Human Molecular Genetics, 2001, Vol. 10, No. 22 2549-2556
© 2001 Oxford University Press
Mice overexpressing genes from the 22q11 region deleted in velo-cardio-facial syndrome/DiGeorge syndrome have middle and inner ear defects
Department of Molecular Genetics, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461, USA, 1Cardiovascular Division, University of Pennsylvania, 954 BRB II, 421 Curie Boulevard, Philadelphia, PA 19104, USA, 2Forschungszentrum Karlsruhe, Institut fuer Toxikologie und Genetik, Postfach 3640, 76133 Karlsruhe, Germany and 3Eaton-Peabody Laboratory, Department of Otology and Laryngology, Harvard Medical School, Massachusetts Eye and Ear Infirmary, 243 Charles Street, Boston, MA 02114, USA
Received July 9, 2001; Revised and Accepted August 14, 2001.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Velo-cardio-facial syndrome/DiGeorge syndrome (VCFS/DGS) is a congenital anomaly disorder associated with hemizygous 22q11 deletions. We previously showed that bacterial artificial chromosome (BAC) transgenic mice overexpressing four transgenes, PNUTL1, (CDCrel-1), GP1Bß, TBX1 and WDR14, had reduced viability, cardiovascular malformations and thymus gland hypoplasia. Since these are hallmark features of VCFS/DGS, we analyzed the mice for additional anomalies. We found that the mice have important defects in the middle and inner ear that are directly relevant to the disorder. The most striking defect was the presence of chronic otitis media, a common finding in VCFS/DGS patients. In addition, the mice had a hyperactive circling behavior and sensorineural hearing loss. This was associated with middle and inner ear malformations, analogous to Mondini dysplasia in humans reported to occur in VCFS/DGS patients. We propose that overexpression of one or more of the transgenes is responsible for the etiology of the ear defects in the mice. Based upon its pattern of expression in the ear and functional studies of the gene, TbX1 likely plays a central role. Haploinsufficiency of TBX1 may be responsible for ear disorders in VCFS/DGS patients.
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Velo-cardio-facial syndrome/DiGeorge syndrome [VCFS, MIM 192430 (1)/DGS, MIM 188400 (2)], is characterized by craniofacial anomalies including cleft palate, cardiovascular defects, thymus hypoplasia and learning disabilities, associated with hemizygous 22q11 deletions (3). VCFS/DGS patients also have ear disorders including chronic otitis media (middle ear inflammation), with associated conductive hearing loss and some have sensorineural hearing loss, as well (4–9). Most patients have 1.5–3 million base pair (Mb) deletions (3), encompassing over 24 genes. Previous efforts to correlate the size of the deletion with the phenotype have failed. Therefore, it has not been possible to narrow the number of candidate genes down to a manageable few by this approach. To identify genes sensitive to decreased dosage, which may be involved in the etiology of VCFS/DGS, in a systematic way, large sets of overlapping deletions of the region of synteny to the human 22q11 locus have been generated in the mouse (10–13). Mice harboring deletions in the distal half of the 1.5 Mb deleted region had reduced viability and cardiovascular defects of the conotruncal type that were similar to those in VCFS/DGS patients (11–13). Therefore, a gene(s) in this interval is responsible for at least one of the main clinical findings of the disorder. Bacterial artificial chromosome (BAC)-mediated rescue was used to narrow the region to an interval overexpressing four human transgenes (12,13), PNUTL1 (CDCrel-1; 14,15), GP1Bß (16), TBX1 (17) and WDR14 (18). Overexpression of one of these genes is responsible for cardiovascular defects in mice. Surprisingly, the BAC transgenic mice, on their own, had reduced viability and related cardiovascular defects, and in addition, they had thymus hypoplasia (12), providing additional evidence for the presence of an important dosage-sensitive gene in this group of four.
To narrow the number of candidates from four to one, individual genes were targeted for inactivation. Hemizygous inactivating mutations of Tbx1, a T-box containing transcription factor, caused mild but similar cardiovascular defects to those in the other mutants (12,13,19). Based upon these findings, we and others implicated TBX1 in the etiology of cardiovascular defects in VCFS/DGS patients (12,13,19). However, the basis of the other anomalies in VCFS/DGS patients is not known. Mice containing homozygous Tbx1 mutations had more severe anomalies than those occurring in VCFS/DGS patients and they died soon after birth (19). As targeted hemizygous inactivation of genes does not always reveal the full spectrum of their biological roles, in a disorder caused by haploinsufficiency of a gene(s), we believed that gain of function mutants might reveal novel gene functions and might provide viable mice. This provided a rationale for a further investigation of the adult BAC transgenic mice for additional physical anomalies. In this report, we show that two independent BAC transgenic lines have chronic otitis media, a hyperactive circling behavior and sensorineural hearing loss, due to ear defects, similar to those in VCFS/DGS patients. Therefore, the molecular dissection of the phenotype will provide novel insights into normal ear development and disease.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Gene dosage in BAC 316 transgenic mice
To generate BAC transgenic mice, circular BAC 316 DNA was microinjected into fertilized oocyte pronuclei and founders were analyzed by BAC-specific PCR-marker based mapping studies (12). BAC 316 yielded three founders (transgenesis rate of 10%) (Fig. 1A and B). BAC 316 lines 316.23 and 316.27 carried all four transgenes and line 317.13 had a deletion of two transgenes and only carried PNUTL1 and GP1Bß. Transgene copy number was determined by quantitative Southern blot hybridization analysis using both a transgene-specific probe and a mouse genomic single copy probe (Fig. 1B). Based upon this analysis, we found that line 316.23 carried eight to 10 copies of the BAC; 316.27 and 316.13 carried one to two copies. The gene expression level correlated with copy number as determined by northern blot hybridization analysis (Fig. 1C). Reverse-transcriptase PCR (RT–PCR) using human and mouse-specific primers confirmed that all the transgenes were expressed in line 316.23. Both human and mouse PNUTL1 and WDR14 genes were ubiquitously expressed, whereas GP1Bß and TBX1 genes were expressed in a tissue-specific manner (Fig. 1D).
