Human Molecular Genetics, 2001, Vol. 10, No. 22 2569-2579
© 2001 Oxford University Press
Similarities between spinocerebellar ataxia type 7 (SCA7) cell models and human brain: proteins recruited in inclusions and activation of caspase-3
1INSERM U289, Hôpital de la Salpêtrière, 47 boulevard de lHôpital, 75651 Paris, Cedex 13, France, 2Neurogenetics Unit, Department of Molecular Medicine, Karolinska Institute, Stockholm, Sweden, 3Laboratoire de Neuropathologie Escourolle, 4INSERM U106 and Ecole Pratique des Hautes Etudes, 5LGN, Bâtiment CERVI, 6Féderation de Neurologie and 7Département de Génétique, Cytogénétique et Embryologie, Hôpital de la Salpêtrière, 75651 Paris, Cedex 13, France, 8Division of Neuropathology, The Jikei University School of Medicine, Tokyo, Japan
Received July 10, 2001; Revised and Accepted August 25, 2001.
| ABSTRACT |
|---|
|
|
|---|
Spinocerebellar ataxia type 7 (SCA7) is an autosomal dominant polyglutamine disorder presenting with progressive cerebellar ataxia and blindness. The molecular mechanisms underlying the selective neuronal death typical of SCA7 are unknown. We have established SCA7 cell culture models in HEK293 and SH-SY5Y cells, in order to analyse the effects of overexpression of the mutant ataxin-7 protein. The cells readily formed anti-ataxin-7 positive, fibrillar inclusions and small, nuclear electron dense structures. We have compared the inclusions in cells expressing mutant ataxin-7 and in human SCA7 brain tissue. There were consistent signs of ongoing abnormal protein folding, including the recruitment of heat-shock proteins and proteasome subunits. Occasionally, sequestered transcription factors were found. Activated caspase-3 was recruited into the inclusions in both the cell models and human SCA7 brain and its expression was upregulated in cortical neurones, suggesting that it may play a role in the disease process. Finally, on the ultrastructural level, there were signs of autophagy and nuclear indentations, indicative of a major stress response in cells expressing mutant ataxin-7.
| INTRODUCTION |
|---|
|
|
|---|
Spinocerebellar ataxia type 7 (SCA7) is one of nine known polyglutamine disorders (15). The group also includes Huntingtons disease (HD), spinal and bulbar muscular atrophy (SBMA), dentatorubral-pallidoluysian atrophy (DRPLA), SCA1-3, 6 and SCA17/TBP disease. SCA7 is an autosomal dominant neurodegenerative disorder, characterized by cerebellar ataxia and visual loss. Pathologically, there is progressive macular degeneration associated with predominant neuronal loss in the cerebellar cortex, the brain stem and the inferior olivary complex. The underlying genetic mutation is an abnormal expansion of a polymorphic CAG repeat (
36
300 units in patients, 435 units in controls) in the 5' region of the SCA7 gene. The propensity of the repeat to expand in SCA7 results in striking anticipation (6). The SCA7 gene encodes a widely expressed 892 amino acid protein, ataxin-7, of unknown function (712). The protein has a functional nuclear localization signal (NLS) (13), but endogenous ataxin-7 is found both in the cytoplasm and in the nucleus in neurones. In COS1 cells overexpressed ataxin-7 is associated with the nuclear matrix and nucleolus (13). The protein carries a motif related to the phosphate-binding site of arrestins (14) and several SH3-binding domains through which it interacts with a Cbl associated protein (15).
Polyglutamine containing proteins have an inherent ability to aggregate when the length of the polyglutamine tract exceeds
3540 glutamines, the threshold above which most of the diseases develop (16). The hallmark of a polyglutamine disease is the presence of ubiquitinated aggregates, neuronal intranuclear inclusions (NIIs), which have been found in human brain, transgenic mice- and cell-models (17). Several groups of proteins, such as elements of the ubiquitinproteasome system and transcription factors, are sequestered in the NIIs. However, whether the inclusions are only a marker of the disease or part of the disease process is a matter of debate (1820). Some studies in transfected cell cultures and transgenic mice have suggested that critical nuclear processes might be perturbed by the polyglutamine expansion and that altered gene transcription may be a major cause of cellular dysfunction (2123). Why this occurs in only selective neuronal populations, is not known, but it has been hypothesized that the polyglutamine expansions trigger a toxic gain of function, eventually through altered interactions with selectively expressed proteins.
The molecular pathways leading to neuronal dysfunction and subsequent death in SCA7 are poorly understood. In an attempt to approach the role of the inclusions and associated abnormalities in SCA7 pathogenesis, we have characterized the inclusions and morphological alterations in HEK293 and SH-SY5Y cells expressing mutant ataxin-7 and the inclusions in human SCA7 cases. Several heat-shock proteins, subunits of the proteasome, transcription factors and activated caspase-3 were detected in a subset of inclusions, and overall caspase-3 immunoreactivity was enhanced in post-mortem SCA7 brain tissue compared to normal brain. There were also ultrastructural signs of autophagy and nuclear indentations, as major cell stress response, in the transfected cells. Moreover, moderate long-term toxicity of ataxin-7 was observed in the cellular models.
| RESULTS |
|---|
|
|
|---|
Ataxin-7 is mainly nuclear and mutant ataxin-7 forms inclusions with a fibrillar structure
A series of normal (10Q) and mutant (100Q), full-length and truncated forms of SCA-7 with tags or fused to GFP (Fig. 1A) were expressed in human embryonic kidney (HEK293) and human neuroblastoma SH-SY5Y cells. Western blotting showed that the different forms of the ataxin-7 protein were expressed with the expected apparent molecular weight. The truncated variants were expressed at much higher level than the full-length protein (Fig. 1B). The general level of expression was lower in SH-SY5Y than in HEK293 cells.
|
Localization of the various proteins after transfection of HEK293 cells was determined by GFP fluorescence and anti-ataxin-7 immunofluorescence (Fig. 1C). Full-length wild-type and mutant ataxin-7 were localized predominantly in the nucleus, indicating that the endogenous NLS was functional (Figs 1C and 2Aa). Cytoplasmic or nucleo-cytoplasmic staining was less frequent, and the nuclei of these cells were often condensed when counterstained with Hoechst dye (Fig. 2Ac). Preliminary experiments using truncated constructs without NLS showed both nuclear and cytoplasmic localization of the truncated proteins (data not shown). In subsequent experiments, only truncated constructs with an added NLS were used. No aggregates were found with the normal SCA7-10 constructs. Both full-length and truncated mutant ataxin-7 formed aggregates in HEK293 cells, the latter to a much higher extent (
40%) than the former (
17%) (Figs 1C and 2Ab). In SH-SY5Y cells,
16% of the cells expressing ataxin-7
-100 harboured inclusions, whereas full-length ataxin-7-100 generated only a few. Therefore, the truncated construct was used in these cells. The inclusions were of different shape and size and were mostly intra- or perinuclear. Since the pCEP4 and the pEGFP-N1 constructs produced the same pattern of expression, indicating that the GFP did not enhance the aggregate formation, the GFP constructs were used except when indicated.
