Human Molecular Genetics, 2001, Vol. 10, No. 23 2679-2686
© 2001 Oxford University Press
A deep intronic mutation in CDKN2A is associated with disease in a subset of melanoma pedigrees
Genetic Epidemiology Division, ICRF Clinical Centre in Leeds, St James’s University Hospital, Beckett Street, Leeds LS9 7TF, UK
Received July 18, 2001; Revised and Accepted September 3, 2001.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Germline mutations of CDKN2A at 9p21 have been shown to predispose to disease in melanoma pedigrees worldwide. However, there remains a significant proportion of melanoma pedigrees with evidence of linkage to 9p21 in which mutations in CDKN2A have not been detected. Investigation of other potential tumour suppressor genes at 9p21 and the promotor of CDKN2A has been unable to explain genetic predisposition to melanoma in these pedigrees. Here we describe a mutation, IVS2-105 A/G, deep in intron 2 of CDKN2A, detected in six English melanoma pedigrees. The mutation creates a false GT splice donor site 105 bases 5' of exon 3 and has been demonstrated to result in aberrant splicing of the mRNA. This is the most common mutation identified in English families to date. The presence of this deep intronic mutation in a relatively large number of kindreds, indicates that it may account for a significant proportion of 9p21-linked melanoma pedigrees with no detectable mutations in the coding region of CDKN2A. In addition, the identification of one deep intronic mutation in CDKN2A indicates the possibility of the existence of other similar splicing mutations located elsewhere in the CDKN2A introns.
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Germline mutations of the CDKN2A gene at chromosome 9p21 have been shown to predispose to melanoma in pedigrees worldwide (1–5). CDKN2A acts through the retinoblastoma pathway. It encodes the p16 protein which binds to the cyclin dependant kinases, CDK4 and CDK6, to inhibit their ability to phosphorylate the retinoblastoma protein and thereby controls passage through the G1 checkpoint of the cell cycle (6).
However, the proportion of melanoma families with identified mutations in CDKN2A remains moderate, representing 
25% of pedigrees with two or more cases overall (7). Some pedigrees, which show evidence of linkage to chromosome 9p21, do not appear to have detectable mutations in the coding region of CDKN2A (8).
Linkage to 9p21 markers in a number of CDKN2A negative families has led to the investigation of other candidate melanoma suseptibility genes at 9p21. CDKN2B which encodes the p15 protein, and the gene encoding p14ARF have been investigated as potential genes for predisposition to melanoma. CDKN2B has been excluded as a candidate due to the lack of germline mutations detected in melanoma kindreds (9–12), and to date only two melanoma kindreds have been shown to have disease associated abnormalities of p14ARF that do not also affect CDKN2A (13,14).
The CDKN2A promoter region has also been screened to investigate the possibility that non-coding mutations in CDKN2A might predispose an individual to melanoma. A subset of melanoma pedigrees was found to have a G
T transversion at base –34 of CDKN2A which creates a novel AUG translation initiation site (15,16). Although this mutation in the 5'-UTR accounts for a proportion of 9p21-linked pedigrees with no detectable coding mutations of CDKN2A, no true promoter mutations have been found (16). There remain a significant number of melanoma kindreds where the cause of predisposition to disease remains unidentified.
We describe the identification and characterization of a deep intronic mutation in a subset of UK melanoma pedigrees with no detectable mutations in the coding region of CDKN2A.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
An A
G transversion in intron 2, 105 bases 5' of exon 3, IVS2-105 A/G, was initially detected in two melanoma pedigrees during the course of routine screening by sequencing for mutations of the CDKN2A gene (Fig. 1).
|
The nucleotide change occurs one base after the 3' end of the forward primer used to amplify exon 3 of CDKN2A (p16 3F). The variant was not observed when sequencing using the forward primer because of its proximity to the priming site. The base change was detected when sequencing initiated from the reverse primer (p16 3R) was of sufficient quality to read all the way through to the forward primer.
A simple allele-specific PCR test was devised to facilitate detection of the variant. This test was used to screen 42 English pedigrees with three or more cases of melanoma, 16 of which had previously been shown to harbour mutations of CDKN2A (8,16,17). An additional 64 kindreds with two cases of melanoma, including six with previously identified CDKN2A mutations (8,16,17), were also screened for IVS2-105. The intronic variant was detected in four kindreds with three or more cases of melanoma and in two kindreds with two cases of melanoma. None of the six pedigrees in which IVS2-105 was detected had previously been found to harbour CDKN2A coding or promoter mutations (Table 1).
|
The presence of the IVS2-105 variant was confirmed by the sequencing of CDKN2A intron 2. All samples identified by allele-specific PCR as carrying the IVS2-105 mutation, plus an additional four spouse control DNA samples, were sequenced. In each instance three homozygous differences from the intron sequence recorded in the Genome Data Base (accession no. AC000048) were identified. Differences were observed at IVS2+474 (T rather than C), at IVS2+1074 (C rather than T) and at IVS2-115 (within the binding site for primer p16 3F), where a run of only two adenosine residues was seen rather than three as indicated in GenBank. The heterozygous IVS2-105 A/G variant was the only difference identified between the melanoma cases and the spouse control samples in CDKN2A intron 2.
