Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (55)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Tilgen, N.
Right arrow Articles by Treves, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tilgen, N.
Right arrow Articles by Treves, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2001, Vol. 10, No. 25 2879-2887
© 2001 Oxford University Press

Identification of four novel mutations in the C-terminal membrane spanning domain of the ryanodine receptor 1: association with central core disease and alteration of calcium homeostasis

Nikola Tilgen1, Francesco Zorzato2,3, Birgit Halliger-Keller1, Francesco Muntoni4, Caroline Sewry4, Laura M. Palmucci5, Christiane Schneider6, Erwin Hauser7, Frank Lehmann-Horn8, Clemens R. Müller1,+ and Susan Treves2

1Institut für Humangenetik, Biozentrum der Universität Würzburg, Am Hubland, 97074 Würzburg, Germany, 2Department für Anaesthesie und Forschung, Kantonsspital Basel, 4031 Basel, Switzerland, 3Dipartimento di Medicina Sperimentale e Diagnostica, Università di Ferrara, 44100 Ferrara, Italy, 4The Dubovitz Neuromuscular Centre, Imperial College School of Medicine, London W12 0NN, UK, 5Centro Malattie Neuromuscolari Paolo Peirolo, Università di Torino, 10126 Torino, Italy, 6Neurologische Klinik der Universität Würzburg, 97080 Würzburg, Germany, 7Universitäts-Kinderklinik, 1090 Wien, Austria and 8Abteilung für Angewandte Physiologie der Universität Ulm, 89069 Ulm, Germany

Received July 26, 2001; Revised and Accepted October 2, 2001.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The skeletal muscle ryanodine receptor gene (RYR1; OMIM 180901) on chromosome 19q13.1 encodes the skeletal muscle calcium release channel. To date, more than 25 missense mutations have been identified in RYR1 and are associated with central core disease (CCD; OMIM 117000) and/or the malignant hyperthermia susceptibility phenotype (MHS1; OMIM 145600). The majority of RYR1 mutations are clustered in the N-terminal hydrophilic domain of the protein. Only four mutations have been identified so far in the highly conserved C-terminal region encoding the luminal/transmembrane domain of the protein which forms the ion pore. Three of these mutations have been found to segregate with pure or mixed forms of CCD. We have screened the C-terminal domain of the RYR1 gene for mutations in 50 European patients, diagnosed clinically and/or histologically as having CCD. We have identified five missense mutations (four of them novel) in 13 index patients. The mutations cluster in exons 101 and 102 and replace amino acids which are conserved in all known vertebrate RYR genes. In order to study the functional effect of these mutations, we have immortalized B-lymphocytes from some of the patients and studied their [Ca2+]i homeostasis. We show that lymphoblasts carrying the newly identified RYR1 mutations exhibit: (i) a release of calcium from intracellular stores in the absence of any pharmacological activators of RYR; (ii) significantly smaller thapsigargin-sensitive intracellular calcium stores, compared to lymphoblasts from control individuals; and (iii) a normal sensitivity of the calcium release to the RYR inhibitor dantrolene. Our data suggest the C-terminal domain of RYR1 as a hot spot for mutations leading to the CCD phenotype. If the functional alterations of mutated RYR channels observed in lymphoblastoid cells are also present in skeletal muscles this could explain the predominant symptom of CCD, i.e. chronic muscle weakness. Finally, the study of calcium homeostasis in lymphoblastoid cells naturally expressing RYR1 mutations offers a novel non-invasive approach to gain insights into the pathogenesis of MH and CCD.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Central core disease (CCD) of muscle (OMIM 117000) is a rare congenital myopathy of autosomal dominant inheritance (1,2). Affected individuals present with infantile hypotonia (floppy infant syndrome) and a delay in achieving motor milestones. Later in life, the predominant symptom is a generalized muscle weakness affecting the proximal muscle groups more than the distal ones. The clinical severity is highly variable but the course is usually slow or non-progressive. Additional clinical features may include congenital hip dislocation, kyphoscoliosis, foot deformities and joint contractures (3). The diagnosis is difficult on the basis of clinical findings alone and a histological examination of muscle tissue is essential. Typically, type I fibres predominate and, on cross sections, contain single, well demarcated and centrally located cores, which do not stain with oxidative and phosphorylase histochemical stains. In longitudinal sections the amorphous-looking areas run along the length of the fibres (4,5).