|
Single or multiple, fibrillar inclusions (12 µm in diameter; Fig. 3Aa, positive for anti-ataxin-7 (1C1) immunogold labelling (Fig. 3B and C, b and c) were found upon ultrastructural examination of HEK293 cells expressing ataxin-7
-100GFP. The inclusions were nuclear as well as perinuclear and did not have limiting membranes. They were composed of individual filaments (
10 nm in diameter), radiating from a dense amorphous centre, and were observed during mitosis as well as in degenerating cells. In addition, several small, isolated electron dense ataxin-7-positive structures were observed (
100 nm in diameter; Fig. 3DF) in the nucleus.
|
Full-length expanded ataxin-7 form inclusions and recruits normal ataxin-7 and ataxin-3
We first investigated whether the full-length protein is able to participate in the formation of inclusions or if it is involved only after cleavage. Transfected cells expressing tagged or GFP fusion variants of full-length ataxin-7-100 were immunostained with antibodies directed against the N-terminal and/or C-terminal tags or were revealed by GFP fluorescence. Confocal microscopy showed that both extremities of the full-length protein were present in all inclusions (Fig. 2Adf). Uncleaved ataxin-7 protein was detected on western blot of total protein extracts (Fig. 1B), indicating that aggregation was promoted by the full-length protein in this experiment.
In accordance with the hypothesis that polyglutamine expansions form polar zippers (24), small polyglutamine tracts of other proteins might be recruited into the NIIs. To determine whether inclusions formed by ataxin-7-100 sequestered normal ataxin-7, ataxin-7 expression constructs (HisSCA7-10GFP and Ha-SCA7-100) were co-transfected into HEK293 cells. Transfected cells were immunostained with an anti-Ha antibody, detecting the mutant form of ataxin-7. Confocal microscopy revealed normal ataxin-7 in inclusions of co-transfected cells, suggesting that wild-type ataxin-7 is recruited into nuclear inclusion (Fig. 2Agi).
In the SCA7 brains, the antibodies against the N-terminal of ataxin-7 (1C1, 1261) identified most NIIs. A few (case 2) NIIs were detected by the antibody against the C-terminal of the ataxin-7 (1598), but only when the N-terminal was present as shown by double immunofluorescence with the 1C1 antibody (Fig. 2Cac). A subset of the ataxin-7-100 cellular inclusions were immunostained by anti-ataxin-3 (2B6) antibody and brain NIIs were frequently stained with anti-ataxin-3 (A3C-1) (data not shown).
Proteins recruited in inclusions
A number of proteins appear to be sequestered in ataxin-7 containing inclusions in both the transfected cell lines and in human SCA7 brain (Table 1). CREB-binding protein (CBP) immunoreactivity, a transcriptional co-activator with 18 consecutive glutamines, was occasionally detected in inclusions in SH-SY5Y cells expressing ataxin-7
-100 (antibody C-20 worked best) and more frequently in the NIIs in the two SCA7 cases (Fig. 2Ch, antibody A-22). In a subset of ataxin-7
-100 nuclear inclusions in SH-SY5Y cells, p53 was either co-localized with, or formed a ring around the core of the inclusions; it often appeared trapped in the centre of an aggregate (Fig. 2Bjo).
|
Inclusions immunoreactive for proteasome subunits, 20S (Fig. 2Bac), ubiquitin and HDJ-2/Hsp-40 (Fig. 2Bgi) were abundant in cells transfected with truncated and full-length ataxin-7-100, suggesting an abnormal protein folding. Hsp-70 and 11S subunit immunoreactivity was less frequently observed. The 19S subunit was detected by western blot in cellular extracts, but could not be detected in inclusions in the transfected cells (data not shown). NIIs of SCA7 cases were ubiquitinated and frequently stained with antibodies against the HDJ-2 and 19S subunit (Fig. 2Cdg). However, they were not stained by antibodies against the 20S- and 11S-subunits or Hsp70 (Hsc70).
Activated caspase-3 was detected in a small population of the ataxin-7 inclusions in both HEK293 and SH-SY5Y cells (Fig. 2Bdf) and in the brain of SCA7 case 1 (Fig. 2Cil). In HEK293 cells expressing ataxin-7
-100-GFP, 11% of the inclusions were immunostained with the activated caspase-3 antibody (CM1) and in case 1, <2% of the NIIs were positive in the two brain areas (supramarginal and temporal cortex) examined.
In addition, the number of activated caspase-3 positive neurones in the two patients (temporal cortex) was much greater than in the control group (mean SCA7 cases: 54 ± 5.3 SD versus mean of the control group 8.0 ± 8.9 SD, Students t-test, P = 0.0012; Table 2).
|
Morphological changes in HEK293 cells might be related to the long-term toxicity of mutant ataxin-7
Nuclei with irregular shapes were often noted in transfected HEK293 cells containing inclusions of truncated or full-length ataxin-7-100 (Fig. 2Ac and i). However, nuclear fragmentation and apoptotic bodies were rare and were observed to the same extent in transfected and in non-transfected HEK293 and SH-SY5Y cells. Ultrastructural examination of HEK293 cells expressing ataxin-7
-100, frequently revealed marked nuclear indentations, sometimes associated with disruption of the nuclear membrane, common in cells with nuclear or perinuclear, fibrillar inclusions (Fig. 4). Fibrillary bundles that differed ultrastructurally from those containing ataxin-7 were found in the nucleus. They were reminiscent of the microfilaments (46 nm in diameter) often observed in the cytoplasm of normal HEK293 cells.
|
In the cytoplasm, the mitochondria appeared swollen, with more prominent cristae and enlarged intracristal spaces. The number of mitochondria was greater around the fibrillar inclusions. The endoplasmic reticulum was normally developed. The cisternae of the Golgi complex were abnormally enlarged and many autophagic vacuoles appeared in its proximity, as previously described (25). These endosomallysosomal structures were scattered throughout the cytoplasm, had single or double membranes, and contained multilamellar structures and electron dense granular material. The engulfed material was sometimes reminiscent of mitochondria or of a part of the cytoplasm. No fibrillar material that resembled the ataxin-7 inclusions was seen in these autophagosomes nor was any anti-ataxin-7 immunogold labelling detected in any of the organelles.