|
BAC 316 transgenic mice have a hyperactive circling behavior
Two of the BAC 316 transgenic lines, 316.23 and 316.27, showed a hyperactive circling behavior as well as head tilt and head tossing, indicative of a vestibular dysfunction. The third line, 316.13, did not have signs of vestibular dysfunction. Line 316.23 was maintained in an FVB inbred background (congenic; 316.23.FVB) and this line was backcrossed into C57Bl/6, referred to as B6 (N6–N8; 316.23.B6). Line 316.27 was analyzed in a mixed B6/FVB background (N4–N5 in FVB). Backcrossing the BAC onto a C57Bl/6 background resulted in a loss of the circling behavior after three to four generations in both lines. Therefore, altering the genetic background modified the phenotype. The 316.13 line did not have a circling behavior or head tilt in either background.
BAC 316 transgenic mice have middle and inner ear defects
To determine the basis for their behavior, we examined the ears in adult BAC 316 transgenic mice for anatomical defects. Pathological studies were performed with 316.23.FVB (n = 23 ears, Tg; n = 14 ears, wild-type) and 316.27 circlers (n = 8 ears, Tg; n = 4 ears, wild-type). The BAC 316.23.B6 mice, possessing only a mild head tilt, were analyzed as well (n = 8, ears, Tg; n = 4 ears, wild-type). A summary of the findings is presented in Table 1 and anatomical details are provided in Figure 2.
|
|
Examination of the anatomy of the middle ears of transgenic mice revealed multiple defects in each line. The middle ear abnormalities in 316.23 mice consisted of a spectrum of features that were all indicative of middle ear inflammation including infusion of red and white blood cells into the middle ear space, fibrosis of infiltrated cells and hypertrophy of submucosal connective tissue and/or the mucosa (Fig. 2B). It is possible that anatomical defects in the Eustachian tubes could account for chronic inflammation. No gross abnormalities were found in the Eustachian tubes in the mice. Chronic otitis media is a common finding in VCFS/DGS patients with 22q11 deletions (8,9). This is the first report to our knowledge of a genetic model for chonic otitis media. This disorder is not only highly prevalent in VCFS/DGS but it is a common health problem of infants and children.
The middle ear contains three ossicles, the incus, malleus and stapes, required to transmit sound wave vibrations to the inner ear. In addition to chronic middle ear inflammation, there were malformations of the middle ear in 316.23 transgenic mice. The most common structural anomaly was a malformed (Fig. 2G) or missing stapes footplate, which normally rests on the oval window (Fig. 2I). This defect occurred equally in both FVB and B6 backgrounds (Table 1).
The inner ear consists of two sensory organ systems. The cochlea is required for hearing and the vestibular system, containing the semicircular canals, utricle and saccule, is required for maintaining a sense of balance. These organs contain fluid termed endolymph and are surrounded by perilymph. The defects in the inner ear included abnormalities in the endolymphatic sac and duct (Fig. 2D–F), malformed (Fig. 2K), missing (Fig. 2L) and ectopic (Fig. 2L) or supernumerary sensory organs (Fig. 2M), a shortened or malformed cochlear duct (Fig. 2B) and hypoplastic semicircular canals (Fig. 2O). The presence of a 50% incidence of shortened cochleas in the 316.23.FVB group (Table 1) is likely to be an underestimate due to sampling errors involved in assaying the small apical end of the mouse cochlea. The abnormalities were more mild and less frequent in the 316.27, low copy line transgenic mice (Table 1). None of the abnormalities was present in wild-type littermates (Fig. 2A, C, F, J and N). The vestibular malformations could account for the circling, head tilt and head bobbing that were observed in the transgenic mice. The severe structural defects observed in the cochlea, unilaterally or bilaterally, in these mice might account for correspondingly severe hearing loss.
In humans, ear defects can be classified according to the type and extent of the malformations. One of the more common classifications of malformations associated with sensorineural deafness is termed Mondini dysplasia (20). Human beings with this condition have a hypoplastic cochlea, large vestibule, abnormal semicircular canals, immature sensorineural structures and in some cases, a defective stapes footplate (20). The malformations present in the BAC transgenic mice are consistent with Mondini dysplasia. Such malformations have been described to occur in association with VCFS/DGS (4–9).
