe metabolic myopathy and cardiomyopathy caused by deficiency of acid {alpha}-glucosidase (GAA), skeletal muscle seems an obvious choice as a depot organ for local therapy and for the delivery of the recombinant enzyme into the systemic circulation. Using knockout mice with this disease and transgenes containing cDNA for the human enzyme under muscle or liver specific promoters controlled by tetracycline, we have demonstrated that the liver provided enzyme far more efficiently. The achievement of therapeutic levels with skeletal muscle transduction required the entire muscle mass to produce high levels of enzyme of which little found its way to the plasma, whereas liver, comprising <5% of body weight, secreted 100-fold more enzyme, all of which was in the active 110 kDa precursor form. Furthermore, using tetracycline regulation, we somatically induced human GAA in the knockout mice, and demonstrated that the skeletal and cardiac muscle pathology was completely reversible if the treatment was begun early.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Although limited success has been achieved with both enzyme and gene replacement in genetic enzyme deficiencies, it is now apparent that the particular problems posed by each disease will inhibit the spread of success by imitation. In addition to the problems of vector design, the choice of the optimal location for the production of an enzyme depends on factors such as the efficient production of a protein that can be exported, circulated, and taken up and processed by affected cells. The same issues arise if the enzyme is made by cells cultured in vitro and then injected.

The current state of attempts to treat glycogen storage disease type II (GSDII) illustrates some of the problems. In this disorder caused by the deficiency of acid {alpha}-glucosidase (GAA), lysosomal glycogen accumulates in cells. Severe deficiency (Pompe syndrome) manifests as a rapidly progressive hypertrophic cardiomyopathy leading to cardiac failure and death before 2 years of age. Partial deficiency results in a progressive limb-girdle-like myopathy, eventually leading to death from respiratory insufficiency (1).

The enzyme is synthesized as a catalytically active precursor that is glycosylated and modified in the Golgi by phosphorylation of mannose residues. Most of the modified precursor goes to the lysosomal compartment, but a portion is secreted, and this extracellular enzyme can be internalized by other cells. The discovery of this secretion–recapture mechanism via mannose-6-phosphate (M6P) receptors on plasma membrane (24) or by an M6P-independent pathway (5) has provided a rationale for both cell-mediated and direct enzyme replacement therapies for GSDII and other lysosomal disorders (68). Clinical trials with recombinant human GAA (rhGAA) produced in Chinese hamster ovary cells or in transgenic rabbit milk (911) have recently been initiated by two groups (1215), and gene replacement techniques are being explored as well. Skeletal muscle is an attractive site for somatic gene therapy due to its large mass, high vascularity, and large capacity for protein synthesis, which allows de novo synthesized proteins access to the systemic circulation. Indeed, a number of studies have demonstrated that skeletal muscle gene therapy can result in sustained and systemic delivery of therapeutic proteins (1620). Furthermore, the idea that easily injectable skeletal muscles of the limbs and trunk which need enzyme replacement might also be a good location for providing enzyme for other affected muscles such as the diaphragm and the heart is appealing, but the decision about the best location must be based on solid experimental grounds. In vitro and ex vivo studies using adenovirus- and retrovirus-mediated gene transfer demonstrated that transduced muscle cells were able to secrete recombinant GAA and provide phenotypic correction of GAA-deficient muscle cells (21,22), but the results of in vivo experiments were less convincing; transfer of the GAA gene into skeletal muscle was accompanied by enzyme secretion in some of the studies (23), but not in others (24,25). Recent in vivo observations have demonstrated the benefits of hepatic-targeted transduction for gene therapy of GSDII (2628).

The major purpose of the study reported here was to compare the efficiency of skeletal muscle and liver as locations for gene replacement therapy in GSDII and to determine whether or not established disease can be reversed. We have over-expressed hGAA cDNA in skeletal muscle or liver of GAA knockout mice (–/–) by using tissue-specific promoters, and we have used a tetracycline-responsive system so that expression of the transgene can be initiated somatically at different stages of disease progression (29,30).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Expression of hGAA in skeletal muscle of knockout mice
Three transgenic hGAA founder lines (F.06, F.53 and F.17) were generated, and each was crossed to GAA–/– mice, resulting in three hGAA/–/– lines. Each of these lines, in turn, was crossed to Mck-T transgenic mice, already on a –/– background (Mck-T/–/–). These double transgenic mice, Mck-T-hGAA/–/–, were designed to constitutively express hGAA in skeletal muscle of knockout animals. Single transgenic mice on either +/– or –/– backgrounds were used as controls. The single transgenics on a –/– background showed a very low, probably non-specific enzyme activity in all tissues tested (Table 1). The double transgenics derived from each of the three hGAA founders expressed low, intermediate or high levels of hGAA in skeletal muscle as reflected by the intensity of green fluorescent protein (GFP) (Fig. 1).


View this table:
[in this window]
[in a new window]
 
Table 1. GAA activity in double transgenic mice and controls (nmol/h/mg protein)
 


View larger version (76K):
[in this window]
[in a new window]
 
Figure 1. Expression of GFP in skeletal muscle of the Mck-T-hGAA/–/– mice. (A) Single transgenic control (hGAA/–/–). Three double transgenic lines derived from three independent founders (F.06, F.P53 and F.17) showed low (B), intermediate (C) or high (D) levels of GAA activity in skeletal muscle. Muscle cells were examined under a fluorescent microscope using excitation light.