To determine whether the structural changes were induced by ataxin-7 related toxicity, a colony formation assay was performed. SH-SY5Y and HEK293 cells were transfected with various pCEP4 SCA7 constructs (Fig. 1A) harbouring the hygromycine B resistance gene. Following selection, there was an
1020-fold reduction in colony formation after introduction of SCA7
-100 compared to the empty vector, whereas SCA7
-10 showed only minor growth supression (
12-fold). Both mutant and wild-type full-length SCA7 constructs also showed substantial growth suppression at a similar level as the truncated mutant form, although they were expressed at a much lower level (Fig. 1B). This suggests that the full-length forms were more toxic. Flow cytometer analysis of the cell cycle after propidium iodide staining of the DNA, 48/72 h after transfection with a series of SCA7 GFP constructs in HEK293 cells, showed no significant perturbations of the cycle, indicating that the observed growth suppression is rather a long-term effect.
| DISCUSSION |
|---|
|
|
|---|
In HEK293 and SH-SY5Y cells transiently expressing tagged variants of SCA7, expanded ataxin-7 produces the morphological hallmarks of SCA7: fibrillar inclusions that recruit other proteins. The present study has increased our knowledge of the proteins recruited.
The truncated ataxin-7 variants harbouring an expanded polyglutamine tract are more prone to aggregation than the full-length protein, probably because of higher expression level and of the protein context as shown previously in an in vitro model of HD (16). Ultrastructural analysis of these inclusions revealed fibrillar structures resembling those in human SCA7 brain (9). The cellular inclusions were nuclear or perinuclear as reported in young SCA7 mice (26). In addition, the ultrastructural characteristics of these fibrils resembles those found in in vitro-produced polyglutamine aggregates, in HD brain and in mouse models (24). To our knowledge, the small isolated, electron dense ataxin-7 positive structures have not yet been described, and may be precursors of inclusions. The identity and the function of these structures remain obscure.
Full-length expanded ataxin-7 formed inclusions without evidence for cleavage in the cell model. However, in SCA7 cases, only few inclusions displayed C-terminal immunoreactivity, this suggests processing of the protein or masking of the epitope. A similar discrepancy was reported between HD-brain and HD-knock-in mice, in which the full-length huntingtin is detected in the NIIs (27).
We have also shown that normal ataxin-7 can be recruited into the cellular inclusions formed by the pathological protein. This suggests that C-terminal ataxin-7, occasionally detected in the brain inclusions, may belong to the normal form, not necessarily the mutant protein. Our finding of normal ataxin-3 sequestration both in the cell culture system as well as in the SCA7 brain further supports the idea that proteins harbouring short polyglutamine stretches or glutamine-rich regions can be incorporated into polyglutamine inclusions (2830). One such protein, the transcription factor CBP was detected in our study. Sequestration of this and similar proteins may contribute to the pathogenesis of polyglutamine diseases, as suggested in recent studies (reviewed in 2123,31). We detected more CBP positive inclusions in SCA7 human brain than in transfected SH-SY5Y cells, suggesting that recruitment of CBP could be time dependent.
Hsp40 (HDJ-2) and ubiquitin were also immunolabelled both in the ataxin-7 cells and in brain inclusions. Proteasome subunits were also detected: 20S and 11S in the cell lines and 19S in the brain. Our results are in accordance with observations on SCA7 transgenic mice, in which ubiquitin, HDJ-2, 19S-, 20S- and 11S-proteasome subunits were recruited into the inclusions (26). Our results indicate that the aggregated proteins in different cell types are recognized as abnormal, given the observed chaperone and proteasome recruitment. On the electron microscopy (EM) level, in degenerating cells, morphologically intact inclusions were noted, with preserved antigenicity towards ataxin-7. This could represent an aborted attempt to refold, disaggregate and/or degrade mutant proteins, in accordance with a dysfunction of the ubiquitinproteasome system as proposed in recent studies (3234). The p53 protein is a major intracellular regulator of cell division and apoptosis with finely tuned turnover secured by the proteasome. This protein was detected in inclusions in the SH-SY5Y cell line expressing ataxin-7
-100, with an intriguing entrapment pattern in some cells. Truncated huntingtin (htt) has also been reported to co-aggregate with p53 in inclusions generated in cell culture (35,36).
The pathways involved in cell death in human polyglutamine disease are still a matter of debate. The morphological study of the ataxin-7
-100 expressing cells with inclusions evokes the image of cells in distress, with swollen organelles and nuclear indentation, resembling the non-apoptotic changes described in R6 HD transgenic mice (37) preceding the nuclear condensation in the final stage before cell death. In human SCA7 brain, the conservation of the tissue did not permit detailed ultrastructural analysis of the cytoplasmic organelles. Signs of ongoing autophagocytosis in the cell cultures were noted. Marked indentations of the nuclear envelope and cytoplasmic vacuolization, which preceded death, have also been observed in a stable SCA3 cell model (38). Increased autophagic degradation has been proposed to explain cellular degeneration in HD cell models (39). Autophagy is specifically associated with type II, non-apoptotic programmed cell death (40), and increases when the proteasome is inhibited (41). Early stages of autophagy could be concomitant with activation of the apoptosis-associated protease caspase-3 that precedes cell death in some models (42,43).
The recruitment of activated caspase-3 into polyglutamine inclusions is observed for the first time. So far, only caspase-8 has been detected in polyglutamine inclusions in cell culture (44,45) and in the insoluble fraction of protein extracts from HD brain. Unprocessed caspase-3 was recently found in purified inclusions from polyglutamine expressing cells (36), but <1% of the intracellular stores were sequestered. Several studies have suggested that the activation of caspases is required for the induction of cell death by polyglutamine proteins (17,46). In a transgenic HD mouse model, expression of a dominant negative caspase-1 mutant extended the survival and delayed the appearance of symptoms (47) and Minocycline, which inhibits caspase-1 and caspase-3 expression, delayed mortality in a HD transgenic mouse model (48). The putative activation of a cell death pathway, suggested by the presence of active caspase-3 might be counterbalanced by regulation of survival promoting factors, such as Hsp70 (49). The caspases might in fact serve to remove condemned cells, as largely noted in the two SCA7 cases, where diffuse activated caspase-3 labelling was detected in
50% of the cortical neurones. This labelling cannot be taken as direct evidence of a cell death process which would have reached a level incompatible with the slow progression of the disease. It might be partially related to a greater sensitivity of SCA7 neurones than of control neurones to pre-mortem conditions. Even control no. 2, who died from low perfusion circulatory insufficiency, had only moderate activation of caspase-3 compared to both SCA7 cases.
