Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (32)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Carlson, H.
Right arrow Articles by Hurlin, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carlson, H.
Right arrow Articles by Hurlin, P. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2001, Vol. 10, No. 21 2403-2413
© 2001 Oxford University Press

A dominant repression domain in Tbx3 mediates transcriptional repression and cell immortalization: relevance to mutations in Tbx3 that cause ulnar-mammary syndrome

Hanqian Carlson1,2, Sara Ota1, Christine E. Campbell3 and Peter J. Hurlin1,2,+

1Shriners Hospitals for Children and 2Department of Cell and Developmental Biology, Oregon Health Sciences University, 3101 Sam Jackson Park Road, Portland, OR 97201, USA and 3Department for Cancer Biology, Lerner Research Institute, Cleveland Clinic Foundation, Cleveland, OH 44195, USA

Received June 8, 2001; Revised and Accepted July 31, 2001.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 NOTE ADDED IN PROOF
 REFERENCES
 
Mutations in Tbx3 are responsible for ulnar-mammary syndrome (UMS), an autosomal dominant disorder affecting limb, tooth, hair, apocrine gland and genital development. Tbx3 is a member of a family of transcription factors that share a highly conserved DNA-binding domain known as the T-domain. UMS-causing mutations in Tbx3 have been found at numerous sites within the TBX3 gene, with many occurring downstream from the N-terminally located T-domain. The occurrence of mutations downstream of the DNA-binding domain raises the possibility that there exist important functional domains in C-terminal portions of the Tbx3 protein that affect its behavior as a transcription factor. To determine if and how such C-terminal mutations affect transcription we have mapped regions that confer transcriptional activity and nuclear localization and characterized the DNA binding properties of Tbx3. We find that Tbx3 binds the canonical Brachyury binding site as a monomer and represses transcription. We show that a key repression domain (RD1) resides in the Tbx3 C-terminus that can function as a portable repression domain. Most UMS-associated C-terminal mutants lack the RD1 and exhibit decreased or loss of transcriptional repression activity. In addition, we identify a domain responsible for nuclear localization of Tbx3 and show that two C-terminal mutants of Tbx3 have increased rates of protein decay. Finally, we show that Tbx3 can immortalize primary embryo fibroblasts and that the RD1 repression domain is required for this activity. Our results identify critical functional domains within the Tbx3 protein and facilitate interpretation of the functional consequences of present and future UMS mutations.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 NOTE ADDED IN PROOF
 REFERENCES
 
Members of the Tbx gene family play a variety of important roles during embryonic development, and mutations in at least two members of this family are responsible for congenital birth defects in humans (1). The hallmark feature of Tbx proteins is a highly conserved DNA-binding domain, the T-domain, first identified in Brachyury (2), the original member of the Tbx family. For Brachyury, it was shown that the T-domain mediates sequence-specific DNA binding as a monomer (2) and regions outside of the T-domain mediate transcriptional activation and repression functions (3). A subsequent study examining the crystal structure of the Xenopus Brachyury T-domain bound to DNA showed that the T-domain can also mediate homodimerization (4).

The brachyury gene was identified by positional cloning of the gene responsible for the classic mouse mutant called tailess or T (5). The tailess mouse has a very short tail caused by defective development of posterior mesoderm during gastrulation. The original tailess mouse was found to contain a large deletion that included a single allele of the brachyury gene, with the other allele apparently unaffected (5). Thus, haploinsufficency of Brachyury appears to be responsible for the classical ‘tailess’ phenotype. Indeed, mice homozygous for a brachyury null allele survive only to midgestation and have more severe defects in posterior mesoderm, lack a notochord and die due to a failure of the allantois to extend and connect with the placenta (6). These results implicate brachyury gene dosage effects, and corresponding Brachyury protein levels as critical during development. Several additional mutant brachyury alleles have been identified that contain mutations predicted to cause C-terminal truncations that leave the T-domain DNA-binding region intact (7). Importantly, these mutations result in a more severe heterozygous phenotype than null alleles, causing complete loss of the tail and skeletal abnormalities (7). These results suggest that C-terminal frameshift and termination mutations in brachyury lead to the production of mutant proteins that have dominant-negative activity. Such proteins are expected to bind their target genes, but misregulate expression due to disruption of regions critical for proper transcriptional regulation. Consistent with this idea, C-terminal truncation mutants of Brachyury that leave the DNA-binding domain intact behave as dominant-negative proteins when expressed in Xenopus embryos (8).

Mutations in the brachyury-related gene TBX3 were recently identified as responsible for the autosomal dominant human disease syndrome ulnar-mammary syndrome (UMS) (9). UMS is a pleiomorphic syndrome characterized by malformations of posterior elements of the upper limb including the ulnar, metacarpals and phalanges as well as apocrine, dental and urogenital abnormalities (10). Like Holt–Oram syndrome caused by mutations in TBX5 (1113) and the mouse ‘tailess’ phenotype caused by brachyury mutations (5,7), UMS is a haploinsufficency syndrome; only a single TBX3 allele is mutated. Thus, the behavior of cells expressing these genes appears extremely sensitive to their expression level. The original description of TBX3 mutations found in individuals with UMS (9) indicated that disease-associated mutations either eliminated or disrupted the T-domain and DNA binding. These results suggested that mutations that destroyed the T-domain generated a single null allele of TBX3, and thus strict haploinsufficiency (reduced gene dosage) of Tbx3 was responsible for UMS (9). However, several additional single allele TBX3 mutations were subsequently identified in a second, more extensive set of patients with UMS that mapped to regions downstream of the T-domain, including ones predicted to cause only small C-terminal truncations, leaving the T-domain intact (14). The range of morphological abnormalities in individuals containing these latter mutations is quite similar to those containing mutations that eliminate the T-domain (14), raising the possibility that mutations downstream of the T-domain may disrupt critical activities of Tbx3.