 
In the low expresser line, the level of GAA activity in skeletal muscle was 5-fold higher than in +/– mice (Table 1), and GAA protein was detected by western analysis in skeletal muscle, but not in any other organ (Fig. 2A). The increase of enzyme activity in skeletal muscle was accompanied by a normalization of glycogen level to wild-type values (Table 2), a finding confirmed by light microscopy (Fig. 2Be). There was no detectable enzyme activity in plasma, however (Table 1), nor was there any significant increase in the levels of GAA activity in the distant organs compared with the levels in –/– mice. In fact, the glycogen level in the heart progressively increased at a rate similar to that in the knockouts. Light microscopy confirmed these results (Fig. 2Bf–h). Thus, no secretion or uptake occurred with this level of gene expression in skeletal muscle.



View larger version (88K):
[in this window]
[in a new window]
 
Figure 2. Analysis of the low muscle expresser line (F.06). (A) Western blot analysis. S, spleen; Li, liver; H, heart; M, skeletal muscle. The 76 kDa form of hGAA is detected only in skeletal muscles from double transgenic mice. Control is an age-matched single transgenic (Mck-T/–/–) littermate. Immunodetection of vinculin was used for loading control. The gels were loaded with 100 µg protein. (B) PAS-stained sections of skeletal muscle, heart, liver and brain from control (Mck-T/–/–) (a–d) and double transgenic (e–h) mice at 4 months of age. Original magnification: x20.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Glycogen content in double transgenic and control mice (% wet weight)
 
In the intermediate expresser line, the GAA activity in skeletal muscle was ~80-fold higher than in +/– mice (Table 1). In these mice, hGAA mRNA was detected in both skeletal muscle and heart (Fig. 3A and B), but not in liver, lung, brain, kidney or spleen, and the lack of GFP expression in these target organs further supported the northern and RT–PCR data (Fig. 3C, lower panel). Thus, systemic correction could be studied in these target organs.



View larger version (61K):
[in this window]
[in a new window]
 
Figure 3. Analysis of the intermediate muscle expresser line (F. P53). (A) Northern blot analysis. M, skeletal muscle; H, heart; Li, liver; Lu, lung; B, brain; K, kidney; S, spleen. The transgene is expressed only in skeletal muscle and heart. Lower panel shows ethidium bromide-stained gel used for northern blot. (B) RT–PCR analysis with primers in exons 14 and 15 of the hGAA detected a 170 bp product only in skeletal muscle and heart. (C) Immunodetection of hGAA (upper panel) and GFP (lower panel) proteins using specific antibodies. Note that the gel was loaded with 5 µg of protein for skeletal muscle and heart. hGAA is a 76 kDa protein and GFP is a 29 kDa protein. hGAA protein is detected in skeletal muscle, heart, liver, lung and spleen; 110 kDa precursor is detected in plasma (P) after a prolonged exposure (top right panel). (D) PAS-stained sections of skeletal muscle (a), liver (b) and brain (c) at 5 months of age. Original magnification: muscle and liver, x20; brain, x40.

 
The hGAA protein was detected by western blot in liver, lung and spleen (Fig. 3C, top panel), and increased GAA activity in these organs reached ~50, 69 and 80%, respectively, of the values in +/– controls. Low levels of GAA activity could be detected in plasma by the enzyme assay (Table 1) and western analysis; the 110 kDa precursor was visible after prolonged exposure (Fig. 3C, top right panel). Morphologically, skeletal muscle was completely cleared of glycogen, and the secreted protein provided a phenotypic rescue in distant organs (shown for liver in Fig. 3Db). No protein was detected in brain and kidney (Fig. 3C), and glycogen in these organs was not reduced (shown for brain in Fig. 3Dc).

In the high expresser line, hGAA was expressed in skeletal muscle and heart, and the levels of enzyme activity reached 1082 ± 142 and 793 ± 85 nmol/h/mg/protein, respectively. These levels were ~200-fold higher than in +/– mice in skeletal muscle and ~90-fold higher in heart. Although glycogen content in these organs was reduced significantly, morphologically both skeletal and cardiac muscles contained multiple periodic acid-Schiff (PAS)-positive cells, with some cells of abnormal shape and smaller size (Fig. 4), suggesting that the high GAA levels might be toxic to the cells. For this reason, this line was not used for cross-correction studies.



View larger version (68K):
[in this window]
[in a new window]
 
Figure 4. Analysis by light microscopy (PAS-stained sections) of skeletal muscle (A) and heart (B) from the high expresser line at 5 months of age. Original magnification: x63.

 
Expression of hGAA in the liver of knockout mice
Two transgenic Alb-T founder lines (F.21 and F.26) were generated, and both were crossed to –/– mice, resulting in two Alb-T/–/– lines which were then crossed to hGAA/–/– (F.17) to generate double transgenics that constitutively express hGAA in the liver. The expression of the transgene in the two lines was similar, as shown by the intensity of GFP staining in liver (Fig. 5), and in both lines the hepatic GAA activity was ~25-fold greater than in +/– controls. Results with only one line (F.21/F.17) are presented here.