The fibrillary inclusions were observed in degenerating as well as in dividing cells. This suggests that there is no close correlation between the fibrillary inclusions and short-term proliferation. The morphological alterations observed by EM were intimately associated with ataxin-7
-100 expressing cells as identified by an inclusion. These alterations could be early signs of distress appearing before cell death. There is also indirect evidence for long-term toxicity of ataxin-7
-100 revealed by the colony formation assay in SH-SY5Y and HEK293 cells. The observed growth suppression could be either a direct effect of mutant protein expression, indirectly related to the aggregationsequestration process, or most likely, a combination of the two. Normal full-length ataxin-7 appeared to be as harmful as the full-length mutant form. A similar finding was reported when the full-length SCA-1 gene was expressed in Drosophila and in the mouse, in which the toxicity was attributed to the high levels of expression (50).
In conclusion, our results highlight the similarities between the composition and structure of inclusions in SCA7 cell models and patients. In both cases, inclusions contained heat-shock proteins, elements of the ubiquitinproteasome system and proteins with polyglutamine stretches, including the transcription factor CBP. Differences in proteins present and their location in the inclusion, could be accounted for by differences in the time course of inclusion formation, their recruitment into the inclusions, their level of expression in various cell types or to antibody affinity. Activation of caspase-3 seems at present to be selective for SCA7 pathology. This activation might be associated with different pathways of cell death one being classical apoptosis, another autophagy (apoptosis type II). The morphological changes, especially the autophagocytosis, observed by EM, favours the latter mechanism.
| MATERIALS AND METHODS |
|---|
|
|
|---|
SCA7 constructs (Fig. 1A)
Full-length wild-type (10 CAG repeats) SCA7 cDNA (7) was cloned into pCEP4 (Invitrogen), after PCR amplification with primers containing the T7 promotor and 6-histidine for the 5' end and an E-tag (Amersham-Pharmacia) at the 3' end (primer 6-his, gatcgctagcttaatacgactcactatagggccatgcatcatcatcatcatcatatgtcggagcgggccgcggatgac; and primer E-tag, cagccaaaggcacgtcccaagcttggtgcgccggtgccgtatccggatccgctggaaccgcgttagcatgcgatc). The full-length mutant versions were generated by insertion of a 100 CAG cassette (15) into the original construct followed by PCR amplification adding a Ha-tag and the T7 promotor in the 5' end and a FLAG-tag at the 3' end (Eastman, Kodak), (primer Ha, gatcgctagcttaatacgactcactatagggccatgtatccatatgatgttccagattatgctatgtcggagcgggccgcggatgac; primer FLAG, cagccaaaggcacgtcccaagcttgactacaaggacgacgatgacaagtagcatgcgatc). The obtained constructs were truncated after amino acid 232 by digestion and then relegated after addition of a cassette with the appropriate restriction sites and the NLS derived from Sv40 (AAA AAG AAG AGA AAG GTA GAA). The truncation was done in order to assure a high level of expression and of inclusion formation. Full-length as well as truncated constructs were also subcloned in pEGFP-N1 (Clonetech) after elimination of the 3-tags. All constructs obtained by PCR were verified by DNA sequencing and the size of the protein was confirmed both by in vitro transcription/translation (TNT, Promega) according to the manufacturers protocol and by western blot.
Cell lines/transfections
Human embryonic kidney, HEK293 cells and SH-SY5Y (third generation subclone of SK-NSH, a human neuroblastoma (51) were propagated in MEM with 7.5% fetal calf serum and DMEM with 10% fetal calf serum, 1 mM glutamine, respectively. All media compounds were purchased from Life Technologies. Cells were plated 24 h before transfection on cover slips coated with poly-L-ornithine (Sigma) for HEK293 or collagene (Sigma) for SH-SY5Y, or directly in the uncoated Petri dishes for protein extraction. Transfections were carried out with Dmrie-C liposomes (Life Technologies) for 5 h according to the manufacturers recommendations.
Immunofluoresence/microscopy
Cells were fixed for 20 min in 4% paraformaldehyde (PFA) 24, 48 and 72 h after transfection. Cells were then washed in PBS, incubated in 50 mM NH4Cl and permeabilized with 0.1% Triton X-100 (in PBS) for 10 min. After blocking in PBS 0.1% BSA, cells were incubated with the primary antibody overnight at 4°C and then with the appropriate secondary antibody (anti-rabbit or anti-mouse Cy3, Jackson Immunoresearch or Alexa green, Molecular Probes). The preparations were counterstained with Hoechst 33258, Sigma (5 µg/ml) for 10 min. Coverslips were mounted with Mowiol (Calbiochem). The localization of the various ataxin-7 constructs, GFP-fusions or pCEP4, was observed directly (GFP) or after immunolabelling with either anti-tag and/or anti-SCA7 antibodies, using a Zeiss microscope equipped with a video camera. The localization was scored in a total of at least 100 cells, in captured random fields, as either cytoplasmic/nucleo-cytoplasmic or purely nuclear. In addition, the number of cells harbouring inclusions was counted. The experiments were repeated at least twice. All localizations were confirmed by confocal microscopy (Leica TCS SP2). Antibody dilutions are listed in Table 3.
|
The frequency of recruitment of caspase-3 into ataxin-7
-100-GFP inclusions was estimated by counting the number of inclusions containing activated caspase-3 (CM1) among 100 inclusions selected at random. Two independent experiments were performed in HEK293 cells fixed 48 h after transfection. Observations were made by confocal microscopy.
EM
HEK-293 cells expressing ataxin-7
-10/100-GFP and non-transfected control cells were analysed by transmission EM. The cells were fixed for 30 min, 48 h after transfection, with 2% PFA and 0.1% glutaraldehyde in 0.1 M phosphate buffer (pH 7.6), post-fixed for 30 min in 1% osmium tetroxyde, dehydrated and embedded in Araldite resin (Ernest F.Fullham). Immunogold labelling of ataxin-7 was performed on ultra-thin sections with the 1C1 antibody (1/1000) as previously described (52).