Analysis of all available samples from the six pedigrees, by allele-specific PCR, showed that the intronic variant segregated with melanoma (Fig. 2). In addition to the six melanoma cases in which the IVS2-105 variant was initially identified, four affected relatives of probands were proven to be carriers. Haplotyping data indicated that a further four affected relatives carried the IVS2-105 variant. In the remaining seven melanoma cases where DNA was not available, carrier status could not be determined from haplotying data. Linkage analysis gave a LOD score of 1.06 for tight linkage indicative of strong evidence of co-segregation between a chromosome 9p mutation and IVS2-105 A/G in these families.
|
The intronic variant was not detected in a panel of 100 control DNAs investigated using the allele-specific PCR test.
Haplotyping studies revealed that a conserved region of chromosome 9p21 adjacent to CDKN2A was shared between the pedigrees with the intron 2 variant. All six pedigrees appear to share the same 9p21 haplotype from D9S 976 to D9S 975, with the exception of markers D9S 1749 and D9S 942 (Fig. 3). The discrepant alleles at these markers may have arisen through separate slippage or conversion events. In view of the heterozygosity of the alleles these results indicate the likelihood that the IVS2-105 variant may have arisen from a common ancestor of these English families.
|
The intronic variant appeared to create a false splice donor site in intron 2 of CDKN2A; AT
GT at –105 bases from exon 3. The sequence surrounding the base change was found to match the splice donor site consensus sequence (18). Using the scoring system developed to determine the probability that a particular splice donor or acceptor sequence would be functional (19), this newly created site was found to score 0.95 (the true splice donor site at IVS2+1 scores 1.0) and was therefore predicted to be functional. To investigate the potential effect of the intron 2 variant on mRNA transcription, cDNA was synthesized from a B-lymphoblastoid cell line, previously established from individual 095F, pedigree MEL 6, known to harbour the intronic variant at IVS2-105.
PCR reactions across intron 2 of CDKN2A were carried out using three different forward primers designed from the CDKN2A exonic sequence, RT 1F, RT1/2F and RT 2F, together with a reverse primer, RT 3R, in the 3'-untranslated region (3'-UTR). Initial PCR reactions of the 095F cell line cDNA produced bands of approximately the size expected for wild-type mRNA transcript (Fig. 4). This was confirmed when the bands were gel purified and sequenced. No aberrantly spliced transcript was detected.
|
However, the band amplified from the 095F cell line cDNA appeared to be approximately half as intense as those produced from the control cell line cDNAs, HT1197 and BC609(+), which were known to possess two copies of CDKN2A. The control PCR reaction, using primers for the GAPDH house-keeping gene, produced bands of equal intensity with all cDNA samples. This indicated the possibility that for sample 095F only the CDKN2A wild-type allele had been amplified by PCR, and that the mRNA transcript from the allele with the intron 2 variant had not been detected.
To address the possibility that an aberrantly spliced transcript may have been too large to detect by conventional PCR, we carried out a long-range PCR on the 095F cDNA using the forward primer RT 1/2F. This primer spans exons 1 and 2, and would therefore be unable to amplify genomic DNA or unprocessed RNA.
In addition to the expected 400 bp wild-type band, long-range PCR of 095F cDNA revealed an extra band, 3.4 kb in size (Fig. 4). This band was sequenced and confirmed to be aberrantly transcribed mRNA. Sequencing of the 3.4 kb band showed that the aberrant transcript appeared to read from CDKN2A exon 2 straight into intron 2, ignoring the normal GT splice donor site. The whole intron appeared to be retained up until the newly created splice donor site at IVS2-105. From this point two separate populations of aberrant transcript could be observed. Approximately half of the aberrant transcript, based on chromatogram peak heights (Fig. 5), appeared to ignore the newly created GT splice donor at –105 and continued reading through the remainder of intron 2 and into exon 3. The other population of aberrant mRNA transcript read through CDKN2A intron 2 up until the newly created splice donor site, where the remaining 105 nucleotides of intron 2 were spliced out (Fig. 6).
|
|
The possibility that additional aberrant populations of mRNA transcript may have been generated by splicing abnormalities was also investigated. Long-range PCR of cDNA from sample 095F using a primer located early in CDKN2A exon 1, RT 1F, was carried out in order to investigate transcription of mRNA across the whole gene. No additional populations of aberrantly spliced mRNA transcript were identified.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
We have identified a deep intronic mutation, IVS2-105 A/G, in six English melanoma pedigrees with no previously detected coding mutations of CDKN2A. The mutation appears to be causal. It segregates with disease and was not detected in a panel of control DNAs. Most importantly IVS2-105 A/G has been demonstrated to affect the splicing of CDKN2A.
Splicing mutations have been identified in a number of different genes and have been estimated to account for 15% of all disease causing mutations (20). These mutations have been shown to have a variety of consequences, including exon skipping and intron retention (21). Most appear to affect the canonical splice sites or their surrounding consensus sequence (22). Two such mutations have been identified in CDKN2A; IVS1-1 and IVS2+1 have been shown to disrupt the canonical splice sites at the 5' and 3' ends of exon 2, respectively (23–25). In a number of reports, mutations remote from the splice donor or acceptor sites have been shown to lead to aberrant splicing. Intronic mutations which affect the RNA processing machinery, such as the branch site or the pyrimidine tract have been shown to disrupt splicing (21,26–28). However, the creation of additional splice sites in the central part of the intron is considered to be a rare event (21).