View larger version (33K):
[in this window]
[in a new window]
 
Figure 5. Expression of GFP in livers of the Alb-T-hGAA/–/– mice. Liver cells were examined under a fluorescent microscope using excitation light. (A) Single transgenic control (hGAA/–/–). Two double transgenic lines derived from two independent founders (F. 21 and F. 26) showed similar levels of GFP expression (B and C).

 
hGAA mRNA was detected only in the liver in double transgenic mice by northern analysis and RT–PCR, but not in skeletal muscle and heart—the two most affected organs of GSDII (Fig. 6A and B). hGAA protein, however, was detected in all three organs by western analysis, implying that the enzyme was secreted by liver and taken up by skeletal muscle and heart (Fig. 6C). Indeed, high levels of 110 kDa GAA precursor were detected in plasma by western analysis. The level of enzyme activity in plasma was extremely high (424 nmol/h/mg)—more than 100 times greater than the values observed in the intermediate Mck-T-hGAA/–/– line. Both skeletal muscle and heart were cross-corrected by the circulating enzyme; GAA activity in these organs was significantly elevated compared with the levels in +/– controls, by ~5-fold in muscle and ~4-fold in heart (Table 1). Both organs appeared morphologically normal, except for occasional muscle fibers with PAS-positive material (Fig. 6De and f). Consistent with these results, glycogen content in skeletal muscle and heart was at near undetectable levels (Table 2).



View larger version (71K):
[in this window]
[in a new window]
 
Figure 6. Analysis of liver expresser line. (A) Northern blot analysis. Li, liver; M, muscle; H, heart. The hGAA transgene is expressed only in liver. Lower panel shows ethidium bromide-stained gel used for northern blot. (B) RT–PCR analysis of cDNA from respective tissues. The primers in exons 5 and 7 of the hGAA detected a 270 bp product only in liver (top); Southern blot analysis with a probe in exon 6 detected a signal only in liver (bottom). (C) Immunodetection of hGAA (upper panel) and GFP (lower panel) proteins using specific antibodies. Note that the gel was loaded with 10 µg of protein for liver. hGAA is a 76 kDa protein and GFP is a 29 kDa protein. hGAA protein is detected in liver, muscle and heart; 110 kDa precursor form is easily detectable in plasma (P). Control is a single transgenic (Alb-T/–/–) littermate. (D) PAS-stained sections of liver, muscle and heart from control (a–c) and double transgenic Alb-T-hGAA/–/– mice at 3 months of age (d–f). Arrows point to occasional muscle cells containing PAS-positive material. Original magnification: x20.

 
Regulation of expression by tetracycline
Double transgenic animals from each of the three Mck-T-hGAA/–/– lines (n = 10) were maintained on doxycycline (dox) since birth for different periods of time: 6, 7, 11, 14, 18, 20 or 40 weeks (gene off). In all the animals, GAA expression was completely abrogated by tetracycline, reaching 0.9 ± 0.38 nmol/h/mg in skeletal muscle, indicating a tight regulation of GAA expression by the drug. In the intermediate Mck-T-hGAA/–/– expresser line dox was removed after 3 weeks (gene off/on; n = 2). The effect of dox in these mice was monitored by tail GAA analysis; GAA activity was still down at 1.5–2 weeks, but increased at 4.5 weeks after dox removal, and at this point the animals were killed. Three-week-old (–/– or single transgenic on a –/– background; n = 3) and 7.5-week-old control mice showed significant accumulation of glycogen in multiple organs (Fig. 7, top and bottom panels). In the gene off/on group, hGAA expression was efficiently induced, reaching 291 nmol/h/mg (average for two muscle groups: quadriceps and gastrocnemius) in skeletal muscle, and the protein was detected by western analysis (not shown). The level of glycogen in muscle, heart, liver and diaphragm of these mice normalized, and histological evaluation revealed complete clearance of glycogen (Fig. 7, middle panel).



View larger version (146K):
[in this window]
[in a new window]
 
Figure 7. Reversal of pathology after somatic induction of the hGAA. PAS-stained sections of skeletal muscle (left), heart (middle) and diaphragm (right). Three-week-old –/– (AC) and 7.5-week-old control mice (GI). (DF) Double transgenic Mck-T-hGAA/–/– (F. P53) mice from gene off/on group.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
For diseases like GSDII in which multiple organs are affected by the deficiency of an enzyme, systemic delivery of the replacement enzyme—whether by injection or by gene therapy—is essential. Although it is possible that systemic delivery of rhGAA produced in vitro will provide a satisfactory treatment, gene replacement remains an attractive alternative to a lifetime of injections. Thus, the best location for a replacement gene is one of the central issues to be decided.

In GSDII, the most critically affected muscles—the diaphragm, intercostal muscles and heart—are virtually inaccessible to direct injection. Since only a small proportion of normal GAA activity is required to prevent clinical disease, low levels of circulating enzyme should be sufficient to provide phenotypic correction in distant organs (31). In vitro and ex vivo trials of GAA delivery from transduced cultured cells to cultured mutant cells have been encouraging. A significant increase in the GAA enzyme level in deficient muscle cells and the phenotypic correction of cultured muscle cells from a GSDII patient was obtained with a recombinant adenovirus containing the human gene (22). A high level of GAA expression was also observed in GAA-deficient myoblasts transduced with a GAA-encoding retrovirus, and those gene-corrected myoblasts provided enzyme to deficient muscle cells by both secretion and cell fusion (21). The implication of these studies is that ex vivo transduced myoblasts from patients could be implanted into the muscles of affected individuals and would then secrete the enzyme for uptake by other cells.