Cell cycle analysis
HEK 293 cells transfected (as above) with the series of SCA7-GFP constructs, were trypsinized, washed in PBS, pre-fixed in cold 1.5% PFA, washed again and then fixed with 70% ethanol for 30 min on ice. The cells were washed and resuspended in PBS containing 10 µg/ml propidium iodide and DNAse-free RNAse A (100 µg/ml) and finally stored on ice until analysis. The samples were analysed with a FACScan flow cytometer (Elite ESP, Beckman-Coulter). The MulticycleTM software was used for interpretation of DNA ploidy and delineation of cell cycle compartments.
Cell growth arrest assay
Long-term transfections for cell growth arrest assay were performed as described by Ory et al. (53). Briefly, HEK293 and SH-SY5Y cells were seeded on day 1, transfected with the series of SCA7 pCEP4 constructs (Fig. 1A) or the empty vector on day 2. The following day, cells were harvested and equal cell numbers were plated in three six-well plates. On day 4, 0.1 mg/ml hygromycine (Life Technologies) was added. After 34 weeks, the emerging colonies were fixed in methanol, stained with Giemsa and counted.
NII in SCA7: brain samples and immunohistochemistry
Patient 1: SCA7 in a 10-year-old child with an 85 CAG repeat expansion who died after 5 years of evolution, described by Holmberg et al. (54). Patient 2: SCA7 in a 36-year-old adult with a 49 CAG repeat expansion who died of intercurrent disease and pancreatitis, after 14 years of disease evolution (a detailed description will be presented elsewhere).
Samples of brain temporal, supramarginal and/or motor cortex were obtained postmortem from the two SCA7 cases. Formalin fixed paraffin embedded tissue was cut into 5 µm sections. Immunohistochemistry and double immunofluorescence were performed as previously described (15). For double immunolabelling of N-terminal ataxin-7 (1C1) and activated caspase-3 (CM1), 1C1 was directly labelled with FITC and the CM1 antibody was immunofluorolabelled by streptavidin-conjugated Cy-3, after signal amplification with biotinylated tyramide. The slides were examined with a Leica TCS 4D confocal microscope.
Quantification of activated caspase-3 in neurones
Five micron sections of temporal cortex from the two SCA7 cases and five normal control cases (Table 2) were immunostained with the anti-activated caspase-3 antibody (CM1), using diaminobenzidine (DAB) as the chromogen. An evaluation of the proportion of neurones displaying activated caspase-3 was estimated in a population of 100 neurones from the temporal cortex. The disector method (55) was used to count the number of labelled and unlabelled neurons in the two SCA7 cases and in the five controls. Students t-test was calculated using the BPMD NS version 1.1 software.
To estimate frequency of recruitment of caspase-3 into NIIs, sections of supramarginal and temporal cortex from case 1 were double immunolabeled with the CM1 and 1C1 antibodies. CM1 and 1C1 labelling were revealed with DAB and FITC, respectively. The sections were examined using a microscope equipped with a system for fluorescence (Olympus BX50). More than 100 NIIs positive for 1C1 were examined for co-localization to the same NIIs.
Western blot analysis
Cells were lysed, 48 h after transfection, in RIPA buffer (10 mM TrisHCl pH 8.0, 150 mM NaCl, 1 mM EDTA, 1% NP40, 0.5% sodium deoxycholic acid) with a cocktail of protease inhibitors (CompleteTM and 1 µg/ml pepstatin; Roche) for 30 min at 4°C. Equal amounts of sample lysates were separated by SDSPAGE and eletrophoretically transferred onto nitrocellulose membranes (Schleicher and Schuell). The membranes were blocked with 5% non-fat milk PBS, 0.2% Tween 20, then incubated with the primary antibody at 4°C overnight followed by the appropriate secondary antibody. Immunoreactivity was revealed using the chemoluminescence kits (Super Signal; Pierce).
| ACKNOWLEDGEMENTS |
|---|
We thank Merle Ruberg for fruitful discussions and critical reading of the manuscript; Marie-Claude Gendron at Institut Jacques Monod, Paris, France for help with cell cycle analysis; D.Lecren, for iconographic assistance; G.Yvert, Y.Trottier and J.L.Mandel, INSERM U189, Illkirch, France for the generous gifts of the 1C1, 1261, 1598 and 2B6 antibodies; Nicole Faucon-Biguet and Jacques Mallet (CNRS UMR 9923) for laboratory hospitality. C.Z. is grateful to T.Soussi (Institut Curie, Paris, France) for helpful discussions, laboratory hospitality and the kind gift of materials. This study was supported by funds from the Verum Foundation, Association Française Contre les Myopathies (AFM) and INSERM. C.Z. was supported by fellowships from Association Française de Recherche Contre le Cancer (ARC), Association Huntington France and the Karolinska Institute.
| FOOTNOTES |
|---|
+ To whom correspondence should be addressed. Tel: +33 1 42 16 21 82; Fax: +33 1 44 24 36 58; Email: brice@ccr.jussieu.frPresent address:V. Albanese, University of Stanford, Stanford, CA 94305-5020, USA
| REFERENCES |
|---|
|
|
|---|
1 Zoghbi, H.Y. and Orr, H.T. (2000) Glutamine repeats and neurodegeneration. Annu. Rev. Neurosci., 23, 217247.[Web of Science][Medline]
2 Zuhlke, C., Hellenbroich, Y., Dalski, A., Kononowa, N., Hagenah, J., Vieregge, P., Riess, O., Klein, C. and Schwinger, E. (2001) Different types of repeat expansion in the TATA-binding protein gene are associated with a new form of inherited ataxia. Eur. J. Hum. Genet., 9, 160164.[Web of Science][Medline]
3 Fujigasaki, H., Martin, J.J., De Deyn, P.P., Camuzat, A., Deffond, D., Stevanin, G., Dermaut, B., Van Broeckhoven, C., Durr, A. and Brice, A. (2001) CAG repeat expansion in the TBP gene causes autosomal dominant cerebellar ataxia. Brain, 124, 19391947.
4 Nakamura, K., Jeong, S.Y., Uchihara, T., Anno, M., Nagashima, K., Nagashima, T., Ikeda Si, S., Tsuji, S. and Kanazawa, I. (2001) SCA17, a novel autosomal dominant cerebellar ataxia caused by an expanded polyglutamine in TATA-binding protein. Hum. Mol. Genet., 10, 14411448.
5 Koide, R., Kobayashi, S., Shimohata, T., Ikeuchi, T., Maruyama, M., Saito, M., Yamada, M., Takahashi, H. and Tsuji, S. (1999) A neurological disease caused by an expanded CAG trinucleotide repeat in the TATA-binding protein gene: a new polyglutamine disease? Hum. Mol. Genet., 8, 20472053.