BAC 316 transgenic mice have sensorineural hearing loss
We examined the BAC 316 transgenic mice for hearing loss by auditory-evoked brainstem response (ABR) threshold measurements (Fig. 3). Unilateral and bilateral sensorineural hearing loss was present in the transgenic mice with varying severity (n = 9) (Fig. 3). Two 316.27 mice had unilateral hearing loss and the rest had normal hearing (Fig. 3A). This is consistent with the presence of more mild malformations in this line (Table 1). In contrast, all BAC 316.23.FVB mice had detectable loss in the low frequency range and severe loss occurred bilaterally in one and unilaterally in two additional mice (Fig. 3B). None of the wild-type littermates had hearing loss (Fig. 3). Mice with chronic otitis media could not be assayed and they were not included in Figure 3.
|
Transgene expression by in situ hybridization
To determine which of the four transgenes could contribute to the observed phenotype in the BAC transgenic mice, and to rule out ectopic expression, we performed a series of expression studies of 9.5–11.5 days post-coitum (d.p.c.) embryos from the BAC 316.23, high copy line. We examined the expression pattern of the four endogenous genes, Wdr14, Tbx1, Gp1bß and Pnutl1 in wild-type littermates. An in situ hybridization signal was not detected for mouse or human Wdr14, a novel six WD40 repeat containing protein (18) and Gp1bß encoding a platelet glycoprotein (16), in wild-type mice or the human transgenes in the BAC transgenic mice, respectively (data not shown) despite its detectable expression by RT–PCR (Fig. 1D). Homozygous inactivating mutations of GP1Bß in humans, is associated with a rare bleeding disorder termed Bernard–Soulier syndrome and they do not have physical defects (21).
PNUTL1 is a member of the septin family of GTPases required for function in cytokinesis and synaptic vesicle transport in exocytosis in the brain (15). The mouse Pnutl1 gene is ubiquitously expressed at low levels (Fig. 1D). Previous in situ hybridization studies revealed high expression in dorsal root ganglia and the developing brain and low expression in the pharyngeal arches (22). A more detailed radioactive hybridization study revealed low level ubiquitous expression including the otic vesicle and pharyngeal arches, with higher levels seen in the dorsal root ganglia (Fig. 4G). The PNUTL1 transgene was expressed at high levels in these same structures (Fig. 4H). Therefore, its presence might suggest a functional role in pharyngeal arch and otic vesicle development. However, the lack of a phenotype in 316.13 transgenic mice (Fig. 1) suggests a secondary role for PNUTL1.
|
In contrast to these three, Tbx1, a member of the T-box containing transcription factor gene family, was highly endogenously expressed in the otic vesicle and surrounding periotic mesenchyme, as well as the pharyngeal arches (Fig. 4B, D–F), as described by Chapman et al. (17). The pattern of expression was exactly what would have been expected for a candidate gene for VCFS/DGS. The human TBX1 transgene (Fig. 4A and C) was expressed in the same pattern as the endogenous gene (Fig. 4B and D) and it did not cross-hybridize with the endogenous one (Fig. 4B). Therefore, of the four, TBX1, has the strongest specific expression pattern in the affected tissues.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Genomic approaches, such as the generation of BAC-containing transgenic mice provide novel functional genomics opportunities. Such gain-of-function mutants are especially useful in identifying genes whose function might be sensitive to altered dosage, especially those that contribute to the etiology of genomic disorders, such as VCFS/DGS. We show here that two independent lines containing BAC 316, overexpressing four human transgenes, WDR14, TBX1, PNUTL1 and GP1Bß, had ear disorders similar to those occurring in VCFS/DGS patients. We suggest that overexpression of one or more of the transgenes is responsible for the phenotype in the mice and perhaps haploinsufficiency is responsible for these defects in VCFS/DGS patients.
WDR14, PNUTL1 and GP1Bß genes
Candidate transgenes for the observed phenotype should be expressed in the developing inner ear. GP1Bß is a platelet glycoprotein essential for blood clotting and its recessive mutations are associated with Bernard–Soulier syndrome, a rare bleeding disorder (21). Specific expression of WDR14, encoding a novel protein (18) and GP1Bß, was not detected in mid-gestational mouse embryos, making them less obvious candidates for the observed phenotype. Mouse Pnutl1, is hypothesized to be involved in the regulation of synaptic vesicle function in nervous tissues (15). Expression was detectable in the otic vesicle as well as the pharyngeal arches and at moderate levels in nervous tissues, whereas the PNUTL1 transgene was expressed at high levels in these structures, as determined by in situ hybridization of embryos. It is possible that its overexpression may play a role in the etiology of inner ear malformations. However, mice containing homozygous inactivating mutations of Pnutl1 are phenotypically normal and healthy (13), putting to question an obvious role for this gene in ear development. Furthermore, the BAC 316.13 transgenic mice overexpressing PNUTL1 and GP1Bß, only, but not TBX1 or WDR14, did not have a hyperactive circling behavior, indicative of ear malformations. Therefore, the role of PNUTL1 in the etiology of the BAC transgenic phenotype is unclear.