The results of the in vivo muscle-mediated GAA delivery, however, have been disappointing. Intracardiac or intramuscular administration of Ad-GAA into newborn rats resulted in high levels of GAA expression locally, but the heart, liver, contralateral muscle and sera showed no increase in GAA activity (24). Similarly, a recombinant Ad-GAA injected into muscle of GAA-deficient quails resulted only in local correction (25). The failure to provide a systemic correction was attributed to a relatively short duration of the locally expressed transgene.

We have now demonstrated that even when the transgene is constitutively expressed in the entire muscle mass at levels exceeding five times those in +/– controls, no secretion by muscle cells and no uptake by distant tissues occurred. Since the expression of the transgene in this line is limited to skeletal muscle, other organs including heart and brain accumulate glycogen at a rate similar to that in the –/– mice. Occasional muscle cells in this line still contain lysosomal glycogen, indicating that this level of enzyme does not reliably provide the correction of neighboring cells. A low level of GAA secretion from skeletal muscle was observed in mice constitutively expressing 80-fold increased activity compared with +/– controls (intermediate expresser line). The high GAA levels in the heart of these mice were a result of the transgene expression rather than uptake of secreted enzyme, but the increased GAA activity in liver, lung and spleen reflected uptake of enzyme secreted by the muscle source.

An extremely high level of GAA expression in skeletal muscle (high expresser line) was not well tolerated, and virtually every cell contained small lysosomes with PAS-positive material. Excess of GAA rather than the transactivator is most likely to be responsible for the effect since the same Mck-T line was used to generate three double transgenic lines expressing hGAA in skeletal muscle.

In other lysosomal diseases, in vivo muscle-mediated gene therapy has not been very promising either. AAV-mediated skeletal muscle gene transfer (human ß-glucuronidase) in neonatal mice with mucopolysaccharidosis type VII showed that the secretion of the enzyme from an intramuscular source was inefficient (32). Similarly, no enzymatic activity was found in serum or peripheral organs in hexosaminidase A-deficient knockout mice (Tay-Sachs disease) after muscle-mediated gene therapy (33).

The liver, however, proved an efficient organ for production and secretion of GAA protein into the bloodstream and uptake in peripheral tissues. Comparable levels of transgene expression in both muscle and liver result in a dramatically different amount of secreted protein. In the liver line, only the 110 kDa precursor, but not the processed forms, was detected in plasma, indicating that the liver cells were not damaged. Furthermore, the enzyme was taken up by skeletal muscle and heart, and targeted to lysosomes where it prevented glycogen accumulation. Thus, the liver, whose mass is <5% of body weight, could fully correct all distant affected tissues except brain, when producing 25-fold more enzyme than the liver of +/– mice, while the muscle, whose mass is ~40% of body weight, was able to provide correction in distant tissues only when producing 80-fold more enzyme than +/– mice. It is not clear why there is such a difference in the level of secreted GAA from muscle and liver. GAA is normally an intracellular enzyme, and the mechanism by which a small portion of the enzyme is secreted is not well understood. It is possible that the secretory pathway is not as efficient in skeletal muscle cells as in hepatocytes. Efficient hexosaminidase, and {alpha}-galactosidase A secretion and restoration of enzyme activity was similarly observed after liver transduction (33,34), and hepatic targeting of an Ad vector encoding GAA resulted in systemic correction in knockout mice (2628).

These findings imply that cultured liver cells could potentially provide a source of the recombinant protein, that both skeletal muscle and heart have a significant capacity to take up the protein as long as it is properly processed, and that the expression of GAA in liver at levels lower than we tested may be sufficient to provide cross-correction, since the GAA activity in muscle and heart was significantly higher than needed to remain phenotypically normal.

Finally, the disease in the knockout mice was reversible. In mice allowed to develop morphological changes over the first 3 weeks of life, accumulated glycogen disappeared completely 1 month after the transgene was turned on. The success of this experiment should allow the size of the window of opportunity for therapeutic effect in clinically affected individuals to be determined.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Generation of transgenic mouse strains
Transgenic strain containing hGAA cDNA. hGAA fragment was released from pCDNA3 (a gift from Dr Frank Martiniuk, New York University Medical Center) by digestion with HindIII/XhoI, and cloned into HindIII/SalI sites of pTRE2 (Clontech, Palo Alto, CA) to give rise to pTRE2-hGAA. In this plasmid, the hGAA is linked to the tetracycline responsive element (TRE) to which the tetracycline-controlled transcriptional activator (tTA) binds in the absence of tetracycline. Next, the internal ribosome entry site (IRES)-enhanced GFP (EGFP) fragment containing the GFP was released from pIRES2-EGFP (Clontech) by digestion with SmaI/XbaI, and cloned into pTRE2-hGAA to give rise to pTRE2-hGAA-IRES-EGFP. The TRE-hGAA-IRES-EGFP-ß-globin poly A fragment was released by XhoI/SapI digest, gel purified and used for microinjection into FVB embryos. These mice are referred to as hGAA.