6 Stevanin, G., Durr, A. and Brice, A. (2000) Clinical and molecular advances in autosomal dominant cerebellar ataxias: from genotype to phenotype and physiopathology. Eur. J. Hum. Genet., 8, 418.[Web of Science][Medline]
7 David, G., Abbas, N., Stevanin, G., Durr, A., Yvert, G., Cancel, G., Weber, C., Imbert, G., Saudou, F., Antoniou, E. et al. (1997) Cloning of the SCA7 gene reveals a highly unstable CAG repeat expansion. Nat. Genet., 17, 6570.[Web of Science][Medline]
8 Michalik, A., Del-Favero, J., Mauger, C., Lofgren, A. and Van Broeckhoven, C. (1999) Genomic organisation of the spinocerebellar ataxia type 7 (SCA7) gene responsible for autosomal dominant cerebellar ataxia with retinal degeneration. Hum. Genet., 105, 410417.[Web of Science][Medline]
9 Mauger, C., Del-Favero, J., Ceuterick, C., Lubke, U., van Broeckhoven, C. and Martin, J. (1999) Identification and localization of ataxin-7 in brain and retina of a patient with cerebellar ataxia type II using anti-peptide antibody. Brain Res. Mol. Brain Res., 74, 3543.[Medline]
10 Cancel, G., Duyckaerts, C., Holmberg, M., Zander, C., Yvert, G., Lebre, A.S., Ruberg, M., Faucheux, B., Agid, Y., Hirsch, E. et al. (2000) Distribution of ataxin-7 in normal human brain and retina. Brain, 123, 2051920530.
11 Einum, D.D., Townsend, J.J., Ptacek, L.J. and Fu, Y.H. (2001) Ataxin-7 expression analysis in controls and spinocerebellar ataxia type 7 patients. Neurogenetics, 3, 8390.[Web of Science][Medline]
12 Lindenberg, K.S., Yvert, G., Muller, K. and Landwehrmeyer, G.B. (2000) Expression analysis of ataxin-7 mRNA and protein in human brain: evidence for a widespread distribution and focal protein accumulation. Brain Pathol., 10, 385394.[Web of Science][Medline]
13 Kaytor, M.D., Duvick, L.A., Skinner, P.J., Koob, M.D., Ranum, L.P. and Orr, H.T. (1999) Nuclear localization of the spinocerebellar ataxia type 7 protein, ataxin-7. Hum. Mol. Genet., 8, 16571664.
14 Mushegian, A.R., Vishnivetskiy, S.A. and Gurevich, V.V. (2000) Conserved phosphoprotein interaction motif is functionally interchangeable between ataxin-7 and arrestins. Biochemistry, 39, 68096813.[Medline]
15 Lebre, A.S., Jamot, L., Takahashi, J., Spassky, N., Leprince, C., Ravise, N., Zander, C., Fujigasaki, H., Kussel-Andermann, P., Duyckaerts, C. et al. (2001) Ataxin-7 interacts with a Cbl-associated protein that it recruits into neuronal intranuclear inclusions. Hum. Mol. Genet., 10, 12011213.
16 Scherzinger, E., Lurz, R., Turmaine, M., Mangiarini, L., Hollenbach, B., Hasenbank, R., Bates, G.P., Davies, S.W., Lehrach, H. and Wanker, E.E. (1997) Huntingtin-encoded polyglutamine expansions form amyloid-like protein aggregates in vitro and in vivo. Cell, 90, 549558.[Web of Science][Medline]
17 Evert, B.O., Wullner, U. and Klockgether, T. (2000) Cell death in polyglutamine diseases. Cell Tissue Res., 301, 189204.[Web of Science][Medline]
18 Klement, I.A., Skinner, P.J., Kaytor, M.D., Yi, H., Hersch, S.M., Clark, H.B., Zoghbi, H.Y. and Orr, H.T. (1998) Ataxin-1 nuclear localization and aggregation: role in polyglutamine-induced disease in SCA1 transgenic mice. Cell, 95, 4153.[Web of Science][Medline]
19 Sisodia, S.S. (1998) Nuclear inclusions in glutamine repeat disorders: are they pernicious, coincidental, or beneficial? Cell, 95, 14.[Web of Science][Medline]
20 Saudou, F., Finkbeiner, S., Devys, D. and Greenberg, M.E. (1998) Huntingtin acts in the nucleus to induce apoptosis but death does not correlate with the formation of intranuclear inclusions. Cell, 95, 5566.[Web of Science][Medline]
21 Osborne, L.R. (2000) Polyglutamine stretches suppress transcription. Mol. Med. Today, 6, 457458.
22 Sieradzan, K.A. and Mann, D.M. (2001) The selective vulnerability of nerve cells in Huntingtons disease. Neuropathol. Appl. Neurobiol., 27, 121.[Web of Science][Medline]
23 McCampbell, A. and Fischbeck, K.H. (2001) Polyglutamine and CBP: fatal attraction? Nat. Med., 7, 528530.[Web of Science][Medline]
24 Wanker, E.E. (2000) Protein aggregation and pathogenesis of Huntingtons disease: mechanisms and correlations. Biol. Chem., 381, 937942.[Web of Science][Medline]
25 Dunn, W.A.,Jr (1990) Studies on the mechanisms of autophagy: formation of the autophagic vacuole. J. Cell Biol., 110, 19231933.
26 Yvert, G., Lindenberg, K.S., Picaud, S., Landwehrmeyer, G.B., Sahel, J.A. and Mandel, J.L. (2000) Expanded polyglutamines induce neurodegeneration and trans-neuronal alterations in cerebellum and retina of SCA7 transgenic mice. Hum. Mol. Genet., 9, 24912506.
27 Wheeler, V.C., White, J.K., Gutekunst, C.A., Vrbanac, V., Weaver, M., Li, X.J., Li, S.H., Yi, H., Vonsattel, J.P., Gusella, J.F. et al. (2000) Long glutamine tracts cause nuclear localization of a novel form of huntingtin in medium spiny striatal neurons in HdhQ92 and HdhQ111 knock-in mice. Hum. Mol. Genet., 9, 503513.
28 Satyal, S.H., Schmidt, E., Kitagawa, K., Sondheimer, N., Lindquist, S., Kramer, J.M. and Morimoto, R.I. (2000) Polyglutamine aggregates alter protein folding homeostasis in Caenorhabditis elegans. Proc. Natl Acad. Sci. USA, 97, 57505755.