TBX1 is a candidate for the ear disorders in BAC transgenic mice
There is substantial evidence to support the role of TBX1 in causing the BAC transgenic phenotype. The first piece of evidence stems from its membership in a large family of dosage sensitive transcription factor genes whose gene products share a common T-box DNA-binding motif, many of which are essential for embryonic development (23). The T gene is required for mesoderm formation and anteroposterior axis formation in mammalian embryos. Haploinsufficiency and overexpression of the prototype, Brachyury or T, results in embryological malformations of the long axis (24). Haploinsufficiency of two related family members, TBX3 and TBX5, is responsible for the etiology of Ulner-mammary syndrome (25) and Holt–Oram syndrome (26,27), respectively. Duplication of 12q24, the region containing both genes, is associated with congenital anomalies (28–30), suggesting that TBX3 and/or TBX5 might be sensitive to increased dosage, as well as decreased dosage.
Therefore, it is possible to hypothesize that TBX1, a member of a dosage sensitive gene family and a gene specifically expressed in the affected structures (17), may play a major role in the etiology of the observed embryonic malformations. The fact that embryos with homozygous inactivating mutations of Tbx1 cause outer, middle and inner ear malformations (19), is the third piece of evidence supporting its role in the etiology of ear disorders in the transgenic mice.
BAC 316 transgenic mice as a model for VCFS/DGS
A mouse model for VCFS/DGS would serve to understand the pathophysiology of the disorder. The BAC transgenic mice have a multitude of defects resembling those in VCFS/DGS patients. The fact that the four genes are overexpressed, yet result in a similar phenotype to VCFS/DGS, where they are haploinsufficient may provide a key to understanding the role of dosage sensitive genes on 22q11.
It is not unprecedented that overexpression and underexpression of a transcription factor gene results in developmental defects of similar structures. For example, both decreased and increased dosage of the PAX6 gene results in related eye abnormalities as determined by a phenotypic analysis of mice carrying inactivating mutations of Pax6 and yeast artificial chromosome (YAC) transgenic mice containing human PAX6 (31). Although the exact types of anomalies are somewhat different, the same structures are involved. In the case of PAX6 and the BAC transgenic mice, the mechanism of dosage sensitivity is unknown. One possibility is that overexpression causes a dominant negative phenotype and another possibility is that it causes a hypomorphic phenotype.
A dominant negative effect of the human transgenes can be ruled out as a possibility because significant complementation rescue occurred when the PAX6 or BAC transgenic mice were crossed with their respective hemizygotes (12,31). A dominant negative effect would have caused a more severe phenotype, in both cases. A hypomorphic phenotype could occur when the overexpression of a particular gene interferes with its own normal function by sequestering interactive factors (32). For example, the transgene could homodimerize instead of forming functional heterodimers with other effectors. This is a possibility for TBX1 because T-gene family members can dimerize (33,34). Based upon the fact that Tbx1 belongs to a family of dosage sensitive genes, it is expressed in the affected structures and that Tbx1 null mutants have ear malformations (11), it is likely that TBX1 plays a central role in the etiology of a multitude of anomalies in VCFS/DGS patients and that they can be modeled in the BAC transgenic mice.
In addition to the potential role of TBX1, overexpression of the other transgenes, such as PNUTL1, may contribute to the phenotype in the transgenic mice and in patients as well. Genetic rescue experiments between BAC transgenic mice and those carrying individual inactivating mutations, as well as single gene transgenic mice, will shed light as to the precise functional roles of the transgenes in this unique model of ear disorders and VCFS/DGS.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
RT–PCR analysis
The generation of BAC 316L10 (RPCI-11; http://www.chori.org/bacpac/11framehmale.htm) transgenic mice has been described (12). PCR assays to detect the BAC 316L10, herein referred to as BAC 316, were established as described by Merscher et al. (12). For RT–PCR, 3 µg of RNA were reverse transcribed using the Superscript Preamplification System (Gibco, BRL). Amplification of DNaseI-treated RNA prior to reverse transcription served as a ‘no RT’ control. In all cases, 3–5 µl of cDNA were used for PCR analysis. The human and mouse Gp1bß genes (Glycoprotein1bß; 16) were amplified using the Expand Long Template PCR System (Boehringer Mannheim) in the presence of buffer 1 and 10% DMSO.
Genomic Southern blot hybridization analysis
For lines containing BAC 316, a probe for genomic Southern blot hybridization analysis, was generated using cos89F (CCATCACCAACAGAAACACG) and cos89-R (TCCATGTGCCCACACAAG). A probe corresponding to a mouse single-copy locus from mouse chromosome 16 was amplified from BAC 72k21 (accession no. AC0003060) using primers BAC72mu.2-F (TAGCCACTCCACAAGGCAG) and BAC72mu.2-R (CCCTGAGCTACGTCTTCTGG). The intensity of the signals was compared using an Image QuaNT Phosphorimager (Molecular Dynamics) and copy numbers were estimated after making corrections for the different lengths of the probes.