Transgenic strain containing tTA under the control of liver specific albumin promoter. The tTA fragment linked to SV40 poly A was cloned into the PstI sites of pcDNA2.1 (Invitrogen, San Diego, CA) to give rise to pcDNA2.1-tTA. Next, the mouse albumin promoter/enhancer was released from pGEMAlbSVPA (a kind gift from Dr T. Jake Liang, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health) (35) with ApaI/NotI and cloned into pcDNA2.1-tTA to generate pcDNA2.1-Alb-tTA. Then a 500 bp fragment of the chicken ß-globin core insulator (36) was PCR amplified from pNI-CD (a gift from Dr Gary Felsenfeld, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health) and cloned into both ApaI and SapI sites of the pcDNA2.1-tTA. The insulator-Alb-tTA-SV40 poly A-insulator fragment was released by PacI digestion, gel purified by electroelution, and used for microinjection into FVB embryos. These mice are referred to as Alb-T.

Transgenic strain containing tTA under the control of muscle specific creatine kinase promoter. Generation of this strain, referred to as Mck-T, was described previously (37).

Genotyping of transgenic lines and breeding strategy
Southern analysis of the founders and F1 progeny from both hGAA and Alb-T transgenic lines revealed integration of the injection fragment. Genomic DNA was isolated from tail clips, digested with EcoRI, and genotyping was performed using standard procedures. For hGAA, a 733 bp fragment from pIRES2-EGFP vector (BstxI/XbaI digest) was used as a probe, resulting in an ~2 kb fragment. For Mck-T and Alb-T, an ~1.5 kb fragment from pTet-Off (Clontech) (EcoRI/HindIII digest) was used as a probe, resulting in ~13 and ~2.6 kb fragments, respectively. The probes were labeled by the random hexamer method (Lofstrand, Gaithersburg, MD). Each of the three transgenic strains was crossed to the knockout mice (–/–) in which the GAA gene was disrupted in the middle of exon 6 (38,39). Tail DNA was screened by Southern analysis to identify –/– mice, as described previously (38). The resulting lines are referred to as hGAA/–/–, Mck-T/–/– and Alb-T/–/–.

hGAA/–/– mice were mated to either Mck-T/–/– or Alb-T/–/– mice to generate double transgenics expressing hGAA in skeletal muscle or in liver of the –/– mice (FVB x C57BL6/129 SVj). The resulting lines are referred to as Mck-T-hGAA/–/– and Alb-T-hGAA/–/–.

Administration of dox
Slow release dox pellets (90-day release; 0.7 mg dox per day) (Innovative Research of America, Sarasota, FL) were implanted subcutaneously using a trochar as described by the manufacturer. Alternatively, mice on dox treatment were given 2 mg/ml dox in a 5% sucrose solution instead of drinking water. Females were administered dox pellets prior to mating so that the transgenic offspring were exposed to the drug in utero.

Light microscopy
Tissues were fixed in 10% formalin, embedded in paraffin, and stained with PAS by standard methods. The animals were starved overnight before death. For GFP detection, tissues were snap frozen, embedded in paraffin and examined under a fluorescent microscope.

GAA enzyme assay, western blot analysis and glycogen content
GAA activity in the tissue homogenates was measured by conversion of the substrate 4-methylumbelliferyl (4-MU) {alpha}-D-glucoside to the fluorescent product umbelliferone as described by Hermans et al. (40). Blood spots on Guthrie cards were used to determine GAA activity in plasma as described by Umapathysivam et al. (41). Western blot analysis was performed as described by Ghersa et al. (37); the blots were incubated with rabbit antiserum to hGAA (a gift of Dr Y.T. Chen, Duke University). Immunodetection was performed with goat anti-rabbit-IgG conjugated to horseradish peroxidase in combination with chemiluminescence (Santa Cruz Biotechnology, Santa Cruz, CA). Total protein concentration of the lysates was measured using Bio-Rad protein assay reagent (Bio-Rad Laboratories, Hercules, CA). Living Colors A.v. Monoclonal Antibody (JL-8) (Clontech) and anti-mouse-IgG-HRP (Santa Cruz Biotechnology) were used to detect EGFP. Glycogen concentration was determined by measuring the amount of glucose released after treatment of tissue extracts with Aspergillus niger amyloglucosidase as described by Kikuchi et al. (42).

Northern analysis and RT–PCR
Total RNA was isolated from tissues using TRIzol reagent (Life Technologies, Gaithersburg, MD) and northern analysis was performed according to standard procedure. An ~1.2 kb SmaI fragment of the hGAA was used as a probe. RNA was digested with DNaseI using a DNA-free kit (Ambion, Austin, TX) as recommended by the manufacturer. First strand cDNA was primed from 1 µg RNA with random hexamers according to the manufacturer’s instructions (Boehringer Mannheim, Indianapolis, IN). Two microliters of the cDNA sample was used for PCR amplifications with primer pair cctttctacctggcgctggaggac/ggtgatagcggtggaggagta (hGAA exon-5-sense/exon-7-antisense) or cccttcatgcggaaccacaacagcctgctc/agaggggccgggccacggtctcccccgc (hGAA exon-14-sense/exon-15-antisense). PCR was performed using SuperMix (Life Technologies). Conditions were denaturation at 95°C for 5 min, followed by 35 cycles at 95°C for 1 min, annealing at 55°C for 1 min and extension at 72°C for 1 min.

Statistical analysis
Data in text and figures are given as means ± standard error. The Student’s t-test was used for comparisons between the groups. Differences were considered significant at P < 0.005.