The creation of a splice donor site within an intron has been reported in the ataxia-telangiectasia ATM and tuberous sclerosis TSC2 genes. In each example, the creation of the donor site appeared to activate an upstream cryptic splice acceptor site, creating a psuedoexon within the intron and resulting in the retention of a portion of intronic sequence in the mRNA (21,29). The CDKN2A deep intronic mutation identified in this paper does not appear to activate an upstream cryptic splice acceptor site in this way, although there are several candidate acceptor sites located in CDKN2A intron 2 with high functionality scores (data not shown).
Analysis of cDNA from a cell line carrying the IVS2-105 mutation revealed two aberrant populations of transcript. In one population the newly created cryptic splice donor did not function as a splice site. However, the wild-type intron 2 splice donor site 3 kb upstream of the mutation also failed to function as a splice site, resulting in the incorporation of the whole of intron 2 into the transcript. In the second population of aberrant transcript, the cryptic splice donor does function as a splice site and the last 105 bases of intron 2 are spliced out. Again the real splice donor site does not appear to function. This implies that there may be some kind of feedback mechanism operating whereby the function of the wild-type splice donor site is impaired by the presence of the IVS2-105 intronic mutation >3 kb downstream. In both cases a very large fragment of intron sequence is incorporated into the transcript.
The incorporation of such a large fragment appears to be a rare event. Previous studies of splicing mutations in other genes have shown the retention of introns to be uncommon (6%) and often associated with short introns (30), although retained introns of 1.2 and 1.6 kb have been observed (31).
The possibility of the existence of additional populations of aberrantly spliced transcript was investigated using primers designed to bind early in exon 1 of CDKN2A. No additional populations of aberrant transcript were detected by long-range PCR across the length of the CDKN2A gene. Therefore, the IVS2-105 mutation does not appear to activate a cryptic splice acceptor site anywhere within the CDKN2A gene.
In addition to the two aberrant populations of transcript, it seems likely that some wild-type transcript would also be produced from the mutant allele. Splicing mutations have previously been shown to be ‘leaky’, affecting the efficiency of correct exon splicing and resulting in the production of both normal and aberrant transcripts from the mutant allele. For this reason, splicing mutations have been demonstrated to result in a less severe disease phenotype, in comparison with exonic mutations that disrupt the function of the protein (22,29,30). However, there is no evidence to suggest that the IVS2-105 mutation is any less penetrant than previously reported coding mutations of CDKN2A.
Haplotyping data for the six UK pedigrees found to harbour the mutation reveal a region of haplotype sharing across 9p21. This conserved haplotype indicates that IVS2-105 may have been inherited as a single ancestral mutation, in a similar manner to the previously studied CDKN2A mutation Met53Ile (32).
The effect of the IVS2-105 mutation on the function of the p16 protein cannot be easily explained. The IVS2-105 mutation has been shown to give rise to two populations of aberrantly spliced mRNA which retain all, or almost all, of intron 2. However, the predicted translation of these deviant populations of mRNA would not produce a protein very dissimilar to that of wild-type p16. Indeed, due to a stop codon in the retained intronic sequence, both aberrant populations would be predicted to give rise to a protein one amino acid shorter than wild-type p16 protein, differing from p16 in only the last four amino acids (Fig. 6).
The four ankyrin repeat units of CDKN2A, which span exons 1 and 2, have been shown to be essential to p16 binding function (33). Most previously identified causal mutations of CDKN2A have been seen to disrupt these sequences. The aberrant splicing caused by IVS2-105 would not seem likely to effect the ankyrin repeat units, as only the last four four amino acids, encoded by exon 3 of CDKN2A, would be predicted to be altered. The truncation of the p16 protein after exon 2, with the loss of these last four amino acids, has previously been shown to have no effect on the function of p16, with respect to binding to CDK4 (33).
This deep intronic mutation does not appear likely to affect the p16 protein-binding function through disruption of the ankyrin repeat sequences; however, the weight of evidence presented here points to IVS2-105 being a causal mutation, predisposing to melanoma. Although the possibility of the IVS2-105 mutation being in linkage disequilibrium with a separate causal mutation in these pedigrees cannot be ruled out, the effect of IVS2-105 on splicing in CDKN2A is apparent.
The aberrant mRNA produced by the IVS2-105 mutation is very large in comparison with normal CDKN2A mRNA. However, in comparison with many other genes a 3.5 kb mRNA is not unusually large and is therefore not likely to be particularly unstable. The stability of the aberrant mRNA transcripts is illustrated by the ease of their detection by long-range PCR of cDNA. Similarly, the translation of the aberrant CDKN2A mRNA to protein is also unlikely to be affected by the incorporation of 3 kb of intronic sequence.