29 Kazantsev, A., Preisinger, E., Dranovsky, A., Goldgaber, D. and Housman, D. (1999) Insoluble detergent-resistant aggregates form between pathological and nonpathological lengths of polyglutamine in mammalian cells. Proc. Natl Acad. Sci. USA, 96, 1140411409.
30 Perez, M.K., Paulson, H.L., Pendse, S.J., Saionz, S.J., Bonini, N.M. and Pittman, R.N. (1998) Recruitment and the role of nuclear localization in polyglutamine-mediated aggregation. J. Cell Biol., 143, 14571470.
31 Cha, J.H.J. (2000) Transcriptional dysregulation in Huntingtons disease. Trends Neurosci., 23, 387392.[Web of Science][Medline]
32 Bence, N.F., Sampat, R.M. and Kopito, R.R. (2001) Impairment of the ubiquitin-proteasome system by protein aggregation. Science, 292, 15521555.
33 Waelter, S., Boeddrich, A., Lurz, R., Scherzinger, E., Lueder, G., Lehrach, H. and Wanker, E.E. (2001) Accumulation of mutant huntingtin fragments in aggresome-like inclusion bodies as a result of insufficient protein degradation. Mol. Biol. Cell, 12, 13931407.
34 Jana, N.R., Zemskov, E.A., Wang, G. and Nukina, N. (2001) Altered proteasomal function due to the expression of polyglutamine-expanded truncated N-terminal huntingtin induces apoptosis by caspase activation through mitochondrial cytochrome c release. Hum. Mol. Genet., 10, 10491059.
35 Steffan, J.S., Kazantsev, A., Spasic-Boskovic, O., Greenwald, M., Zhu, Y.Z., Gohler, H., Wanker, E.E., Bates, G.P., Housman, D.E. and Thompson, L.M. (2000) The Huntingtons disease protein interacts with p53 and CREB-binding protein and represses transcription. Proc. Natl Acad. Sci. USA, 97, 67636768.
36 Suhr, S.T., Senut, M.C., Whitelegge, J.P., Faull, K.F., Cuizon, D.B. and Gage, F.H. (2001) Identities of sequestered proteins in aggregates from cells with induced polyglutamine expression. J. Cell Biol., 153, 283294.
37 Turmaine, M., Raza, A., Mahal, A., Mangiarini, L., Bates, G.P. and Davies, S.W. (2000) Nonapoptotic neurodegeneration in a transgenic mouse model of Huntingtons disease. Proc. Natl Acad. Sci. USA, 97, 80938097.
38 Evert, B.O., Wullner, U., Schulz, J.B., Weller, M., Groscurth, P., Trottier, Y., Brice, A. and Klockgether, T. (1999) High level expression of expanded full-length ataxin-3 in vitro causes cell death and formation of intranuclear inclusions in neuronal cells. Hum. Mol. Genet., 8, 11691176.
39 Kegel, K.B., Kim, M., Sapp, E., McIntyre, C., Castano, J.G., Aronin, N. and DiFiglia, M. (2000) Huntingtin expression stimulates endosomal- lysosomal activity, endosome tubulation and autophagy. J. Neurosci., 20, 72687278.
40 Klionsky, D.J. and Emr, S.D. (2000) Autophagy as a regulated pathway of cellular degradation. Science, 290, 17171721.
41 Kopito, R.R. (2000) Aggresomes, inclusion bodies and protein aggregation. Trends Cell Biol., 10, 524530.[Web of Science][Medline]
42 Xue, L., Fletcher, G.C. and Tolkovsky, A.M. (1999) Autophagy is activated by apoptotic signalling in sympathetic neurons: an alternative mechanism of death execution. Mol. Cell. Neurosci., 14, 180198.[Web of Science][Medline]
43 Jia, L., Dourmashkin, R.R., Allen, P.D., Gray, A.B., Newland, A.C. and Kelsey, S.M. (1997) Inhibition of autophagy abrogates tumour necrosis factor
induced apoptosis in human T-lymphoblastic leukaemic cells. Br. J. Haematol., 98, 673685.[Web of Science][Medline]
44 Sanchez, I., Xu, C.J., Juo, P., Kakizaka, A., Blenis, J. and Yuan, J. (1999) Caspase-8 is required for cell death induced by expanded polyglutamine repeats. Neuron, 22, 623633.[Web of Science][Medline]
45 Kouroku, Y., Fujita, E., Jimbo, A., Mukasa, T., Tsuru, T., Momoi, M.Y. and Momoi, T. (2000) Localization of active form of caspase-8 in mouse L929 cells induced by TNF treatment and polyglutamine aggregates. Biochem. Biophys. Res. Commun., 270, 972977.[Web of Science][Medline]
46 Wellington, C.L. and Hayden, M.R. (2000) Caspases and neurodegeneration: on the cutting edge of new therapeutic approaches. Clin. Genet., 57, 110.[Web of Science][Medline]
47 Ona, V.O., Li, M., Vonsattel, J.P., Andrews, L.J., Khan, S.Q., Chung, W.M., Frey, A.S., Menon, A.S., Li, X.J., Stieg, P.E. et al. (1999) Inhibition of caspase-1 slows disease progression in a mouse model of Huntingtons disease. Nature, 399, 263267.[Medline]
48 Chen, M., Ona, V.O., Li, M., Ferrante, R.J., Fink, K.B., Zhu, S., Bian, J., Guo, L., Farrell, L.A., Hersch, S.M. et al. (2000) Minocycline inhibits caspase-1 and caspase-3 expression and delays mortality in a transgenic mouse model of Huntington disease. Nat. Med., 6, 797801.[Web of Science][Medline]
49 Beere, H.M. and Green, D.R. (2001) Stress managementheat shock protein-70 and the regulation of apoptosis. Trends Cell Biol., 11, 610.[Web of Science][Medline]
50 Fernandez-Funez, P., Nino-Rosales, M.L., de Gouyon, B., She, W.C., Luchak, J.M., Martinez, P., Turiegano, E., Benito, J., Capovilla, M., Skinner, P.J. et al. (2000) Identification of genes that modify ataxin-1-induced neurodegeneration. Nature, 408, 101106.[Medline]
51 Biedler, J.L., Helson, L. and Spengler, B.A. (1973) Morphology and growth, tumorigenicity and cytogenetics of human neuroblastoma cells in continuous culture. Cancer Res., 33, 26432652.