    FOOTNOTES
 
+ To whom correspondence should be addressed. Tel: +1 301 496 1474; Fax: +1 301 402 0012; Email: rabenn@arb.niams.nih.gov Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
1 Hirschhorn, R. (1995) Glycogen storage disease type II acid {alpha}-glucosidase (acid maltase) deficiency. In Scriver, C.R., Beaudet, A.L., Sly, W.S. and Valle, D. (eds), The Metabolic and Molecular Basis of Inherited Diseases. McGraw-Hill, New York, NY, pp. 2443–2464.

2 Reuser, A.J., Kroos, M.A., Ponne, N.J., Wolterman, R.A., Loonen, M.C., Busch, H.F., Visser, W.J. and Bolhuis, P.A. (1984) Uptake and stability of human and bovine acid {alpha}-glucosidase in cultured fibroblasts and skeletal muscle cells from glycogenosis type II patients. Exp. Cell Res., 155, 178–189.[Web of Science][Medline]

3 Hoefsloot, L.H., Willemsen, R., Kroos, M., Hoogeveen-Westerveld, M., Hermans, M.M., Van der Ploeg, A.T., Oostra, B.A. and Reuser, A.J.J. (1990) Expression and routeing of human lysosomal {alpha}-glucosidase in transiently transfected mammalian cells. Biochem. J., 272, 485–492.[Web of Science][Medline]

4 Wisselaar, H.A., Kroos, M.A., Hermans, M.M., Van Beeumen, J. and Reuser, A.J.J. (1993) Structural and functional changes of lysosomal acid {alpha}-glucosidase during intracellular transport and maturation. J. Biol. Chem., 268, 2223–2231.[Abstract/Free Full Text]

5 Tsuji, A., Omura, K. and Suzuki, Y. (1988) Intracellular transport of acid {alpha}-glucosidase in human fibroblasts: evidence for involvement of phosphomannosyl receptor-independent system. J. Biochem. (Tokyo), 104, 276–278.[Abstract/Free Full Text]

6 Van der Ploeg, A.T., Loonen, M.C.B., Bolhuis, P.A., Busch, H.M.F., Reuser, A.J. and Galjaard, H. (1988) Receptor-mediated uptake of acid {alpha}-glucosidase corrects lysosomal glycogen storage in cultured skeletal muscle. Pediatr. Res., 24, 90–94.[Web of Science][Medline]

7 Van der Ploeg, A.T., Kroos, M.A., Willemsen, R., Brons, H.N.C. and Reuser, A.J. (1991) Intravenous administration of phosphorylated acid {alpha}-glucosidase leads to uptake of enzyme in heart and skeletal muscle of mice. J. Clin. Invest., 87, 513–518.

8 Neufeld, E.F. (1991) Lysosomal storage diseases. Annu. Rev. Biochem., 60, 257–280.[Web of Science][Medline]

9 Fuller, M., Van der Ploeg, A.T., Reuser, A.J., Anson, D.S. and Hopwood, J.J. (1995) Isolation and characterization of a recombinant precursor form of lysosomal acid {alpha}-glucosidase. Eur. J. Biochem., 234, 903–909.[Web of Science][Medline]

10 Van Hove, J.L.K., Yang, H.W., Wu, J.Y., Brady, R.O. and Chen, Y.T. (1996) High level production of recombinant human lysosomal acid {alpha}-glucosidase in Chinese hamster ovary cells which targets to heart muscle and corrects glycogen accumulation in fibroblasts from patients with Pompe disease. Proc. Natl Acad. Sci. USA, 93, 65–70.[Abstract/Free Full Text]

11 Bijvoet, A.G.A., Van Hirtum, H., Kroos, M.A., Van de Kamp, E.H., Schoneveld, O., Visser, P., Brakenhoff, J.P., Weggeman, M., van Corven, E.J., Van der Ploeg, A.T. and Reuser, A.J. (1999) Human acid {alpha}-glucosidase from rabbit milk has therapeutic effect in mice with glycogen storage disease type II. Hum. Mol. Genet., 8, 2145–2153.[Abstract/Free Full Text]

12 Van den Hout, H., Reuser, A.J.J., Vulto, A.G., Loonen, M.C.B., Cromme-Dijkhuis, A. and Van der Ploeg, A.T. (2000) Recombinant human {alpha}-glucosidase from rabbit milk in Pompe patients. Lancet, 356, 397–398.[Web of Science][Medline]

13 Chen, Y.T. and Amalfitano, A. (2000) Towards a molecular therapy for glycogen storage disease type II (Pompe disease). Mol. Med. Today, 6, 245–251.[Web of Science][Medline]

14 Amalfitano, A., Bengur, A.R., Morse, R.P., Majure, J.M., Case, L.E., Veerling, D.L., Mackey, J., Kishnani, P., Smith, W., McVie-Wylie, A. et al. (2001) Recombinant human acid {alpha}-glucosidase enzyme therapy for infantile glycogen storage disease type II: results of a phase I/II clinical trial. Genet. Med., 3, 132–138.[Web of Science][Medline]

15 Van den Hout, J.M., Reuser, A.J., de Klerk, J.B., Arts, W.F., Smeitink, J.A. and Van der Ploeg, AT. (2001) Enzyme therapy for pompe disease with recombinant human alpha-glucosidase from rabbit milk. J. Inherit. Metab. Dis., 24, 266–274.