Northern blot hybridization analysis
Total RNA was isolated using a LiCl/Urea precipitation procedure. Probes for the transgenes corresponded to parts of the coding sequences NM000173 (GP1Bß), AF301595 (WDR14), AF012130 (TBX1) and Y11593 (PNUTL1) and were PCR-amplified from human cDNA (Clontech). A probe corresponding to the human ß-actin gene (Clontech) was used to demonstrate equal loading.
In situ hybridization studies
Whole-mount embryo preparation, processing, probe preparation and digoxigenin-mediated in situ hybridization were performed essentially as described (http://www.hhmi.ucla.edu/derobertis/protocol_page). The probes used for hybridization were amplified from cDNA generated from mouse testis RNA (Superscript II Preamplification System; Gibco BRL) or human testis cDNA (Clontech), digested with either EcoRI or BamHI and subsequently subcloned into pBluescript II KS for in vitro transcription. For Pnutl1, a 351 bp fragment was amplified using primers Pnutl1.muRT_R1-Fa (GGGGGAATTCGGGAACTGAAGGAAAGTGCA) and Pnutl1.muRT_R1-Ra (GGGGGAATTCTGATGAGCTTCTCGGTCTCC); for Gp1bß, a 590 bp fragment was amplified using primers Gp1bb.muRT_R1-F (GGGGGAATTCGAATTGGTGCTGACCGGCAA) and Gp1bb.muRT_R1-R (GGGGGAATTCACCATGTTGATTCAGGCTTGC); for Tbx1, a 461 bp fragment was amplified using primers Tbx1.muRT_R1-F (GGGGGAATTCAGCGAGATCCTGCTACACCT) and Tbx1.muRT_R1-R (GGGGGAATTCCCGAGAGCGAGCAAAGGCA); and for Wdr14, a 948 bp fragment was amplified using primers G5.muRT_R1-R3 (GGGGGAATTCTGCCAGGTGTCTATCATCTG) and G5.muRT_R1-F3 (GGGGGAATTCAGGGTGTAATCTGGCTGAAG). For PNUTL1, a 308 bp fragment was amplified using primers PNUTL1.RT1_R1-F (GGGGGAATTCATATGCACGACCTCAAGGAC) and PNUTL1. RT2_R1-R (GGGGGAATTCGAACAGTCCGGTCTGGTGT); for GP1Bß, a 354 bp fragment was amplified using primers GP1.RT2_R1-F (GGGGGAATTCTGCACGCGTTGCTGCTGGTG) and GP1 RT2_R1-R (GGGGGAATTCAGCCTGGAAGTGCGGGTTCG); and for TBX1, a 470 bp fragment was amplified using primers TBX1.RT3_HI-F (GGGGGGATCCACTTCGTGCCGGTGGACGAT) and TBX1.RT1_H1-R (GGGGGGATCCAGGCGCTCATGAGCGGCAGT). For WDR14, the 1.5 kb insert of EST AI870670 was excised with Not1 and EcoR1 and used.
Radioactive in situ hybridization was performed using tissue fixed in 4% paraformaldehyde, dehydrated, embedded in paraffin and sectioned at 8 µm as described by Wawersik and Epstein (35). After washing, slides were exposed to photographic emulsion for 7 days. Sense probes did not produce a signal.
Histological analysis of the middle and inner ear
The adult specimens were prepared essentially as described by Xu et al. (36). Briefly, anesthetized mice were perfused with 10% formalin, auditory bullae were filled with 10% formalin and 1% acetic acid and the heads were incubated in this solution for 3 days. After decalcification in 8 N formic acid, specimens were embedded in paraffin, sectioned at 8 µm and every fifth section was stained with hematoxylin and eosin. Both ears in 14 316.23.FVB and seven wild-type littermates, four 316.23.Bl/6 and two wild-type littermates, as well as four 316.27 and two wild-type littermates, were examined.
ABR testing
Hearing status of adult mice 2–3 months of age, was assessed by obtaining ABR thresholds. ABR signals were recorded from needle electrodes inserted through the skin (vertex to ipsilateral tragus). Computer-assisted evoked potential systems were used to obtain responses to tone pips at 5, 8, 11, 16, 22, 32 and 45 kHz (tone pip duration 5 ms; repetition rate 30/s) and averaged responses to 512 pips of alternating polarity.
|
ACKNOWLEDGEMENTS |
|---|
We thank James Horner and Dr Ken Chen for performing the pronuclear micro-injections. We thank Drs Arthur Skoultchi, Raju Kucherlapati, Sandra Merscher, Lisa Edelmann, Thomas Van De Water, Scott Emmons and Joerg Heyer for helpful discussions. This work was supported by grant PO-1 HD34980-3 from the National Institutes of Health (NIH), a March of Dimes Grant (1-FY00-4) and an American Heart Association Established Investigator Grant (0040133N) to B.E.M. J.A. was supported by a NIH grant (DC03929). M.C.B. was supported by a NIH grant (DC01089). J.A.E. was supported by NIH grants RO-1 HL62974 and HL61475 as well as the WW Smith Foundation. H.S. is supported by a grant from Deutsche Forschungsgemeinschaft (503-2).