52 El Hachimi, K.H., Verga, L., Giaccone, G., Tagliavini, F., Frangione, B., Bugiani, O. and Foncin, J.F. (1991) Relationship between non-fibrillary amyloid precursors and cell processes in the cortical neuropil of Alzheimer patients. Neurosci. Lett., 129, 119122.[Web of Science][Medline]
53 Ory, K., Legros, Y., Auguin, C. and Soussi, T. (1994) Analysis of the most representative tumour-derived p53 mutants reveals that changes in protein conformation are not correlated with loss of transactivation or inhibition of cell proliferation. EMBO J., 13, 34963504.[Web of Science][Medline]
54 Holmberg, M., Duyckaerts, C., Durr, A., Cancel, G., Gourfinkel-An, I., Damier, P., Faucheux, B., Trottier, Y., Hirsch, E.C., Agid, Y. et al. (1998) Spinocerebellar ataxia type 7 (SCA7): a neurodegenerative disorder with neuronal intranuclear inclusions. Hum. Mol. Genet., 7, 913918.
55 Sterio, D.C. (1984) The unbiased estimation of number and sizes of arbitrary particles using the disector. J. Microsci., 134, 127136.
56 Fujigasaki, H., Uchihara, T., Koyano, S., Iwabuchi, K., Yagishita, S., Makifuchi, T., Nakamura, A., Ishida, K., Toru, S., Hirai, S. et al. (2000) Ataxin-3 is translocated into the nucleus for the formation of intranuclear inclusions in normal and Machado-Joseph disease brains. Exp. Neurol., 165, 248256.[Web of Science][Medline]
57 Trottier, Y., Cancel, G., AnGourfinkel, I., Lutz, Y., Weber, C., Brice, A., Hirsch, E. and Mandel, J.L. (1998) Heterogeneous intracellular localization and expression of ataxin-3. Neurobiol. Dis., 5, 335347.[Web of Science][Medline]
58 Vojtesek, B., Bartek, J., Midgley, C.A. and Lane, D.P. (1992) An immunochemical analysis of the human nuclear phosphoprotein-p53new monoclonal antibodies and epitope mapping using recombinant-p53. J. Immunol. Methods, 151, 237244.[Web of Science][Medline]
59 Srinivasan, A., Roth, K.A., Sayers, R.O., Shindler, K.S., Wong, A.M., Fritz, L.C. and Tomaselli, K.J. (1998) In situ immunodetection of activated caspase-3 in apoptotic neurons in the developing nervous system. Cell Death Different., 5, 10041016.[Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
J. E. Young, L. Gouw, S. Propp, B. L. Sopher, J. Taylor, A. Lin, E. Hermel, A. Logvinova, S. F. Chen, S. Chen, et al. Proteolytic Cleavage of Ataxin-7 by Caspase-7 Modulates Cellular Toxicity and Transcriptional Dysregulation J. Biol. Chem., October 12, 2007; 282(41): 30150 - 30160. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Latouche, C. Lasbleiz, E. Martin, V. Monnier, T. Debeir, A. Mouatt-Prigent, M.-P. Muriel, L. Morel, M. Ruberg, A. Brice, et al. A Conditional Pan-Neuronal Drosophila Model of Spinocerebellar Ataxia 7 with a Reversible Adult Phenotype Suitable for Identifying Modifier Genes J. Neurosci., March 7, 2007; 27(10): 2483 - 2492. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Janer, E. Martin, M.-P. Muriel, M. Latouche, H. Fujigasaki, M. Ruberg, A. Brice, Y. Trottier, and A. Sittler PML clastosomes prevent nuclear accumulation of mutant ataxin-7 and other polyglutamine proteins J. Cell Biol., July 3, 2006; 174(1): 65 - 76. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Taylor, S. K. Grote, J. Xia, M. Vandelft, J. Graczyk, L. M. Ellerby, A. R. La Spada, and R. Truant Ataxin-7 Can Export from the Nucleus via a Conserved Exportin-dependent Signal J. Biol. Chem., February 3, 2006; 281(5): 2730 - 2739. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Helmlinger, J. Bonnet, J.-L. Mandel, Y. Trottier, and D. Devys Hsp70 and Hsp40 Chaperones Do Not Modulate Retinal Phenotype in SCA7 Mice J. Biol. Chem., December 31, 2004; 279(53): 55969 - 55977. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. K. M. Chow, A. M. Ellisdon, L. D. Cabrita, and S. P. Bottomley Polyglutamine Expansion in Ataxin-3 Does Not Affect Protein Stability: IMPLICATIONS FOR MISFOLDING AND DISEASE J. Biol. Chem., November 12, 2004; 279(46): 47643 - 47651. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Everett and N. W. Wood Trinucleotide repeats and neurodegenerative disease Brain, November 1, 2004; 127(11): 2385 - 2405. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Bruni, J. Takahashi-Fujigasaki, F. Maltecca, J. F. Foncin, A. Servadio, G. Casari, P. D'Adamo, R. Maletta, S. A. M. Curcio, G. De Michele, et al. Behavioral Disorder, Dementia, Ataxia, and Rigidity in a Large Family With TATA Box-Binding Protein Mutation Arch Neurol, August 1, 2004; 61(8): 1314 - 1320. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Adachi, M. Katsuno, M. Minamiyama, C. Sang, G. Pagoulatos, C. Angelidis, M. Kusakabe, A. Yoshiki, Y. Kobayashi, M. Doyu, et al. Heat Shock Protein 70 Chaperone Overexpression Ameliorates Phenotypes of the Spinal and Bulbar Muscular Atrophy Transgenic Mouse Model by Reducing Nuclear-Localized Mutant Androgen Receptor Protein J. Neurosci., March 15, 2003; 23(6): 2203 - 2211. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Takahashi, H. Fujigasaki, C. Zander, K. H. El Hachimi, G. Stevanin, A. Durr, A.-S. Lebre, G. Yvert, Y. Trottier, H. d. The, et al. Two populations of neuronal intranuclear inclusions in SCA7 differ in size and promyelocytic leukaemia protein content Brain, July 1, 2002; 125(7): 1534 - 1543. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Garden, R. T. Libby, Y.-H. Fu, Y. Kinoshita, J. Huang, D. E. Possin, A. C. Smith, R. A. Martinez, G. C. Fine, S. K. Grote, et al. Polyglutamine-Expanded Ataxin-7 Promotes Non-Cell-Autonomous Purkinje Cell Degeneration and Displays Proteolytic Cleavage in Ataxic Transgenic Mice J. Neurosci., June 15, 2002; 22(12): 4897 - 4905. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