16 Kessler, P., Pdsakoff, G., Chen, X., McQuiston, S., Colosi, P., Matelis, L., Kurtzman, G. and Byrne, B. (1996) Gene delivery to skeletal muscle results in sustained expression and systemic delivery of a therapeutic protein. Proc. Natl Acad. Sci. USA, 93, 14082–14087.[Abstract/Free Full Text]

17 Herzog, R.W., Hagstrom, J.N., Kung, S.H., Tai, S.J., Wilson, J.M., Fisher, K.J. and High, K.A. (1997) Stable gene transfer and expression of human blood coagulation factor IX after intramuscular injection of recombinant adeno-associated virus. Proc. Natl Acad. Sci. USA, 94, 5804–5809.[Abstract/Free Full Text]

18 Hasse, G., Kennel, P., Pettmann, B., Vigne, E., Akli, S., Revah, F., Schmalbruch, H. and Kahn, A. (1997) Gene therapy of murine neuron disease using adenoviral vectors for neurotrophic factors. Nat. Med., 3, 429–436.[Web of Science][Medline]

19 Vincent-Lacaze, N., Snyder, R., Gluzman, R., Bohl, D., Lagarde, C. and Danos, O. (1999) Structure of adeno-associated virus vector DNA following transduction of the skeletal muscle. J. Virol., 73, 1949–1955.[Abstract/Free Full Text]

20 Gros, L., Riu, E., Montoliu, L., Ontiveros, M., Lebrigand, L. and Bosch, F. (1999) Insulin production by engineered muscle cells. Hum. Gene Ther., 10, 1207–1217.[Web of Science][Medline]

21 Zaretsky, J., Candotti, F., Boerkoel, C., Adams, E., Yewdell, J., Blaese, M. and Plotz, P. (1997) Retroviral transfer of acid {alpha}-glucosidase cDNA to enzyme-deficient myoblasts results in phenotypic spread of the genotypic correction by both secretion and fusion. Hum. Gene Ther., 8, 1555–1563.[Web of Science][Medline]

22 Nicolino, M.P., Puech, J.P., Kremer, E.J., Reuser, A.J., Mbebi, C., Verdiere-Sahuque, M., Kahn, A. and Poenaru, L. (1998) Adenovirus-mediated transfer of the acid {alpha}-glucosidase gene into fibroblasts, myoblasts and myotubes from patients with glycogen storage disease type II leads to high level expression of enzyme and corrects glycogen accumulation. Hum. Mol. Genet., 7, 1695–1702.[Abstract/Free Full Text]

23 Poenaru, L. (2000) Approach to gene therapy of glycogenosis type II (Pompe disease). Mol. Genet. Metab., 70, 163–169.[Web of Science][Medline]

24 Pauly, D.F., Johns, D.C., Matelis, L.A., Lawrence, J.H., Byrne, B.J. and Kessler, P.D. (1998) Complete correction of acid {alpha}-glucosidase deficiency in Pompe disease fibroblasts in vitro, and lysosomally targeted expression in neonatal rat cardiac and skeletal muscle. Gene Ther., 5, 473–480.[Web of Science][Medline]

25 Tsujino, S., Kinoshita, N., Tashiro, T., Ikeda, K., Ichihara, N., Kikuchi, H., Hagiwara, Y., Mizutani, M., Kikuchi, T. and Sakuragawa, N. (1998) Adenovirus-mediated transfer of human acid maltase gene reduces glycogen accumulation in skeletal muscle of Japanese quail with acid maltase deficiency. Hum. Gene Ther., 9, 1609–1616.[Web of Science][Medline]

26 Amalfitano, A., McVie-Wylie, A.J., Hu, H., Dawson, T., Raben, N., Plotz, P. and Chen, Y.T. (1999) Systemic correction of the muscle disorder glycogen storage disease type II after hepatic targeting of a modified adenovirus vector encoding human acid {alpha}-glucosidase. Proc. Natl Acad. Sci. USA, 96, 8861–8866.[Abstract/Free Full Text]

27 Pauly, D., Fraites, T., Toma, C., Bayes, H., Huie, M., Hirschhorn, R., Plotz, P., Raben, N., Kessler, P. and Byrne, B. (2001) Intracellular transfer of the virally derived precursor form of acid {alpha}-glucosidase corrects the enzyme deficiency in inherited cardioskeletal myopathy Pompe disease. Hum. Gene Ther., 12, 527–538.[Web of Science][Medline]

28 Ding, E.Y., Hodges, B.L., Hu, H., McVie-Wylie, A.J., Serra, D., Migone, F.K., Pressley, D., Chen, Y.T. and Amalfitano, A. (2001) Long-term efficacy after [E1, polymerase] adenovirus-mediated transfer of human acid {alpha}-glucosidase gene into glycogen storage disease type II knockout mice. Hum. Gene Ther., 12, 955–965.[Web of Science][Medline]

29 Furth, P.A., Onge, L.S., Boger, H., Gruss, P., Gossen, M., Kistner, A., Bujard, H. and Henninghausen, L. (1994) Temporal control of gene expression in transgenic mice by a tetracycline-responsive promoter. Proc. Natl Acad. Sci. USA, 91, 9302–9306.[Abstract/Free Full Text]

30 Kistner, A., Gossen, M., Zimmermann, F., Jerecic, J., Ullmer, C., Lubbert, H. and Bujard., H. (1996) Doxycycline-mediated quantitative and tissue-specific control of gene expression in transgenic mice. Proc. Natl Acad. Sci. USA, 93, 10933–10938.[Abstract/Free Full Text]