In this study, we investigate molecular and biochemical mechanisms that regulate Tbx3 function and how these are affected by C-terminal truncation mutations associated with UMS. In addition, we show that Tbx3 can immortalize primary cells and that this activity is dependent on a dominant repression domain located in the Tbx3 C-terminus. Our results indicate that loss or disruption of C-terminal regions of Tbx3 has severe consequences for the normal function of Tbx3.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 NOTE ADDED IN PROOF
 REFERENCES
 
Transcriptional activity of Tbx3 and identification of a critical repression domain
To determine the transcriptional activity of Tbx3 and define regions of Tbx3 that contribute to transcriptional regulation, fusion proteins were made between the DNA-binding domain of Gal4 (Gal4DB) and either wild-type (WT) Tbx3 (accession no. NM005996) or portions of the Tbx3 protein. These fusion proteins were expressed in HEK293 cells and transcriptional activity measured using a luciferase reporter gene containing four promoter-proximal Gal4 binding sites (Fig. 1A). Western blot analysis of the various Gal4 fusion proteins in transfected cells indicated similar expression levels (not shown). Consistent with a previous study examining a putative Xenopus Tbx3 ortholog ET (15), we found that Gal4-Tbx3 repressed transcription. Furthermore, several regions within the Tbx3 protein conferred transcriptional repression as well as transcriptional activation (Fig. 1A). Of particular interest was the region that included amino acids 567–623, which repressed transcription to levels near that of the wild-type protein and showed a dominant repression activity when fused with an adjacent region of Tbx3 (amino acids 423–500) that activated transcription (Fig. 1A). The presence of a key repression domain specifically in this region of Tbx3 is consistent with results of transcription assays using C-terminal truncation mutants in the context of binding to a consensus Brachyury site (see below).



View larger version (39K):
[in this window]
[in a new window]
 
Figure 1. Dissection of the transcriptional regulatory domains in the Tbx3 protein. (A) Fusion proteins were made between the Gal4 DNA-binding domain in the vector pSG424 and the indicated regions of the Tbx3 protein. Fusion proteins were expressed in HEK293 cells together with the reporter pGLGal4 containing four Gal4 sites at a promoter-proximal position and luciferase activity measured. Luciferase activity was normalized to ß-galactosidase activity produced by a co-transfected plasmid, pCMVßGal. (B) Transcriptional activity of Gal4–VP16 fusion proteins containing regions of Tbx3 showing transcriptional repression activity. The ability of Tbx3 amino acids 567–623 to suppress activation by VP16 activation domain and repress transcription reveals a dominant repression domain. (C) Western blot of Gal4–VP16–Tbx3 fusion proteins using anti-Gal4 antibody (B). (D) Schematic diagram showing the relative positions of regions displaying transcriptional activity. The dominant-repression activity of amino acids 567–623 is denoted in black. Reporter assays were carried out at least three times and performed in triplicate. Results in (A) are represented in ± SEM.

 
To determine whether Tbx3 amino acids 567–623 can function as a transferable repression domain, we fused this region to the potent transcriptional activation domain of VP16 (Fig. 1B). Similar to the ability of this region to override an adjacent activation domain in the Tbx3 protein (Fig. 1A), it showed dominant repression activity over activation by VP16. Other regions of Tbx3, including amino acids 100–200, which showed repression activity as a Gal4 fusion, failed to affect activation by VP16 (Fig. 1A and data not shown). As shown in Figure 1C, expression levels for these VP16 fusion proteins were comparable.

DNA binding of Tbx3 and C-terminal UMS-associated mutant proteins
The T-domain of Tbx proteins mediates DNA binding and there is evidence showing that this domain may also mediate homodimerization (4). Thus, mutations found in TBX3 that truncate the protein before or within the T-domain, as well as mutations that abrogate DNA binding, are thought to function as null alleles. Indeed, characterization of the DNA binding properties of Tbx3 proteins with engineered UMS mutations that fall within the T-domain disrupt DNA binding (C.E.Campbell, personal communication). However, it is more difficult to explain why mutations predicted to truncate Tbx3 downstream of the T-domain also act as null alleles. One possibility is that C-terminal regions directly or indirectly effect DNA binding or dimerization by the T-domain. To test this possibility we have constructed a series of expression plasmids containing mutant Tbx3 cDNAs based on mutations associated with UMS (Fig. 2A). We also constructed plasmids encoding non-UMS-associated Tbx3 truncations to assist in analyzing DNA binding and transcriptional function (Fig. 2A).




View larger version (121K):
[in this window]
[in a new window]
 
Figure 2. DNA binding of Tbx3 and C-terminal UMS mutant proteins to the preferred palindromic Brachyury binding site. (A) Schematic diagram of the structure of the Tbx3 gene showing exons (boxed regions) based on the work of Bamshad et al. (14). Gray boxes denote the exons encoding the T-domain (14). The position of mutations identified by Bamshad et al. (14) downstream from the T-box are indicated with numbers representing the size in amino acids of Tbx3 truncation mutants predicted to be produced by the corresponding mutation. Please note that the Tbx3 cDNA used in this study does not contain the alternatively spliced exon 2a (14). WT denotes wild-type proteins and asterisks denote non-UMS associated mutant proteins used in this study. (B) Autoradiograph showing expression of the indicated proteins in HEK293 cells by western blot using an anti HA-antibody (proteins are HA-tagged at the 3' end). (C) EMSA of whole cell extracts of wild-type Tbx3 (Tbx3-WT) and Tbx3 truncation mutants to a radiolabeled oligonucleotide containing the Brachyury binding site AATTTCACACCTAGGTGTGAAATT. The left side of the panel shows EMSA with wild-type Tbx3 with 100x unlabeled Brachyury oligonucleotide demonstrating specificity of the Tbx3–DNA complex and with anti-HA ({alpha}-HA) showing supershift of the Tbx3–DNA complex. The right side of the panel shows EMSA of cells cotransfected with Tbx3-WT and the indicated plasmids expressing truncated proteins. Extracts used were made from equal numbers of transfected cells. ‘Empty’ represents cells transfected with empty plasmid and ‘cells’ represent untransfected cells.