Synthesis and processing of RNA occurs in the nucleus. Pre-mRNA molecules transcribed from DNA undergo splicing and acquire their 5' cap structure in the nucleoplasm before export to the cytoplasm as mature messenger RNAs. It is believed that the export apparatus surveys mRNA molecules to ensure that every intron that is meant to be removed has been removed before passage to the cytoplasm (34).
This control of transport of mRNA across the nuclear membrane may explain how the IVS2-105 deep intronic mutation could predispose to melanoma. If the aberrantly spliced forms of CDKN2A are recognized as not having being properly processed, their passage into the cytoplasm may be obstructed. Hence, the levels of CDKN2A mRNA in the cytoplasm available for translation to p16 protein would be reduced.
Therefore, it is plausible that the aberrant splicing caused by the IVS2-105 mutation may reduce the amount of wild-type p16 protein produced to below a threshold level where its function as an inhibitor of CDK4 is impaired. This would result in the loss of control of cell cycle regulation and predisposition to disease.
CDKN2A shares exons 2 and 3 with p14ARF, but utilizes them in a different reading frame. It is possible that the IVS2-105 mutation would also affect the splicing and function of p14ARF. Long-range PCR using a forward primer in the 5'-UTR of p14ARF exon 1ß revealed an extra band 3 kb larger than wild-type, indicating that intron 2 is also retained in the p14ARF mRNA (data not shown). The retention of intron 2 would not have a direct effect on the p14ARF protein as the protein terminates before the end of exon 2. However, passage of the aberrant p14ARF mRNA into the cytoplasm may be obstructed as described above, resulting in a reduction in the level of wild-type p14ARF protein produced.
Variation can occur in the way that pre-mRNAs are processed in different tissues and at different stages in development. The splice sites used may vary, resulting in the alternative splicing of the same pre-mRNA in different tissues to yield mRNAs with different coding potential (35–37). Tissue-specific splicing has been demonstrated previously in CDKN2A, where the splicing of pre-mRNA in the pancreas was seen to be different to that in other tissues (38). The cDNA used in this investigation was synthesized from RNA extracted from a B-lymphoblastoid cell line. There is no assurance that the effect of the IVS2-105 mutation on CDKN2A splicing will be the same in the skin. It is conceivable that the effect of the mutation on the p16 protein in melanocytes, the site of melanogenesis, may be different to that observed in lymphocytes.
The frequency of the deep intronic mutation appears to be relatively high in UK melanoma pedigrees. Of the 106 pedigrees screened for the IVS2-105 mutation, 42 had at least three cases of melanoma, the conventionally accepted criteria for a melanoma family. Coding or promoter mutations have been identified previously in 16 of these pedigrees (8,16,17). The IVS2-105 mutation was identified in four of the remaining 26 pedigrees. Therefore, this single intronic mutation accounts for 15% of English melanoma pedigrees with no previously reported coding or promoter mutations.
The location of IVS2-105, deep within intron 2 of CDKN2A, makes the mutation difficult to detect by sequencing or SSCP analysis. In addition, the two populations of abberrant mRNA transcript are undetectable by conventional RT–PCR due to the incorporation of such a large portion of intronic sequence. The difficulty involved in the detection of IVS2-105, together with the frequency in which it has been identified in UK melanoma pedigrees suggests the possibility that this single deep intronic mutation may actually account for a substantial subset of 9p21-linked melanoma pedigrees worldwide with no detectable coding mutations of CDKN2A.
The identification of one deep intronic mutation in CDKN2A argues the prospect of the existence of other intronic mutations which may also predispose to melanoma in pedigrees with no detectable coding mutations of CDKN2A. Although the creation of additional splice sites in introns is considered to be a rare event (21), this may be because most deep intronic mutations would be missed by the mutation detection techniques used most frequently. Therefore, the true frequency of intronic splice mutations is unknown.
To date there has not been a thorough investigation of the intronic sequence of CDKN2A for mutations; however, in the light of the identification of the IVS2-105 deep intronic mutation this has become a priority in those melanoma pedigrees where coding mutations of CDKN2A cannot be identified.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Families at increased risk of melanoma have been recruited in the period since 1989 in England and Wales. Ethical Committee approval for this study was obtained from all institutions involved. Forty-two of the families have been described previously (8,16,17).
Routine screening of CDKN2A exon 3
CDKN2A exon 3 is routinely screened in our laboratory as part of a complete screen of all exons of CDKN2A in melanoma kindreds. The exon is amplified from genomic DNA by PCR using previously described intronic primers (p16 3F CCATTGCGAGAACTTTATCC and p16 3R TGGACATTTACGGTAGTGGG) (39), following a standard PCR protocol (17).
The CDKN2A exon 3 PCR product was then sequenced using the ABI PRISM BigDye Terminator Cycle Sequencing kit (Perkin Elmer) and the products analysed on an ABI377 sequencer.
Allele-specific PCR test for intronic variant
A simple allele-specific PCR test was developed to allow easier detection of the intronic variant. PCR reactions were carried out in parallel using wild-type-specific (WT-F CCATTGCGAGAACTTTATCCA) and variant-specific (MUT-F CCATTGCGAGAACTTTATCCG) forward primers in combination with the standard CDKN2A exon 3 reverse primer, p16 3R. Standard PCR reaction conditions were used as above, with an annealing temperature of 61°C to increase the specificity of the reaction.