31 Reuser, A.J.J., Kroos, M.A., Hermans, M.M., Bijvoet, A.G., Verbeet, M.P., van Diggelen, O.P., Kleijer, W.J. and Van der Ploeg, A.T. (1995) Glycogenosis type II (acid maltase deficiency). Muscle Nerve, 3 (suppl.), S61–S69.[Medline]

32 Daly, T., Okuyama, T., Vogler, C., Haskins, M., Muzyczka, N. and Sands, M. (1999) Neonatal intramuscular injection with recombinant adeno-associated virus results in prolonged ß-glucuronidase expression in situ and correction of liver pathology in mucopolysaccharidosis type VII mice. Hum. Gene Ther., 10, 85–94.[Web of Science][Medline]

33 Guidotti, J.E., Mignon, A., Haase, G., Caillaud, C., McDonell, N., Kahn, A. and Poenaru, L. (1999) Adenoviral gene therapy of the Tay-Sachs disease in hexosaminidase A-deficient knock-out mice. Hum. Mol. Genet., 8, 831–838.[Abstract/Free Full Text]

34 Jung, S.C., Han, I.P., Limaye, A., Xu, R., Gelderman, M.P., Zerfas, P., Tirumalai, K., Murray, G.J., During, M.J., Brady, R.O. and Qasba, P. (2001) Adeno-associated viral vector-mediated gene transfer results in long-term enzymatic and functional correction in multiple organs of Fabry mice. Proc. Natl Acad. Sci. USA, 98, 2676–2681.[Abstract/Free Full Text]

35 Manickan, E., Satoi, J., Wang, T.C. and Liang, T.J. (2001) Conditional liver specific expression of SV40 antigen leads to regulatable development of hepatic neoplasm in transgenic mice. J. Biol. Chem., 276, 13989–13994.[Abstract/Free Full Text]

36 Recillas-Targa, F., Bell, A.C. and Felsenfeld, G. (1999) Positional enhancer-blocking activity of the chicken ß-globin insulator in transiently transfected cells. Proc. Natl Acad. Sci. USA, 96, 14354–14359.[Abstract/Free Full Text]

37 Ghersa, P., Gobert, R.P., Sattonnet-Roche, P., Richards, C.A., Merlo Pich, E. and Hooft van Huijsduijnen, R. (1998) Highly controlled gene expression using combinations of a tissue-specific promoter, recombinant adenovirus and a tetracycline-regulatable transcription factor. Gene Ther., 5, 1213–1220.[Web of Science][Medline]

38 Raben, N., Nagaraju, K., Lee, E., Kessler, P., Byrne, B., Lee, L., LaMarca, M., King, C., Ward, J., Sauer, B. and Plotz, P. (1998) Targeted disruption of the acid {alpha}-glucosidase gene in mice causes an illness with critical features of both infantile and adult human glycogen storage disease type II. J. Biol. Chem., 273, 19086–19092.[Abstract/Free Full Text]

39 Raben, N., Nagaraju, K., Lee, E. and Plotz, P. (2000) Modulation of disease severity in mice with targeted disruption of the acid {alpha}-glucosidase gene. Neuromusc. Disord., 10, 283–291.[Web of Science][Medline]

40 Hermans, M.M., Kroos, M.A., van Beeumen, J., Oostra, B.A. and Reuser, A.J.J. (1991) Human lysosomal {alpha}-glucosidase. Characterization of the catalytic site. J. Biol. Chem., 266, 13507–13512.[Abstract/Free Full Text]

41 Umapathysivam, K., Whittle, A., Ranieri, E., Bindloss, C., Ravenscroft, E., Van Diggelen, O.P., Hopwood, J. and Meikle, P. (2000) Determination of acid {alpha}-glucosidase protein: evaluation as a screening marker for Pompe disease and other lysosomal storage disorders. Clin. Chem., 46, 1318–1325.[Abstract/Free Full Text]

42 Kikuchi, T., Yang, H.W., Pennybacker, M., Ichihara, N., Mizutani, M., Van Hove, J.L. and Chen, Y.T. (1998) Clinical and metabolic correction of Pompe disease by enzyme therapy in acid maltase deficient quail. J. Clin. Invest., 101, 827–833.[Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
L. R. DeRuisseau, D. D. Fuller, K. Qiu, K. C. DeRuisseau, W. H. Donnelly Jr, C. Mah, P. J. Reier, and B. J. Byrne
Neural deficits contribute to respiratory insufficiency in Pompe disease
PNAS, June 9, 2009; 106(23): 9419 - 9424.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
S. Meinen, P. Barzaghi, S. Lin, H. Lochmuller, and M. A. Ruegg
Linker molecules between laminins and dystroglycan ameliorate laminin-{alpha}2-deficient muscular dystrophy at all disease stages
J. Cell Biol., March 26, 2007; 176(7): 979 - 993.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Yan, N. Raben, and P. Plotz
The Human Acid alpha -Glucosidase Gene Is a Novel Target of the Notch-1/Hes-1 Signaling Pathway
J. Biol. Chem., August 9, 2002; 277(33): 29760 - 29764.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (33)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Raben, N.
Right arrow Articles by Plotz, P.H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Raben, N.
Right arrow Articles by Plotz, P.H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?