 
To examine DNA binding we prepared whole cell extracts from HEK293 cells transfected with wild-type Tbx3 and the various Tbx3 truncation mutants constructed. Electrophoretic mobility shift assays (EMSAs) were performed by mixing equal amounts of nuclear extract with a radiolabeled oligonucleotide containing the consensus Brachyury binding site, ATTTCACACCTAGGTGTGAAAT (2). As shown in Figure 2C, each of the truncation mutants was capable of binding DNA, although differences in the amount of protein–DNA complexes suggest that some differences in DNA binding properties might exist. In addition, all of the truncation proteins with the exception of Tbx3-605 and -652 produced a second slower mobility shift, raising the possibility that the more severe C-terminal mutant proteins might bind DNA as both monomers and homodimers. To test for the ability of wild-type Tbx3 to form homodimers in cells, we performed EMSAs with cell extracts made from cells cotransfected with C-terminal truncation mutants and wild-type Tbx3 (Fig. 2C, right side). If Tbx3 binds DNA as a dimer then intermediate mobility shifts consisting of wild-type and mutant Tbx3 would be detcted in this assay. Consistent with results using in vitro translated proteins (not shown), no intermediate size mobility shifts were produced compared with the mobility shifts of the individual proteins (Fig. 2C). These results suggest that wild-type Tbx3 binds the preferred palindromic Brachyury binding site as a monomer and does not dimerize with C-terminal truncated forms. However, experiments designed to determine whether C-terminal truncation mutants are capable of binding DNA as both monomers and homodimers have been inconclusive (not shown).

Transcriptional activity of UMS-associated C-terminal mutants
Since the C-terminal truncation mutants of Tbx3 tested all bound DNA we next focused on whether disrupted or abrogated transcriptional function associated with loss or disruption of the C-terminal repression domain might be a property of these forms. We first measured the transcriptional activities of wild-type Tbx3, C-terminal UMS-associated mutant forms and a form lacking the entire C-terminus downstream from the T-domain (Tbx-300), using an engineered luciferase reporter plasmid containing two copies of the Brachyury binding site at a promoter-proximal position (16). Tbx3 repressed transcription approximately 3- to 5-fold relative to empty expression vector (Fig. 3). A range of transcriptional activity was seen with the different C-terminal mutants: the most extensive mutant forms (Tbx3-300, Tbx3-343 and Tbx3-360) were transcriptionally inert, Tbx3-433 and Tbx3-605 repressed transcription less effectively than wild-type Tbx3, and Tbx3-652 repressed transcription similarly to the wild-type protein (Tbx3-WT, Fig. 3). Although these results are consistent with our Gal4 fusion protein studies showing that a critical transcriptional repression domain exists in the Tbx3 C-terminus (Fig. 1), the ability of Tbx3-652 to repress transcription similarly to wild-type Tbx3 indicates that loss of this domain and transcriptional repression is not an absolute requirement for UMS.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 3. Transcriptional activity of Tbx3 C-terminal mutant proteins. Mutant 450 is a truncation mutant not based on a UMS mutation and {Delta}RD1 (mutant that deletes amino acids 557–605) removes a region of Tbx3 encoding the RD1 dominant repression domain. Transcription assays using the T2-reporter containing Tbx3 binding sites showing that only the Tbx3-652 mutant protein retains wild-type repression activity and that repression by Tbx3 requires the RD1. Reporter assays were carried out at least three times and performed in triplicate. Results are represented in ± SEM.

 
Protein stability and subcellular distribution of Tbx3 and C-terminal mutant Tbx3 proteins
Since loss of transcription repression potential is likely not by itself responsible for UMS, we examined whether our C-terminal truncation proteins exhibited altered protein stability properties and/or altered subcellular localization that might be related to UMS. To determine whether sequence within the C-terminus affected Tbx3 protein turnover, we used a pulse–chase analysis of wild-type Tbx3, Tbx3-652 and Tbx3-300. Cells were transfected with plasmids expressing HA-tagged versions of Tbx3 or Tbx3 mutants. Two days later the transfected cells were labeled for 30 min (pulse) with [35S]methionine-containing medium. Following labeling, cells were washed twice to remove labeling medium, and fresh, non-radioactive growth medium was added (chase). Cells were harvested at the time points indicated in Figure 4A and Tbx3 proteins were immunoprecipitated and analyzed by PAGE/autoradiography. Similar results were obtained in each of three separate experiments performed and showed that the Tbx3-652 and Tbx3-300 proteins have a slightly increased rate of decay compared with the wild-type protein (Fig. 4A and B). In contrast to a linear rate of decay for Tbx3-300, the degradation rate of the wild-type Tbx3 and Tbx3-652 appears to slow at later time points (Fig. 4A–C). As the wild-type and Tbx3-652 proteins decayed, an additional immunoreactive band of higher molecular mass appeared (Fig. 4A and C, see arrow). No such additional immunoreactive species was seen for Tbx3-300 (Fig. 4A). We conclude that Tbx3 has complex degradation kinetics and that UMS-associated Tbx3 truncation mutants degrade at a slightly elevated rate.



View larger version (42K):
[in this window]
[in a new window]
 
Figure 4. Rate of decay of Tbx3 and C-terminal truncation mutants. (A) Pulse–chase experiments showing rate of degradation of wild-type Tbx3 (Tbx-WT) and Tbx3-652, a Tbx3 mutant lacking the C-terminal 69 amino acids modeled after the frameshift UMS mutation: 1887delC (14) and Tbx3-300, a non-UMS-associated mutant that lacks nearly all sequence downstream from the T-domain. Untransfected cells were used as a control. Note the second signal seen with the wild-type and Tbx3-652 proteins at 8 h (arrow), but not Tbx3-652. (B) Comparison of the degradation rates of WT-Tbx3 (black), Tbx3-652 (gray) and Tbx-300 (white) based on densitometric scanning of the autoradiographs in (A). (C) Pulse–chase experiment showing the rate of decay of wild-type Tbx3 using extended chase periods. The slower migrating Tbx3 species is indicated by an arrow.