Sequencing of CDKN2A intron 2
Intron 2 of CDKN2A was amplified by PCR in eight overlapping fragments of 400–500 bp which cover the entire 2659 bp intron and a portion of flanking exonic sequence. The fragments were amplified from genomic DNA using the following primers: In2-1F GTCCCTCAGGTGAGGACTGA, In2-1R CCAGCTTGGTATGCAAATGA; In2-2F ACTGCGGAGCAATGAAGACT, In2-2R AGGGCAAGGAGGACCATAAT; In2-3bF TGGACCAACCTCAGGATTTC, In2-3R CTGGGCCAAAATAAGATGGA; In2-4F CAGTACACGGGAATTAACACGA, In2-4R ACTTGGCTCCTCAGGCTTTT; In2-5F GGGTCCCGATTTAGAAGGAG, In2-5bR CACCTGTGGTCCCAGCTAGT; In2-6F TGGGGTTTACATTTGGAGACA, In2-6R TGCATTAGATTCTCCGACCA; In2-7F AAAACCAATGCAATGGGTAAA, In2-7R CAGCTTGCGATAACCAAAGG; In2-8F CGTAGGGAAGCTACGGGATT, In2-8R TTCTTTCAATCGGGGATGTC. Standard PCR reaction conditions were used, as above, with an annealing temperature of 58°C in each case. Sequencing reactions were carried out using the ABI PRISM BigDye Terminator Cycle Sequencing kit and the products were analysed on an ABI 377 DNA sequencer. DNA sequencing was carried out in both directions, initiated from the forward and reverse primers used in the initial PCR amplification of each fragment.
Analysis of intronic variant
The segregation of the intronic variant with melanoma was investigated in all pedigrees in which it was detected using the allele-specific PCR test. All cases in families in which the mutation was identified were assessed for their carrier status. The evidence for IVS2-105 A/G being the causal mutation was further assessed by linkage analysis. Linkage analysis was performed using the LINKAGE software, v5.2 (40). We assumed that susceptibility to melanoma was inherited as an autosomal dominant with an allele frequency of 0.001 and with lifetime penetrance as estimated by the Melanoma Genetics Consortium (41).
In addition, the frequency of the variant in the general population was assessed using a panel of control DNA samples, consisting of 80 controls with no history of cancer collected in epidemiological case/control studies and 20 samples obtained from healthy staff of ICRF Leeds.
Haplotyping
Individuals from pedigrees with the intron 2 variant were typed for the following 9p21 markers: D9S976, D9S736, D9S1749, D9S2136, D9S974, D9S942, D9S1748, D9S1604, D9S1752, D9S975 and D9S171. Primer sequences were obtained from the Genome database (http://www.gdb.org). For each primer pair one oligonucleotide was labelled with a 5' fluorescent amidite (6'-FAM, HEX or TET) using standard amidite labelling chemistry.
Amplification was carried out using an AmpliTaq Gold (Applied Biosystems) PCR protocol. Markers D9S1749, D9S974 and D9S171 were amplified together in a multiplex PCR reaction, as were markers D9S736 and D9S1748. The remaining markers were amplified individually. Products were visualized using an ABI377 Sequencer and analysed using the ABI PRISM Genescan Analysis software package.
RT–PCR analysis of CDKN2A transcript
A previously established B-lymphoblastoid cell line was available for individual 095F, pedigree MEL 6, which had been shown to carry the IVS2-105 intronic variant. Total RNA was extracted from this cell line using the Qiagen RNeasy Midi Kit. cDNA was then reverse transcribed from RNA using the Advantage RT-for-PCR kit (Clontech).
The CDKN2A mRNA transcript was initially amplified using forward primers in exon 1 (RT 1F GAGCAGCATGGAGCCTTC), exon 2 (RT 2F GCACCAGAGGCAGTAACCAT) and a cDNA-specific forward primer that spans exons 1 and 2 (RT 1/2F GAGGCCGATCCAGGTCAT), together with a reverse primer in the CDKN2A 3'-UTR (RT 3R CCTGTAGGACCTTCGGTGAC). Control PCR reactions were carried out using primers designed to amplify the GAPDH housekeeping gene (GAPDH 1F CGAGCCACATCGCTCAGACA and GAPDH 1R TGAGGCTGTTGTCATACTTCTC). A standard PCR protocol was followed, as above (17).
Long-range PCR of mutant transcript
The Geneamp XL PCR kit (Applied Biosystems) was used to carry out long-range PCR across the CDKN2A introns, using the forward primers RT 1F and RT1/2F, together with reverse primer RT 3R. Reaction conditions were as described in the Geneamp XL PCR protocol, with an annealing temperature of 68°C.
|
ACKNOWLEDGEMENTS |
|---|
Thanks to Linda Whitaker, Elizabeth Pinney, Veronique Bataille, Karen Griffiths, J.M. (Bee) Squire, Patricia Mack and Rachel Wachsmuth who were involved in interviewing patients in the familial melanoma research programme since 1989. We are very grateful to the families who take part without whose gift of time and information this research would not take place. We are also grateful to the Clare Hall Cell Service facility and to Tracy Lee for providing the lymphoblastoid cell line. This work was funded by the Imperial Cancer Research Fund in the UK.