CCD is closely associated with malignant hyperthermia susceptibility (MHS1; OMIM 145600), a pharmacogenetic disease inherited as an autosomal dominant trait. MH susceptible individuals can suffer from adverse reactions to commonly used inhalative anaesthetics and depolarizing muscle relaxants with an acute hypermetabolic crisis which can include skeletal muscle rigidity, tachycardia, hyperthermia, acidosis, cardiac arrhythmias and rhabdomyolysis (68). Biochemical studies have demonstrated that MHS is due to abnormalities in skeletal muscle calcium homeostasis (9). Genetic linkage studies have mapped the primary locus of MH on chromosome 19q13.1, to the gene encoding the ryanodine receptor RYR1 (10,11). However, only ~50 % of MH families have mutations in the RYR1 gene and linkage to other loci has been reported (1215).

The ryanodine receptor (RYR1), the calcium release channel of skeletal muscle sarcoplasmic reticulum (SR), is encoded by a gene comprised of 106 exons (16) producing one of the largest known proteins (5038 amino acids) (17,18). The functional channel is composed of four identical subunits of 565 kDa each and has been shown to interact with a number of regulatory proteins. The first 4000 amino acids comprise the hydrophilic cytoplasmic domain which bridges the gap between the transverse tubules and the SR whereas the last 1000 amino acids form the hydrophobic membrane-spanning plate, containing the pore (7,19). To date, more than 25 missense mutations in the RYR1 gene have been associated with susceptibility to MHS and/or CCD (20). The mutated codons giving rise to CCD and MHS are clustered in three regions of the RYR1 gene: CCD/MHS region 1 extends from Met1 to Arg614, CCD/MHS region 2 lies between Arg2162 and Arg2458. Both regions are predicted to reside in the myoplasmic foot domain of the protein. CCD/MHS region 3 is located in the transmembrane/luminal region of the highly conserved C-terminal domain. The majority of RYR1 mutations appear to be clustered in regions 1 and 2 and so far only four mutations have been found in region 3 (2124).

Recently, Sei et al. (25) demonstrated that circulating B-lymphocytes as well as the human B-cell line DAKIKI express a functional type 1 RYR calcium release channel. Following this observation, we have studied the calcium homeostasis in lymphoblastoid cell lines from MHS patients carrying the Val2168Met mutation. Our data indicate that their sensitivity to calcium mobilizing RYR activators were different from those of control individuals (T.Girard, D.Cavagna, E.Padovan, G.Spagnoli, A.Urwyler, F.Zorzato and S.Treves, manuscript submitted for publication). Thus, measurements of the intracellular Ca2+ concentration, [Ca2+]i in EBV-immortalized lymphoblastoid cells can be used to assay the function of RYR1 mutations ex vivo.

In the present work, we describe five mutations (four of them novel) identified in 13 unrelated individuals by screening the C-terminal domain of RYR1 in a cohort of 50 patients with clinical CCD. In addition, we demonstrate that four of these mutations lead to a marked disturbance of calcium homeostasis in patients’ lymphoblastoid cells: Ca2+ is released from intracellular stores in the absence of pharmacological activators of RYR1 leading to smaller thapsigargin-sensitive Ca2+ stores whereas the sensitivity of RYR to dantrolene is not impaired. Our results suggest the C-terminal, transmembrane domain of RYR1 as a hot spot for CCD mutations and give evidence for the usefulness of Ca2+ release measurements in B-lymphocytes as a novel, non-invasive approach to test RYR1 function ex vivo.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
RYR1 mutation analysis
We have screened by single strand conformation analysis (SSCA) exons 98–103 of the RYR1 gene in 50 unrelated patients being diagnosed clinically and/or histologically as having CCD. We concentrated on this region because it is thought to be part of the highly conserved hydrophobic C-terminal domain of the RYR1 protein and was previously found to harbour three CCD-related mutations (2123). Aberrant fragments were observed in the DNA from seven patients in exon 101 and from six patients in exon 102. No variant SSCA patterns were found in exons 98–100 and 103, respectively. Direct sequencing of aberrant PCR fragments revealed a total of five heterozygous sequence variants, all leading to the substitution of single amino acids which are conserved in all known vertebrate RYR genes (Fig. 1). The novel mutation Arg4861His was found in five multiplex pedigrees and two simplex cases of German and Austrian origin, respectively. The mutation Ile4898Thr (21) was observed in two Italian and one Swiss–Italian pedigree. The remaining three novel mutations were found only once: Gly4891Arg in one German patient, Gly4899Arg in an Italian multiplex pedigree and Ala4906Val in another German patient. The candidate mutations were shown to be absent in 50 control individuals. In nine pedigrees, affected and unaffected family members of the index cases were available and were screened for the respective mutation by restriction analysis or sequencing. In all instances, the familial mutation segregated perfectly with the disease (Table 1). No relatives of the remaining four index cases were available for study. Thus, in our cohort, there is no case of a proven de novo RYR1 mutation.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 1. Alignment of the C-terminal amino acid sequences of nine vertebrate RYR genes. Identical amino acids are indicated by a horizontal dash. The last line shows the substitutions found in CCD patients.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Clinical and molecular data of 25 patients with well documented CCD
 