 
To examine the subcellular distribution of Tbx3 and C-terminal mutants, HA-tagged proteins were expressed in HEK293 cells and detected by immunofluorescence. As shown in Figure 5, wild-type Tbx3 protein (Tbx3-WT, panels D–F), and Tbx3-300 (panels G–I) localized to the nucleus (yellow signal in merged image). Similarly, other Tbx3 mutant forms lacking more distal regions of the C-terminus also maintained a wild-type distribution pattern (not shown). Thus, mutations that remove nearly all sequence C-terminal to the T-domain do not cause mislocalization of Tbx3. To identify region(s) required to localize Tbx3 to the nucleus, the N-terminal 300 amino acids were searched for stretches of basic amino acids that might typically serve as nuclear localization signals. A cluster of basic amino acids was identified at amino acid positions 292–297 (RREKRK). Deletion of this site in the context of the wild-type Tbx3 protein (creating Tbx3{Delta}NLS) caused mislocalization to a perinuclear site and to the cytoplasm (Fig. 5J–L). Furthermore, truncation mutants of Tbx3 that lack this site showed a similar subcellular distribution to the 292–297 deletion (not shown), therefore we conclude that the RREKRK sequence (or sequence within) functions as the Tbx3 nuclear localization signal.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 5. Subcellular distribution of Tbx3 and C-terminal truncation mutants and mapping of the Tbx3 nuclear localization domain. HA-tagged proteins were expressed in HEK293 cells and examined by immunofluorescence using an anti-HA antibody and FITC-conjugated secondary antibody. (A, D, G and J) The intracellular localization of Tbx3 proteins (green signal); (B, E, H and K) the corresponding propidium iodide-stained cells in the field (red fluorescence); and (C, F, I and L) the merged images. Wild-type Tbx3 (D–F) and Tbx3-300 (G–I), a truncation form of Tbx3 containing the N-terminal 300 amino acids of Tbx3, localize to the nucleus. Tbx3-{Delta}NLS, a mutant containing a deletion of amino acids 292–298 (J–L) results in localization primarily to the cytoplasm. (M–O) Colocalization of Tbx3{Delta}292–298 with actin in the cytoplasm. (M) FITC-conjugated secondary antibody staining of the Tbx3{Delta}NLS protein. (N) Rhodamine-conjugated secondary antibody staining of anti-actin, and (O) merged image.

 
Immortalization of primary mouse embryo fibroblasts by Tbx3, but not a mutant lacking RD1
It was recently demonstrated that Tbx2, which is closely related to Tbx3 (17), is capable of immortalizing mouse embryo fibroblasts (MEFs) when ectopically expressed in these cells (18). This result prompted us to test the ability of Tbx3 to immortalize MEFs. Two protocols were used: first, primary MEFs at passage three were transfected with retroviral vectors expressing either wild-type Tbx3 or a mutant containing a deletion in the RD1 (amino acids 555–605). Transfected cells were selected with G418 for 3 weeks and the number of colonies surviving determined. Cells transfected with wild-type Tbx3, but not Tbx3{Delta}RD1 or empty virus, produced colonies in this assay (Fig. 6A). Colonies isolated from Tbx3 transfected cells have continued to proliferate for >50 population doublings and appear to have acquired an infinite lifespan in culture.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 6. Tbx3 allows primary MEFs to escape senescence. MEFs at passage three were transfected with empty RF retrovirus, RF-Tbx3{Delta}RD1 or RF-Tbx3. Cells were grown in growth medium supplemented with G418 to select for transfectants (neomycin gene provided by the RF virus) for 3 weeks, then stained with crystal violet. Whereas only small abortive colonies were produced from empty virus and RF-Tbx3{Delta}RD1 transfected cells, many large colonies were produced from cells transfected with Tbx3. This experiment has been repeated twice with essentially identical results. (B) Western blot of empty RF, RF-Tbx3{Delta}RD1 and RF-Tbx3 virus-infected MEFs to demonstate viral expression of Tbx3{Delta}RD1 and Tbx3 proteins. Growth curve of MEFs infected with empty virus and Tbx3 virus. Cells were passaged every 3.5 days according to a modified 3T3 protocol (18).

 
In the second protocol, primary MEFs at passage one were infected with retroviral constructs expressing either wild-type Tbx3 or empty virus (Fig. 6B). Infected cells were passaged under non-selective conditions according to a modified 3T3 protocol (Fig. 6C). Cells infected with Tbx3 and empty virus showed little or no difference in proliferative rate up to 6–7 passages, but only Tbx3-infected cells continued to proliferate after the seventh passage (Fig. 6C). Cells infected with wild-type Tbx3 do not show an increased proliferative rate, but appear to be ‘immortal’ as they have continued to proliferate for >15 passages (approximately 45 population doublings). We conclude that Tbx3, like Tbx2 (18), promotes escape from the normal restraints on the replication capacity of MEFs and that this activity is mediated by the RD1.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 NOTE ADDED IN PROOF
 REFERENCES
 
The Tbx family of proteins has emerged as key transcriptional regulators of cell fate decisions during embryonic development. In humans, mutations in TBX3 that cause UMS (9,14) have illuminated the role of this protein in patterning posterior elements of the upper limb and in regulating mammary, apocrine gland, tooth and sexual development. Mutations that cause UMS occur throughout the TBX3 gene, including regions of the N-terminus critical for the DNA-binding domain (the T-domain) and regions of the C-terminus of unknown function (9,13). Although UMS mutations in the T-box that disrupt the ability of Tbx3 to bind DNA are expected to be null, loss of function alleles, it is less clear how mutations that effect only C-terminal regions are involved in disease. Thus the aim of this study was to determine the transcriptional activities of Tbx3, how these activities are regulated in cells and to identify domains in the Tbx3 protein critical to its function and that might be disrupted as a result of UMS mutations. Since the engineered mutant Tbx3 proteins used in this study do not include unique sequence additions predicted to result from frameshift mutations in the TBX3 gene, we cannot formally rule out that such sequence additions may affect Tbx3 function. Nonetheless our series of UMS-based mutants (12,14), and the cell systems used in our analysis allow for an approximation, if not an accurate assessment, of the activity of the predicted mutant proteins.

Regulation of transcription by Tbx3
Although the T-domain is highly conserved amongst members of the Tbx family, it is not clear whether the subtle differences that exist reflect significantly different biochemical properties. Our results with Tbx3 indicate that all UMS-associated C-terminal truncation mutants are capable of binding the palindromic Brachyury binding site (Fig. 2). Although we cannot rule out that, under the DNA binding conditions used, some of the truncation mutants can bind the Brachyury site as dimers, our results suggest that wild-type Tbx3, as well as Tbx3-605 and Tbx3-652, bind only as monomers. Furthermore, our DNA binding assays demonstrate an inability of wild-type Tbx3 to interact with the C-terminal truncation mutants, raising the possibility that dimers between wild-type Tbx3 and C-terminal mutants do not occur in UMS patients. However, the ability of C-terminal truncation mutants to bind DNA predicts that these proteins, if produced in vivo, could compete with wild-type proteins for binding to DNA.