|
FOOTNOTES |
|---|
+ To whom correspondence should be addressed. Tel: +44 113 206 4668; Fax: +44 113 242 9886; Email: j.newton-bishop@icrf.icnet.uk
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
1 Dracopoli, N.C. and Fountain, J.W. (1996) CDKN2A mutations in melanoma. Cancer Surv., 26, 115–131.[Web of Science][Medline]
2 Hayward, N.K. (1996) The current situation with regard to human melanoma and genetic inferences. Curr. Opin. Oncol., 8, 136–142.[Medline]
3 Foulkes, W., Flanders, T.Y., Pollock, P.M. and Hayward, N.K. (1997) The CDKN2A (p16) gene and human cancer. Mol. Med., 3, 5–20.[Web of Science][Medline]
4 Liggett, W.H.,Jr and Sidransky, D. (1998) Role of the p16 tumor suppressor gene in cancer. J. Clin. Oncol., 16, 1197–1206.[Abstract]
5 Soufir, N., Avril, M.F., Chompret, A., Demenais, F., Bombled, J., Spatz, A., Stoppa-Lyonnet, D., Benard, J. and Bressac de Paillerets, B. (1998) Prevalence of p16 and CDK4 germline mutations in 48 melanoma-prone families in France. Hum. Mol. Genet., 7, 209–216.
6 Roussel, M.F. (1999) The INK4 family of cell cycle inhibitors in cancer. Oncogene, 18, 5311–5317.[Web of Science][Medline]
7 Goldstein, A.M. and Tucker. M.A. (1997) Screening for CDKN2A mutations in hereditary melanoma. J. Natl Cancer Inst., 89, 676–678.
8 Newton Bishop, J.A., Harland, M., Bennett, D.C., Bataille, V., Goldstein, A.M., Tucker, M.A., Ponder, B.A.J., Cuzick, J., Selby, P. and Bishop, D.T. (1999) Mutation testing in melanoma families: CDKN2A CDK4 and INK4d. Br. J. Cancer Res., 80, 295–300.
9 Stone, S., Jiang, P., Dayananth, P., Tavtigian, S.V., Katcher, H., Parry, D., Peters, G. and Kamb, A. (1995) Complex structure and regulation of the P16 (MTS1) locus. Cancer Res., 55, 2988–2994.
10 Flores, J.F, Pollock, P.M., Walker, G.J., Glendening, J.M., Lin, A.H.T., Palmer, J.M., Walters, M.K., Hayward, N.K. and Fountain J.W. (1997) Analysis of the CDKN2A, CDKN2B and CDK4 genes in 48 Australian melanoma kindreds. Oncogene, 15, 2999–3005.[Web of Science][Medline]
11 Platz, A., Hannson, J., Månsson-Brahme, E., Lagerloff, B., Linder, S., Lundqvist, E., Sevigny, P., Inganas, M. and Ringborg, U. (1997) Screening of germline mutations in the CDKN2A and CDKN2B genes in Swedish families with hereditary cutaneous melanoma. J. Natl Cancer Inst., 89, 697–702.
12 Liu, L., Goldstein, A.M., Tucker, M.A., Brill, H., Gruis, N.A., Hogg, D. and Lassam, N.J. (1997) Affected members of melanoma-prone families with linkage to 9p21 but lacking mutations in CDK N2A do not harbor mutations in the coding regions of either CDKN2B or p19ARF. Genes Chromosomes Cancer, 19, 52–54.
13 Randerson-Moor, J.A., Harland, M., Williams, S., Cuthbert-Heavens, D., Sheridan, E., Aveyard, J., Sibley, K., Whittaker, L., Knowles, M., Newton Bishop, J. and Bishop, D.T. (2001) A germline deletion of p14ARF but not CDKN2A in a melanoma-neural system tumour syndrome family. Hum. Mol. Genet., 10, 55–62.
14 Rizos, H., Puig, S., Badenas, C., Malvehy, J., Darmanian, A., Jimenez, L., Mila, M. and Kefford, R. (2001) A melanoma-associated germline mutation in exon 1B inactivates p14ARF. Oncogene, 20, 5543–5547.[Web of Science][Medline]
15 Liu, L., Dilworth, D., Gao, L., Monzon, J., Summers, A., Lassam, N. and Hogg, D. (1999) Mutation of the CDKN2A 5'-UTR creates an aberrant initiation codon and predisposes to melanoma. Nat. Genet., 21, 128–132.[Web of Science][Medline]
16 Harland, M., Holland, E.A., Ghiorzo, P., Mantelli, M., Bianchi-Scarra, G., Goldstein, A.M., Tucker, M.A., Ponder, B.A.J., Mann, G.J., Bishop, D.T. and Newton Bishop, J. (2000) Mutation screening of the CDKN2A promoter in melanoma families. Genes Chromosomes Cancer, 28, 45–57.[Web of Science][Medline]
17 Harland, M., Meloni, R., Gruis, N., Pinney, E., Brookes, S., Spurr, N.K., Frischauf, A.M., Bataille, V., Peters, G., Cuzick, J. et al. (1997) Germline mutations of the CDKN2 gene in UK melanoma families. Hum. Mol. Genet., 6, 2061–2067.