|
FOOTNOTES |
|---|
+ To whom correspondence should be addressed. Tel: +1 718 430 4274; Fax: +1 718 430 8778; Email: morrow@aecom.yu.edu
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
1 Shprintzen, R.J., Goldberg, R.B., Lewin, M.L., Sidoti, E.J., Berkman, M.D., Argamaso, R.V. and Young, D. (1978) A new syndrome involving cleft palate, cardiac anomalies, typical facies and learning disabilities: velo-cardio-facial syndrome. Cleft Palate J., 15, 56–62.[Web of Science][Medline]
2 DiGeorge, A. (1965) A new concept of the cellular basis of immunity. J. Pediatr., 67, 907–908.
3 Morrow, B., Goldberg, R., Carlson, C., Das Gupta, R., Sirotkin, H., Collins, J., Dunham, I., O’Donnell, H., Scambler, P., Shprintzen, R. et al. (1995) Molecular definition of the 22q11 deletions in velo-cardio-facial syndrome. Am. J. Hum. Genet., 56, 1391–1403.[Web of Science][Medline]
4 Adkins, W.Y.,Jr and Gussen, R. (1974) Temporal bone findings in the third and fourth pharyngeal pouch (DiGeorge) syndrome. Arch Otolaryngol., 100, 206–208.
5 Black, F.O., Spanier, S.S. and Kohut, R.I. (1975) Aural abnormalities in partial DiGeorge syndrome. Arch. Otolaryngol., 101, 129–134.
6 Ohtani, I. and Schuknecht, H.F. (1984) Temporal bone pathology in DiGeorge’s syndrome. Ann. Otol. Rhinol. Laryngol., 93, 220–224.[Web of Science][Medline]
7 Smith, S.D. and Harker, L.A. (1998) Single gene influences on radiologically-detectable malformations of the inner ear. J. Commun. Disord., 31, 391–408.[Web of Science][Medline]
8 Reyes, M.R., LeBlanc, E.M. and Bassila, M.K. (1999) Hearing loss and otitis media in velo-cardio-facial syndrome. Int. J. Pediatr. Otorhinolaryngol., 47, 227–233.[Web of Science][Medline]
9 Ford, L.C., Sulprizio, S.L. and Rasgon, B.M. (2000) Otolaryngological manifestations of velocardiofacial syndrome: a retrospective review of 35 patients. Laryngoscope, 110, 362–367.[Web of Science][Medline]
10 Kimber, W.L., Hsieh, P., Hirotsune, S., Yuva-Paylor, L., Sutherland, H.F., Chen, A., Ruiz-Lozano, P., Hoogstraten-Miller, S.L., Chien, K.R., Paylor, R., Scambler, P.J. and Wynshaw-Boris, A. (1999) Deletion of 150 kb in the minimal DiGeorge/velocardiofacial syndrome critical region in mouse. Hum. Mol. Genet., 8, 2229–2237.
11 Lindsay, E.A., Botta, A., Jurecic, V., Carattini-Rivera, S., Cheah, Y.C., Rosenblatt, H.M., Bradley, A. and Baldini, A. (1999) Congenital heart disease in mice deficient for the DiGeorge syndrome region. Nature, 401, 379–383.[Medline]
12 Merscher, S., Funke, B., Epstein, J.A., Heyer, J., Puech, A., Lu, M.M., Xavier, R.J., Demay, M.B., Russell, R.G., Factor, S. et al. (2001) A mouse model for velo-cardio-facial/DiGeorge syndromes and the identification of Tbx1 as the gene responsible for cardiovascular defects. Cell, 104, 619–629.[Web of Science][Medline]
13 Lindsay, E.A., Vitelli, F., Su, H., Morlshima, M., Huynh T., Pramparo, T., Jurecic, V., Ogunrinu, G., Sutherland, H.F., Scambler, P.J., Bradley, A. and Baldini, A. (2001) Tbx1 haploinsufficieny in the DiGeorge syndrome region causes aortic arch defects in mice. Nature, 410, 97–101.[Medline]
14 McKie, J.M., Sutherland, H.F., Harvey, E., Kim, U.J. and Scambler, P.J. (1997) A human gene similar to Drosophila melanogaster peanut maps to the DiGeorge syndrome region of 22q11. Hum. Genet., 101, 6–12.[Web of Science][Medline]
15 Beites, C.L., Xie, H., Bowser, R. and Trimble, W.S. (1999) The septin CDCrel-1 binds syntaxin and inhibits exocytosis. Nat. Neurosci., 2, 434–439.[Web of Science][Medline]
16 Kelly, M.D., Essex, D.W., Shapiro, S.S., Meloni, F.J., Druck, T., Huebner, K. and Konkle, B.A. (1994) Complementary DNA cloning of the alternatively expressed endothelial cell glycoprotein Ib ß (GPIb ß) and localization of the GPIb ß gene to chromosome 22. J. Clin. Invest., 93, 2417–2424.