A previous study by He et al. (15) showed that the Xenopus Tbx3 ortholog, ET, repressed transcription as a Gal4 fusion protein. We have confirmed and extended these results by showing that human Tbx3 is a transcriptional repressor both in the context of a Gal4 fusion protein binding to Gal4 binding sites and in the more natural setting of wild-type Tbx3 binding to Tbx binding sites. Although Tbx3 shows net transcriptional repression activity, our Gal4 fusion study shows that there are several regions within the Tbx3 protein that have both repression and activation activity. Although a region capable of activating transcription was identified in Tbx3 (Fig. 1), it is unclear whether this activity is relevant to Tbx3 function. This region was capable of activating transcription only when isolated from other regions of Tbx3 (Fig. 1A), indicating that it is subordinate to repression by Tbx3. Indeed, our Gal4 studies showed that an adjacent repression domain (RD1) located between amino acids 567 and 623 is dominant over this activating region in the context of the Tbx3 protein. Furthermore, the RD1 functioned as a portable dominant repression domain when fused to the potent activation domain of VP16 (Fig. 1B). Thus, although the net repression activity of Tbx3 appears relatively weak (3–5-fold), our results support the conclusion that transcriptional repression mediated by Tbx3 is dominant over the activity of transcriptional activators. It will now be important to determine the mechanism by which Tbx3 and the RD1 mediate repression and whether auxiliary factors are capable of mediating and/or modulating this activity.

Mutant Tbx3 proteins and UMS
Studies of the relationship between the phenotype of different tailess mouse mutants and the nature of mutations in the brachyury gene have demonstrated that C-terminal truncations downstream of the T-domain generate proteins that have dominant-negative activity and produce phenotypes more severe than null alleles (7,8). Given the ability of each of the C-terminal mutant Tbx3 proteins to bind the Brachyury target sequence (Fig. 2), they might be expected, if produced in cells, to alter or block the normal regulation of Tbx3 target genes and yield unique, and potentially more severe, phenotypic consequences. However, in contrast to brachyury mutations, the genotype/phenotype relationship between mutations in Tbx3 and UMS suggests that true null alleles or putative null alleles (ones predicted to disrupt the T-domain) are equivalent to mutations predicted to disrupt regions downstream of the T-domain (9,14). An important consideration, however, is that C-terminal truncation mutants of Tbx3 (but not Brachyury or Tbx5) may not be produced in cells, or may be produced at reduced levels due to nonsense-mediated mRNA decay (19). This latter situation appears to apply to certain disease-causing mutations, including ones in the fibrillin gene that cause Marfans syndrome (19). Another possibility is that C-terminal truncation mutants of Tbx3 are expressed, but that regions affecting protein turnover are lost, resulting in lower protein levels in cells and UMS. Indeed, we find that Tbx3-300 and Tbx3-652 degraded at a slightly increased rate compared with the wild-type protein (Fig. 4). Although it is not known whether the decreased turnover rates are significant, since haploinsufficiency of Tbx3 is postulated to cause UMS, it is certainly possible that many of the cells that express Tbx3 are sensitive to minor changes in its expression. However, since Tbx-652 retains wild-type transcriptional repression activity (Fig. 3), a decrease in its steady-state protein levels might be expected to be less severe than for other mutations that appear transcriptionally inert. This does not appear to be the case for individuals containing the 1857 delC mutation (our Tbx3-652 mutant is modeled after this mutation) (14). Thus the lack of a clear genotype/phenotype relationship in UMS, together with our molecular studies, is consistent with an alternative mechanism, such as nonsense-mediated mRNA decay, as an important underlying mechanism in UMS.

A role for Tbx3 in pathways controlling cell senescence
The Tbx2 gene was recently shown to allow bypass of the premature senescence phenotype of mouse embryo fibroblasts that lack the polycomb group gene Bmi1 (18). Tbx2 is closely related to Tbx3 (17) and is also a transcriptional repressor (20). A potential mechanism allowing Tbx2 to immortalize cells is direct repression of the gene encoding p19ARF (18), an inhibitor of MDM2-mediated degradation of p53 (21). Although we are currently examining a potential role for p19ARF in immortalization by Tbx3, we do find that immortalization is dependent on the RD1 repression domain (Fig. 6). Translating this result to a potential in vivo function, expression of Tbx3 might be predicted to target cells to undergo additional rounds of cell division in an otherwise growth/proliferation suppressive environment. Given the abnormalities associated with mutations in Tbx3, one can speculate that cells targeted to proliferate by Tbx3 may be concomitantly or subsequently sensitized to patterning or inductive signals critical for proper development. Conversely, Tbx3 expression and its cell proliferation signal may be the target of patterning/inductive signals. Both of these scenarios are consistent with the fact that mutations in Tbx3 cause hypoplasia of several different tissues as well as patterning defects. Understanding the molecular mechanisms underlying the ability of Tbx3 to immortalize cells in culture and how this activity is manifest in vivo will likely lead to a better understanding of how mutations in Tbx3 cause UMS.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 NOTE ADDED IN PROOF
 REFERENCES
 
Cell culture and DNA transfection and retroviral infection
HEK293 and mouse fibroblast NIH3T3 cells were obtained from American Type Culture Collection (ATCC). HEK293 cells were grown in 1x low glucose Dulbecco’s modified Eagle’s medium (DMEM) (Gibco) supplemented with 5% fetal bovine serum (FBS, Hyclone Laboratories, Logan, UT) and 1% penicillin–streptomycin (P/S, Gibco). Primary MEFs were isolated from embryonic day 13.5 mouse (C57Bl/6) embryos and grown in DMEM supplemented with 10% FBS. Colony formation by MEFs transfected with control and Tbx3 retroviral vectors was determined by staining cells with crystal violet. Experiments were performed in duplicate and repeated twice using MEFs isolated from different mice. For lifespan analysis, infected MEFs were plated at 4 x 105 cells and passaged every 3.5 days according to the modified 3T3 protocol described by Jacobs et al. (19). All cultures were maintained at 37°C in a humidified atmosphere of 95% air and 5% CO2. Transfections were performed by the BES-buffered saline (BBS) calcium phosphate method (22). Retroviral supernatants were generated from transfected Phoenix cells and retroviral infections of MEFs were carried out for 24 h in DMEM/10% FBS. Following infection, MEFs were washed with phosphate-buffered saline (PBS) and fresh medium was added.