18 Mount, S.M. (1982) A catalogue of splice junction sequences. Nucleic Acids Res., 10, 459–472.
19 Shapiro, M.B. and Senapathy, P. (1987) RNA splice junctions of different classes of eukaryotes: sequence statistics and functional implications in gene expression. Nucleic Acids Res., 15, 7155–7174.
20 Krawczak, M., Reiss, J. and Cooper, D.N. (1992) The mutational spectrum of single base-pair substitutions in mRNA splice junctions of human genes: causes and consequences. Hum. Genet., 90, 41–54.[Web of Science][Medline]
21 Mayer, K., Ballhausen, W., Leistner, W. and Rott, H. (2000) Three novel types of splicing aberrations in the tuberous sclerosis TSC2 gene caused by mutations apart from splice consensus sequence. Biochim. Biophys. Acta, 1502, 495–507.[Medline]
22 Teraoka, S.N., Telatar, M., Becker-Catania, S., Liang, T., Onengut, S, Tolun, A., Chessa, L., Sanal, O., Bernatowska, E., Gatti, R.A. and Concannon, P. (1999) Splicing defects in the ataxia-telangiectasia gene, ATM: underlying mutations and consequences. Am. J. Hum. Genet., 64, 1617–1631.[Web of Science][Medline]
23 Petronzelli, F., Sollima, D., Coppola, G., Martini-Neri, M.E., Neri, G. and Genuardi, M. (2001) CDKN2A germline splicing mutation affecting both p16(ink4) and p14(arf) RNA processing in a melanoma/neurofibroma kindred. Genes Chromosomes Cancer, 31, 398–401.[Web of Science][Medline]
24 Hussussian, C.J., Struewing, J.P., Goldstein, A.M., Higgins, P.A., Ally, D.S., Sheahan, M.D., Clark, W.H., Jr, Tucker, M.A. and Dracopoli, N.C. (1994) Germline p16 mutations in familial melanoma. Nat. Genet., 8, 15–21.[Web of Science][Medline]
25 MacKie, R.M., Andrew, N., Lanyon, W.G. and Connor, J.M. (1998) CDKN2A germline mutations in U.K. patients with familial melanoma and multiple primary melanomas. J. Invest. Dermatol., 111, 269–272.[Web of Science][Medline]
26 Burrows, N.P., Nicholls, A.C., Richards, A.J., Luccarini, C., Harrison, J.B., Yates, J.R. and Pope, F.M. (1998) A point mutation in an intronic branch site results in aberrant splicing of COL5A1 and in Ehlers–Danlos syndrome type II in two British families. Am. J. Hum. Genet., 63, 390–398.[Web of Science][Medline]
27 Li, M., and Pritchard, P.H. (2000) Characterization of the effects of mutations in the putative branchpoint sequence of intron 4 on the splicing within the human lecithin:cholesterol acyltransferase gene. J. Biol. Chem., 275, 18079–18084.
28 Janssen, R.J., Wevers, R.A., Haussler, M., Luyten, J.A., Steenbergen-Spanjers, G.C., Hoffmann, G.F., Nagatsu, T. and Van den Heuvel, L.P. (2000) A branch site mutation leading to aberrant splicing of the human tyrosine hydroxylase gene in a child with a severe extrapyramidal movement disorder. Ann. Hum. Genet., 64, 375–382.[Web of Science][Medline]
29 McConville, C.M., Stankovic, T., Byrd, P.J., McGuire, G.M., Yao, Q.Y., Lennox, G.G. and Taylor A.M.R. (1996) Mutations associated with variant phenotypes in ataxia-telangiectasia. Am. J. Hum. Genet., 59, 320–330.[Web of Science][Medline]
30 Ketterling, R.P., Drost, J.B., Scaringe, W.A., Liao, D.Z., Liu, J.Z., Kasper, C.K. and Sommer, S.S. (1999) Reported in vivo splice-site mutations in the factor IX gene: severity of splicing defects and a hypothesis for predicting deleterious splice donor mutations. Hum. Mutat., 13, 221–231.[Web of Science][Medline]
31 Nakai, K. and Sakamoto, H. (1994) Construction of a novel database containing aberrant splicing mutations of mammalian genes. Gene, 141, 171–177.[Web of Science][Medline]
32 Pollock, P.M., Spurr, N., Bishop, T., Newton-Bishop, J., Gruis, N., van der Velden, P.A., Goldstein, A.M., Tucker, M.A., Foulkes, W.D., Barnhill, R. et al. (1998) Haplotype analysis of two recurrent CDKN2A mutations in 10 melanoma families: evidence for common founders and independent mutations. Hum. Mutat., 11, 424–431.[Web of Science][Medline]
33 Parry, D. and Peters, G. (1996) Temperature-sensitive mutants of p16CDKN2 associated with familial melanoma. Mol. Cell. Biol., 16, 3844–3852.[Abstract]
34 Watson, J.D., Hopkins, N.H., Roberts, J.W., Steitz, J.A. and Weiner, A.M. (1987) Molecular Biology of the Gene. Benjamin/Cummings Publishing Co., Menlo Park, CA.