17 Chapman, D.L., Garvey, N., Hancock, S., Alexiou, M., Agulnik, S.I., Gibson-Brown, J.J., Cebra-Thomas, J., Bollag, R.J., Silver, L.M. and Papaioannou, V.E. (1996) Expression of the T-box family genes, Tbx1–Tbx5, during early mouse development. Dev. Dyn., 206, 379–390.[Web of Science][Medline]
18 Funke, B., Pandita, R.K. and Morrow, B.E. (2001) Isolation and characterization of a novel gene containing WD40 repeats from the region deleted in velo-cardio-facial/DiGeorge syndrome on chromosome 22q11. Genomics, 73, 264–271.[Web of Science][Medline]
19 Jerome, L.A. and Papaioannou, V.E. (2001) DiGeorge syndrome phenotype in mice mutant for the T-box gene, Tbx1. Nat. Genet., 27, 1–6.[Web of Science][Medline]
20 Schuknecht, H.F. (1980) Mondini dysplasia; a clinical and pathological study. Ann. Otol. Rhinol. Laryngol., 89 (suppl.), 1–23.
21 Budarf, M.L., Konkle, B.A., Ludlow, L.B., Michaud, D., Li, M., Yamashiro, D.J., McDonald-McGinn, D., Zackai, E.H. and Driscoll, D.A. (1995) Identification of a patient with Bernard–Soulier syndrome and a deletion in the DiGeorge/velo-cardio-facial chromosomal region in 22q11.2. Hum. Mol. Genet., 4, 763–766.
22 Maldonado-Saldivia, J., Funke, B., Pandita, R.K., Schuler, T., Morrow, B.E. and Schorle, H. (2000) Expression of cdcrel-1 (PNUTL1), a gene frequently deleted in velo-cardio-facial syndrome/DiGeorge syndrome. Mech. Dev., 96, 121–124.[Web of Science][Medline]
23 Wilkinson, D.G., Bhatt, S. and Herrmann, B.G. (1990) Expression pattern of the mouse T gene and its role in mesoderm formation. Nature, 343, 657–659.[Medline]
24 Stott, D., Kispert, A. and Herrmann, B.G. (1993) Rescue of the tail defect of Brachyury mice. Genes Dev., 7, 197–203.
25 Bamshad, M., Lin, R.C., Law, D.J., Watkins, W.C., Krakowiak, P.A., Moore, M.E., Franceschini, P., Lala, R., Holmes, L.B., Gebuhr, T.C. et al. (1997) Mutations in human TBX3 alter limb, apocrine and genital development in ulnar-mammary syndrome. Nat. Genet., 16, 311–315.[Web of Science][Medline]
26 Basson, C.T., Bachinsky, D.R., Lin, R.C., Levi, T., Elkins, J.A., Soults, J., Grayzel, D., Kroumpouzou, E., Traill, T.A., Leblanc-Straceski, J. et al. (1997) Mutations in human TBX5 cause limb and cardiac malformation in Holt–Oram syndrome. Nat. Genet., 15, 30–35.[Web of Science][Medline]
27 Li, Q.Y., Newbury-Ecob, R.A., Terrett, J.A., Wilson, D.I., Curtis, A.R., Yi, C.H., Gebuhr, T., Bullen, P.J., Robson, S.C., Strachan, T. et al. (1997) Holt–Oram syndrome is caused by mutations in TBX5, a member of the Brachyury (T) gene family. Nat. Genet., 15, 21–29.[Web of Science][Medline]
28 Melnyk, A.R., Weiss, L., Van Dyke, D.L. and Jarvi, P. (1981) Malformation syndrome of duplication 12q24.1 leads to qter. Am. J. Med. Genet., 10, 357–365.[Web of Science][Medline]
29 McCorquodale, M.M., Rolf, J., Ruppert, E.S., Kurczynski, T.W. and Kolacki, P. (1986) Duplication (12q) syndrome in female cousins, resulting from maternal (11;12) (p15.5;q24.2) translocations. Am. J. Med. Genet., 24, 613–622.[Web of Science][Medline]
30 Dixon, J.W., Costa, T. and Teshima, I.E. (1993) Mosaicism for duplication 12q (12q13–12;q24.2) in a dysmorphic male infant. J. Med. Genet., 30, 70–72.