Expression plasmids
The human Tbx3 cDNA (accession no. NM005996) was cloned by RT–PCR from the human breast carcinoma cell line MDA Mbyte 453. Gal4–Tbx3 fusions were constructed by inserting different PCR-generated Tbx3 fragments with the Gal4 DNA-binding domain (amino acids 1–147) in the plasmid pSG424 (23). pCS2Tbx3 constructs were made by inserting PCR-generated fragments of full length or truncated versions of Tbx3 into BamHI/XhoI sites of pCS2 (D. Turner and R.Rupp, unpublished data). HA epitope-tagged Tbx3 sequences were generated by PCR using a 3' primer encoding the HA epitope into the XhoI site of pCS2. All inserts were verified by sequencing. Retrovirus expression constructs Rf-Tbx3 and Tbx3{Delta}RD1 contain wild-type Tbx3 and Tbx3 containing a deletion of sequence coding for amino acids 555–605, respectively, in the RF retrovirus (Stratagene).

Luciferase assays
For Gal4 fusion experiments, 4 x 105 HEK293 cells/well in 6-well dishes were transfected overnight with 0.5 µg of pGL24 x Gal4 luciferase reporter plasmid containing a 4-fold reiteration of the Gal4 recognition sequence in pGL2 (Promega), 0.5 µg of pCMVßGal and 2 µg of pSG424 fusion plasmid. For experiments using pCS2 expression plasmids, 0.5 µg of pGL2T2 reporter plasmid (16), 0.5 µg of ßGal and 2 µg of pCS2Tbx3 plasmid were used. Cells were harvested 48 h after transfection, washed with PBS, lysed with 100 mM potassium phosphate pH 7.8, 0.2% Triton X-100, 0.5 mM dithiothreitol (DTT). Lysates were centrifuged for 2 min at 14 000 r.p.m. and supernatants were assayed for luciferase and ß-galactosidase activity using luciferin and Galacton Plus substrates, respectively, and a Tropix TR717 luminometer (Tropix, Massachusetts). ß-Galactosidase activity was used as a control for transfection efficiency. Experiments were performed in triplicate and repeated three or more times.

Western blot and immunoprecipitation analysis
For transfected cells, cells were harvested 48 h after transfection and lysed with NP-40 buffer [150 mM NaCl, 20 mM Tris–HCl pH 8, 1 mM EDTA, 1% NP-40, 10% glycerol, and 10 µg/ml aprotinin, 1 mM phenylmethylsulfonyl fluoride (PMSF) and 25 µg/ml leupeptin added fresh]. Equal amounts of protein were resolved on 12.5% SDS–polyacrylamide gel and transfered to polyvinylidene difluoride membranes (Millipore Corp., Bedford, MA). Membranes were incubated in TTBS (10 mM Tris pH 7.6, 150 mM NaCl, 0.1% Tween-20) containing 5% non-fat dry milk overnight at 4°C. Membranes were then incubated for 1 h with 0.2 µg/ml rabbit polyclonal Gal4 antibody (Santa Cruz Biotechnology) or 0.2 µg/ml mouse monoclonal anti-HA antibody (Sigma). Membranes were washed with TTBS prior to incubation with alkaline phosphatase-conjugated anti-rabbit IgG secondary antibody (New England BioLabs). Immunocomplexes were visualized using CDP-Star chemiluminescence reagents (Bio Labs) and exposure to X-ray film.

For immunoprecipitations, transfected 293 cells or NIH3T3 cells (1 x 105 cells/6-well dish) were washed twice with labeling medium [Met-and Cys-free DMEM (Gibco), dialyzed 10% fetal bovine serum (Gibco), 25 mM HEPES pH 7.4]. After washing, cells were starved in 1 ml labeling medium for 15 min at 37°C (5% CO2) followed by labeling for 30 min in 1 ml labeling medium containing [35S]methionine (Express label) 100 µCi/ml L-[35S]Met (1000 Ci/mM; Dupont/NEN). For pulse–chase analysis, cells were washed twice with DMEM (containing cold methionine), placed back in a 37°C cell culture incubator and harvested at various times afterward. Cells were washed twice with ice-cold PBS and lysed in1 ml RIPA buffer (0.01m Tris–HCl pH 7.4, 0.15 M NaCl, 0.3% NP-40, 0.05% Triton X-100, 0.3% deoxycholate, 0.1% BSA and 5 mM EDTA, plus inhibitors added fresh: 100 mM PMSF, 100 mM aprotinin) and sonicated. Lysates were centrifuged at 14 000 r.p.m. for 5 min, and supernatants were incubated for 1 h at 4°C with 5 µl of anti-HA (Sigma) and 25 µl of protein G–agarose (Amersham Pharmacia). Agarose beads were washed with RIPA buffer (four times, 5 min each time), proteins eluted in 2x SDS sample buffer (100 mM Tris–HCl pH 6.8, 200 mM DTT, 4% SDS, 0.2% Bromophenol blue, 20% glycerol) and resolved by SDS–PAGE. Gels were dried and exposed to film.

Cell extracts and EMSAs
A modified version of a previously described protocol (24) was used to make cell extracts for EMSAs. Briefly, transfected HEK293 cells in 6-well dishes were washed with PBS, harvested in 100 µl of F-buffer [10 mM Tris pH 7.05, 50 mM NaCl, 30 mM sodium pyrophosphate, 1% Triton X-100 and 1 tablet/10 ml protease inhibit cocktail tablet (Boehringer Mannheim)] per well. Cells were incubated on ice for 10 min, transferred to a tube and vortexed for 45 s and cleared by centrifugation at 14 000 r.p.m. A duplex oligonucleotide corresponding to the Brachyury consensus binding site [AATTTCACACCTAGGTGTGAAATT (2)] containing three overhanging guanine residues was radiolabeled with [{alpha}-32P]dCTP and Klenow (NEB). Labeled probe was isolated by Microspin G-50 columns (Amersham Pharmacia). Three microliters of cell extract, corresponding to equal numbers of starting cells, in a total volume of 23 µl [17 µl incubation buffer (10 mM Tris pH 7.8, 50 mM NaCl, 5 mM EDTA pH 8, 5% glycerol), 2 µl [32P]oligonucleotide (20 000 c.p.m.) and 1 µl (5 µg) of poly dI dC (Amersham Pharmacia Biotech)], were incubated at 4°C for 25 min. Binding complexes were resolved in 4.5% polyacrylamide gels (Tris/Borate/EDTA buffer). Gels were dried and exposed to film for 16–24 h.