35 Amara, S.G., Jonas, V., Rosenfeld, M.G., Ong, E.S. and Evans, R.M. (1982) Alternative RNA processing in calcitonin gene expression generates mRNAs encoding different polypeptide products. Nature, 298, 240–244.[Medline]
36 Nabeshima, Y., Fujii-Kuriyama, Y., Muramatsu, M. and Ogata, K. (1984) Alternative transcription and two modes of splicing results in two myosin light chains from one gene. Nature, 308, 333–338.[Medline]
37 Savitsky, K., Bar-Shira, A., Gilad, S., Rotman, G., Ziv, Y., Vanagaite, L., Tagle, D.A., Smith, S., Uziel, T., Sfez, S. et al. (1995) A single ataxia telangiectasia gene with a product similar to PI-3 kinase. Science, 268, 1749–1753.
38 Robertson, K.D. and Jones, P.A. (1999) Tissue-specific alternative splicing in the human INK4a/ARF cell cycle regulatory locus. Oncogene, 18, 3810–3820.[Web of Science][Medline]
39 Kamb, A., Shattuck-Eidens, D., Eeles, R., Liu, Q., Gruis, N.A., Ding, W., Hussey, C., Tran, T., Miki, Y., Weaver-Feldhaus, J. et al. (1994) Analysis of the p16 gene (CDKN2) as a candidate for the chromosome 9p melanoma susceptibility locus. Nat. Genet., 8, 23–26.[Medline]
40 Lathrop, G.M., Lalouel, J.M., Julier, C. and Ott, J. (1984) Strategies for multilocus linkage analysis in humans. Proc. Natl Acad. Sci. USA, 81, 3443–3446.
41 Bishop, D., Goldstein, A. and Demenais, F. (2000) Geographical variation in CDKN2A penetrance for melanoma. Am. J. Hum. Genet., 67, 16.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  A M Goldstein, S N Stacey, J H Olafsson, G F Jonsson, A Helgason, P Sulem, B Sigurgeirsson, K R Benediktsdottir, K Thorisdottir, R Ragnarsson, et al. CDKN2A mutations and melanoma risk in the Icelandic population J. Med. Genet., May 1, 2008; 45(5): 284 - 289. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Lonning, S Knappskog, V Staalesen, R Chrisanthar, and J. Lillehaug Breast cancer prognostication and prediction in the postgenomic era Ann. Onc., August 1, 2007; 18(8): 1293 - 1306. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. N. Markovic, L. A. Erickson, R. D. Rao, R. R. McWilliams, L. A. Kottschade, E. T. Creagan, R. H. Weenig, J. L. Hand, M. R. Pittelkow, B. A. Pockaj, et al. Malignant Melanoma in the 21st Century, Part 1: Epidemiology, Risk Factors, Screening, Prevention, and Diagnosis Mayo Clin. Proc., March 1, 2007; 82(3): 364 - 380. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Ghiorzo, S. Gargiulo, L. Pastorino, S. Nasti, R. Cusano, W. Bruno, S. Gliori, M. R. Sertoli, A. Burroni, V. Savarino, et al. Impact of E27X, a novel CDKN2A germ line mutation, on p16 and p14ARF expression in Italian melanoma families displaying pancreatic cancer and neuroblastoma Hum. Mol. Genet., September 15, 2006; 15(18): 2682 - 2689. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K Laud, C Marian, M F Avril, M Barrois, A Chompret, A M Goldstein, M A Tucker, P A Clark, G Peters, V Chaudru, et al. Comprehensive analysis of CDKN2A (p16INK4A/p14ARF) and CDKN2B genes in 53 melanoma index cases considered to be at heightened risk of melanoma J. Med. Genet., January 1, 2006; 43(1): 39 - 47. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Puig, J. Malvehy, C. Badenas, A. Ruiz, D. Jimenez, F. Cuellar, A. Azon, U. Gonzalez, T. Castel, A. Campoy, et al. Role of the CDKN2A Locus in Patients With Multiple Primary Melanomas J. Clin. Oncol., May 1, 2005; 23(13): 3043 - 3051. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. P. Larson, Y. Ding, L. S-C. Cheng, C. Lundberg, V. Gagalang, G. Rivas, L. Geller, J. Weitzel, D. MacDonald, J. Archambeau, et al. Genetic Linkage of Prostate Cancer Risk to the Chromosome 3 Region Bearing FHIT Cancer Res., February 1, 2005; 65(3): 805 - 814. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Tsao, A. J. Sober, K. B. Niendorf, and A. Zembowicz Case 7-2004 - A 48-Year-Old Woman with Multiple Pigmented Lesions and a Personal and Family History of Melanoma N. Engl. J. Med., February 26, 2004; 350(9): 924 - 932. [Full Text] [PDF]
|
|
|
|
|
|
P. Ghiorzo, L. Pastorino, L. Bonelli, R. Cusano, A. Nicora, S. Zupo, P. Queirolo, M. Sertoli, V. Pugliese, and G. Bianchi-Scarra INK4/ARF germline alterations in pancreatic cancer patients Ann. Onc., January 1, 2004; 15(1): 70 - 78. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||