31 Schedl, A., Ross, A., Lee, M., Engelkamp, D., Rashbass, P., van Heyningen, V. and Hastie, N.D. (1996) Influence of PAX6 gene dosage on development: overexpression causes severe eye abnormalities. Cell, 86, 71–82.[Web of Science][Medline]
32 Ptashne, M. and Gann, A. (1997) Transcriptional activation by recruitment. Nature, 386, 569–577.[Medline]
33 Kispert, A. and Herrmann, B.G. (1993) The Brachyury gene encodes a novel DNA binding protein. EMBO J., 12, 3211–3220.[Web of Science][Medline]
34 Sinha, S., Abraham, S., Gronostajski, R.M. and Campbell, C.E. (2000) Differential DNA binding and transcription modulation by three T-box proteins, T, TBX1 and TBX2. Gene, 258, 15–29.[Web of Science][Medline]
35 Wawersik, S. and Epstein, J.A. (2000) Gene expression analysis by in situ hybridization. Radioactive probes. Methods Mol. Biol., 137, 87–96.[Medline]
36 Xu, P.X., Adams, J., Peters, H., Brown, M.C., Heaney, S. and Maas, R. (1999) Eya1-deficient mice lack ears and kidneys and show abnormal apoptosis of organ primordia. Nat. Genet., 23, 113–117.[Web of Science][Medline]
37 Puech, A., Saint-Jore, B., Funke, B., Gilbert, D.J., Sirotkin, H., Copeland, N.G., Jenkins, N.A., Kucherlapati, R., Morrow, B. and Skoultchi, A.I. (1997) Comparative mapping of the human 22q11 chromosomal region and the orthologous region in mice reveals complex changes in gene organization. Proc. Natl. Acad. Sci. USA, 94, 14608–14613.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  H. Ishiguro, M. Koga, Y. Horiuchi, E. Noguchi, M. Morikawa, Y. Suzuki, M. Arai, K. Niizato, S. Iritani, M. Itokawa, et al. Supportive evidence for reduced expression of GNB1L in schizophrenia Schizophr Bull, November 14, 2008; (2008) sbn160v1. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Zhang and A. Baldini In vivo response to high-resolution variation of Tbx1 mRNA dosage Hum. Mol. Genet., January 1, 2008; 17(1): 150 - 157. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. S. Arnold, E. M. Braunstein, T. Ohyama, A. K. Groves, J. C. Adams, M. C. Brown, and B. E. Morrow Tissue-specific roles of Tbx1 in the development of the outer, middle and inner ear, defective in 22q11DS patients Hum. Mol. Genet., May 15, 2006; 15(10): 1629 - 1639. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. S. Arnold, U. Werling, E. M. Braunstein, J. Liao, S. Nowotschin, W. Edelmann, J. M. Hebert, and B. E. Morrow Inactivation of Tbx1 in the pharyngeal endoderm results in 22q11DS malformations Development, March 1, 2006; 133(5): 977 - 987. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Hiroi, H. Zhu, M. Lee, B. Funke, M. Arai, M. Itokawa, R. Kucherlapati, B. Morrow, T. Sawamura, and S. Agatsuma A 200-kb region of human chromosome 22q11.2 confers antipsychotic-responsive behavioral abnormalities in mice PNAS, December 27, 2005; 102(52): 19132 - 19137. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Liao, L. Kochilas, S. Nowotschin, J. S. Arnold, V. S. Aggarwal, J. A. Epstein, M. C. Brown, J. Adams, and B. E. Morrow Full spectrum of malformations in velo-cardio-facial syndrome/DiGeorge syndrome mouse models by altering Tbx1 dosage Hum. Mol. Genet., August 1, 2004; 13(15): 1577 - 1585. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. O. Bush, Y. Lan, and R. Jiang The cleft lip and palate defects in Dancer mutant mice result from gain of function of the Tbx10 gene PNAS, May 4, 2004; 101(18): 7022 - 7027. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Raft, S. Nowotschin, J. Liao, and B. E. Morrow Suppression of neural fate and control of inner ear morphogenesis by Tbx1 Development, April 15, 2004; 131(8): 1801 - 1812. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. K. Chauhan, Y. Yang, K. Cveklova, and A. Cvekl Functional interactions between alternatively spliced forms of Pax6 in crystallin gene regulation and in haploinsufficiency Nucleic Acids Res., March 12, 2004; 32(5): 1696 - 1709. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Piotrowski, D.-g. Ahn, T. F. Schilling, S. Nair, I. Ruvinsky, R. Geisler, G.-J. Rauch, P. Haffter, L. I. Zon, Y. Zhou, et al. The zebrafish van gogh mutation disrupts tbx1, which is involved in the DiGeorge deletion syndrome in humans Development, October 15, 2003; 130(20): 5043 - 5052. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Vitelli, A. Viola, M. Morishima, T. Pramparo, A. Baldini, and E. Lindsay TBX1 is required for inner ear morphogenesis Hum. Mol. Genet., August 15, 2003; 12(16): 2041 - 2048. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Spiteri, M. Babcock, C. D. Kashork, K. Wakui, S. Gogineni, D. A. Lewis, K. M. Williams, S. Minoshima, T. Sasaki, N. Shimizu, et al. Frequent translocations occur between low copy repeats on chromosome 22q11.2 (LCR22s) and telomeric bands of partner chromosomes Hum. Mol. Genet., August 1, 2003; 12(15): 1823 - 1837. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. A. COLLIER FISH, flexible joints and panic: are anxiety disorders really expressions of instability in the human genome? The British Journal of Psychiatry, December 1, 2002; 181(6): 457 - 459. [Full Text] [PDF]
|
|
|
|
|
|
A. Baldini DiGeorge syndrome: the use of model organisms to dissect complex genetics Hum. Mol. Genet., October 1, 2002; 11(20): 2363 - 2369. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||