Immunofluorescence
HEK293 cells were plated 1 x 105 cells/chamber into two-chamber slides. Forty-eight hours later, cells were fixed in ice-cold acetone for 10 min then washed with PBS for 5 min. The cells were incubated with polyclonal rat anti-HA (Sigma, 10 µg/ml) for 3 h at room temperature in a humidified chamber. Slides were then washed with PBS three times for 5 min, and then labeled for 30 min with anti-rat FITC-anti-IgG (1:32) secondary antibody. After washing three more times with PBS, the slides were stained for 10 min with propidium iodide. Slides were then washed twice for 10 min with PBS. 90% glycerol–PBS was used for mounting the slides. The slides were viewed with a Nikon eclipse E800 microscope. For actin staining, rabbit polyclonal anti-actin antibody (Sigma) and sheep anti-rabbit IgG conjugated to rhodamine (Sigma) were used.


    ACKNOWLEDGEMENTS
 
We thank D. Turner for plasmid pCS2 and M. Ptashne for plasmid SG424. This work was supported by a grant from Shriners Hospitals for Children to P.J.H. and NIH grant DK48796 to C.E.C.


    NOTE ADDED IN PROOF
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 NOTE ADDED IN PROOF
 REFERENCES
 
We have now examined the lifespan of several different strains of primary MEFs following introduction of wild-type and different mutant Tbx3 proteins. We find that some mutant proteins lacking the Tbx3 C-terminus and the RD1 are capable of low-efficiency (comapared with the wild-type protein) immortalization. These results suggest that the Tbx3 C-terminus and the RD1 are not absolutely required for the immortalization potential of Tbx3.


    FOOTNOTES
 
+ To whom correspondence should be addressed. Tel: +1 503 221 3438; Fax: +1 503 221 3451; Email: pjh@shcc.org Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 NOTE ADDED IN PROOF
 REFERENCES
 
1 Smith, J. (1999) T-box genes: what they do and how they do it. Trends Genet., 15, 154–158.[Web of Science][Medline]

2 Kispert, A. and Hermann, B.G. (1993) The Brachyury gene encodes a novel DNA binding protein. EMBO J., 12, 4898–4909.[Web of Science][Medline]

3 Kispert, A., Koschorz, B. and Herrmann, B.G. (1995) The T protein encoded by Brachyury is a tissue-specific transcription factor. EMBO J., 14, 4763–4772.[Web of Science][Medline]

4 Muller, C.W. and Herrmann, B.G. (1997) Crystallographic structure of the T domain-DNA complex of the Brachyury transcription factor. Nature, 389, 884–888.[Medline]

5 Herrmann, B.G., Labeit, S., Poustka, A., King, T.R. and Lehrach, H. (1990) Cloning of the T gene required in mesoderm formation in the mouse. Nature, 343, 617–622.[Medline]

6 Gluecksohn-Schoenheimer, S. (1938) The development of two tailless mutants in the house mouse. Genetics, 23, 573–584.[Free Full Text]

7 Stott, D., Kispert, A. and Herrmann, B.G. (1993) Rescue of the tail defect of Brachyury mice. Genes Dev., 7, 197–203.[Abstract/Free Full Text]

8 Rao, Y. (1994) Conversion of a mesodermalizing molecule, the Xenopus Brachyury gene, into a neuralizing factor. Genes Dev., 8, 939–947.[Abstract/Free Full Text]

9 Bamshad, M., Lin, R.C., Law, D.J., Watkins, W.C., Krakowiak, P.A., Moore, M.E., Franceschini, P., Lala, R., Holmes, L.B., Gebuhr, T.C. et al. (1997) Mutations in human TBX3 alter limb, apocrine and genital development in ulnar-mammary syndrome. Nat. Genet., 16, 311–315.[Web of Science][Medline]

10 Bamshad, M., Watkins, W.S., Dixon, M.E., Le, T., Roeder, A.D., Kramer, B.E., Carey, J.C. and Jorde, L.B. (1999) Reconstructing the history of human limb development: lessons from birth defects. Pediatr. Res., 45, 291–299.[Web of Science][Medline]

11 Basson, C.T., Bachinsky, D.R., Lin, R.C., Levi, T., Elkins, J.A., Soults, J., Grayzel, D., Kroumpouzou, E., Traill, T.A., Leblanc-Straceski, J. et al. (1997) Mutations in human TBX5 [corrected] cause limb and cardiac malformation in Holt-Oram syndrome. Nat. Genet., 15, 30–35.[Web of Science][Medline]

12 Li, Q.Y., Newbury-Ecob, R.A., Terrett, J.A., Wilson, D.I., Curtis, A.R., Yi, C.H., Gebuhr T., Bullen, P.J., Robson, S.C., Strachan, T. et al. (1997) Holt-Oram syndrome is caused by mutations in TBX5, a member of the Brachyury (T) gene family. Nat. Genet., 15, 1–9.[Web of Science][Medline]

13 Yang, J., Hu, D., Xia, J., Yang, Y., Ying, B., Hu, J. and Zhou, X. (2000) Three novel TBX5 mutations in Chinese patients with Holt-Oram syndrome. J. Med. Genet., 92, 237–240.

14 Bamshad, M., Le, T., Watkins, W.S., Dixon, M.E., Kramer, B.E., Roeder, A.D., Carey, J.C., Root, S., Schinzel, A., Van Maldergem, L. et al. (1999) The spectrum of mutations in TBX3: genotype/phenotype relationship in ulnar-mammary syndrome. Am. J. Hum. Genet., 64, 1550–1562.[Web of Science][Medline]

15 He, M.l., Wen, L., Campbell, C.E., Wu, J.Y. and Rao, Y. (1999) Transcription repression by Xenopus ET and its human ortholog TBX3, a gene involved in ulnar-mammary syndrome. Proc. Natl Acad. Sci. USA, 96, 10212–10217.[Abstract/Free Full Text]

16 Hurlin, P.J., Steingrimsson, E., Copeland, N.G., Jenkins, N.A. and Eisenman, R.N. (1999) Mga, a dual-specificity transcription factor that interacts with Max and contains a T-domain DNA-binding motif. EMBO J., 70, 19–28.

17 Agulnik, S.I., Garvey, N., Hancock, S., Ruvinsky, I., Chapman, D.L., Agulnik, I., Bollag, R., Papaioannou, V. and Silver, L.M. (1996) Evolution of mouse T-box genes by tandem duplication and cluster dispersion. Genetics, 144, 249–254.[Abstract]

18 Jacobs, J.J., Keblusek, P., Robanus-Maandag, E., Kristel, P., Lingbeek, M., Nederlof, P.M., van Welsem, T., van de Vijver, M.J., Koh, E.Y., Daley, G.Q. and van Lohuizen, M. (2000) Senescence bypass screen identifies TBX2, which represses Cdkn2a (p19(ARF)) and is amplified in a subset of human breastcancers. Nat. Genet., 26, 291–299.[Web of Science][Medline]

19 Frischmeyer, P.A. and Dietz, H.C. (1999) Nonsense-mediated mRNA decay in health and disease. Hum. Mol. Genet., 8, 1893–900.[Abstract/Free Full Text]

20 Carreira, S., Dexter, T.J., Yavuzer, U., Easty, D.J. and Goding, C.R. (1998) Brachyury-related transcription factor Tbx2 and repression of the melanocyte-specific TRP-1 promoter. Mol. Cell. Biol., 18, 5099–5108.[Abstract/Free Full Text]

21 Sherr, C.J. and Weber, J.D. (2000) The ARF/p53 pathway. Curr. Opin. Genet. Dev., 10, 949–953.

22 Chen, C.A. and Okayama, H. (1988) Calcium phosphate-mediated gene transfer: a highly efficient transfection system for stably transforming cells with plasmid DNA. Biotechniques, 6, 632–638.[Web of Science][Medline]

23 Sadowski, I. and Ptashne, M. (1989) A vector for expressing GAL4(1–147) fusions in mammalian cells. Nucleic Acids Res., 17, 7539–7540.[Free Full Text]

24 Sommer, A., Bousset, K., Kremmer, E., Austen, M. and Luscher, B. (1998) Identification and characterization of specific DNA-binding complexes containing members of the Myc/Max/Madnetwork of transcriptional regulators. J. Biol. Chem., 273, 6632–6642.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Hum Mol GenetHome page
S. Ota, Z.-Q. Zhou, J. M. Link, and P. J. Hurlin
The role of senescence and prosurvival signaling in controlling the oncogenic activity of FGFR2 mutants associated with cancer and birth defects
Hum. Mol. Genet., July 15, 2009; 18(14): 2609 - 2621.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
W. Yarosh, T. Barrientos, T. Esmailpour, L. Lin, P. M. Carpenter, K. Osann, H. Anton-Culver, and T. Huang
TBX3 Is Overexpressed in Breast Cancer and Represses p14ARF by Interacting with Histone Deacetylases
Cancer Res., February 1, 2008; 68(3): 693 - 699.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Abrahams, S. Mowla, M. I. Parker, C. R. Goding, and S. Prince
UV-mediated Regulation of the Anti-senescence Factor Tbx2
J. Biol. Chem., January 25, 2008; 283(4): 2223 - 2230.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
K. E. Govoni, S. K. Lee, R. B. Chadwick, H. Yu, Y. Kasukawa, D. J. Baylink, and S. Mohan
Whole genome microarray analysis of growth hormone-induced gene expression in bone: T-box3, a novel transcription factor, regulates osteoblast proliferation
Am J Physiol Endocrinol Metab, July 1, 2006; 291(1): E128 - E136.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
C. Rallis, J. Del Buono, and M. P. O. Logan
Tbx3 can alter limb position along the rostrocaudal axis of the developing embryo
Development, April 15, 2005; 132(8): 1961 - 1970.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. Z. Stoller and J. A. Epstein
Identification of a novel nuclear localization signal in Tbx1 that is deleted in DiGeorge syndrome patients harboring the 1223delC mutation
Hum. Mol. Genet., April 1, 2005; 14(7): 885 - 892.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. W. Vance, S. Carreira, G. Brosch, and C. R. Goding
Tbx2 Is Overexpressed and Plays an Important Role in Maintaining Proliferation and Suppression of Senescence in Melanomas
Cancer Res., March 15, 2005; 65(6): 2260 - 2268.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
Z. Harrelson, R. G. Kelly, S. N. Goldin, J. J. Gibson-Brown, R. J. Bollag, L. M. Silver, and V. E. Papaioannou
Tbx2 is essential for patterning the atrioventricular canal and for morphogenesis of the outflow tract during heart development
Development, October 15, 2004; 131(20): 5041 - 5052.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
W. Fan, X. Huang, C. Chen, J. Gray, and T. Huang
TBX3 and Its Isoform TBX3+2a Are Functionally Distinctive in Inhibition of Senescence and Are Overexpressed in a Subset of Breast Cancer Cell Lines
Cancer Res., August 1, 2004; 64(15): 5132 - 5139.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Prince, S. Carreira, K. W. Vance, A. Abrahams, and C. R. Goding
Tbx2 Directly Represses the Expression of the p21WAF1 Cyclin-Dependent Kinase Inhibitor
Cancer Res., March 1, 2004; 64(5): 1669 - 1674.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
T. G. Davenport, L. A. Jerome-Majewska, and V. E. Papaioannou
Mammary gland, limb and yolk sac defects in mice lacking Tbx3, the gene mutated in human ulnar mammary syndrome
Development, May 15, 2003; 130(10): 2263 - 2273.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. E. Lingbeek, J. J. L. Jacobs, and M. van Lohuizen
The T-box Repressors TBX2 and TBX3 Specifically Regulate the Tumor Suppressor Gene p14ARF via a Variant T-site in the Initiator
J. Biol. Chem., July 12, 2002; 277(29): 26120 - 26127.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (32)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Carlson, H.
Right arrow Articles by Hurlin, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carlson, H.
Right arrow Articles by Hurlin, P. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?