Functional studies of cells expressing the mutated RYR1 calcium channel
Since circulating B-lymphocytes and EBV-immortalized B-cell lines express a functional type 1 RYR calcium release channel (25), we established cell lines from patients carrying three of the above mutations (Arg4861His, Ile4898Thr and Gly4899Arg) and studied their intracellular Ca2+ homeostasis. We were also able to include a cell line from another CCD patient carrying the Arg4893Trp mutation (C.Sewry, unpublished data). The presence of the RYR1 gene mutation in the cell lines was checked by PCR amplification and restriction enzyme digestion (not shown). We next loaded the cells with the fluorescent calcium indicator fura-2 and studied their [Ca2+]i in nominally Ca2+-free EGTA-containing Krebs-Ringer buffer. Figure 2 shows that cells harbouring the RYR1 mutations Arg4893Trp (Fig. 2B), Arg4861His (Fig. 2C), Ile4898Thr (Fig. 2D) and Gly4899Arg (Fig. 2E) released calcium from intracellular stores when placed in Krebs-Ringer medium containing 0.5 mM EGTA. This increase in [Ca2+]i was not an artefact since: (i) changes in fluorescence occurred at both wavelengths (at 340 nm the fluorescence increased whereas at 380 nm the fluorescence decreased); (ii) the increase in fluorescence ratio varied among the different cells and did not occur in cells from control individuals (Fig. 2A) nor in cells carrying RYR1 mutations which have been linked to MH (not shown); (iii) the [Ca2+]i returned to basal levels; and (iv) cells in which this release occurred had smaller thapsigargin-induced increases in [Ca2+]i. In fact, the intracellular calcium pool from which the calcium was being released was endowed with a SERCA type Ca-ATPase. When we compared the peak Ca2+ released by 400 nM thapsigargin, the cells harbouring the four CCD-linked mutations released significantly less calcium (Fig. 3), indicating that their stores had previously been depleted. No difference was observed in the thapsigargin-sensitive stores of cells from controls or individuals carrying the MH-associated Val2168Met mutation (Fig. 3).



View larger version (21K):
[in this window]
[in a new window]
 
Figure 2. EBV-immortalized B cells from CCD patients carrying the Arg4893Trp, Arg4861His, Ile4898Thr and Gly4899Arg mutations ‘spontaneously’ release calcium from intracellular stores. Cells were loaded with the fluorescent calcium indicator fura-2/AM as described in Materials and Methods. Prior to the [Ca2+]i measurements, 0.7 x 106 cells/ml were centrifuged, resuspended in nominally Ca2+-free Krebs-Ringer buffer containing 0.5 mM EGTA, placed in the fluorimeter cuvette and the [Ca2+]i was recorded. Lymphoblastoid cells from patients with the newly identified mutations exhibited an increase in their [Ca2+]i, in the absence of exogenous trigger agents (BE), whereas cells from controls did not exhibit this Ca2+ release (A). Where indicated, 400 nM thapsigargin was added. Traces are representative of experiments carried out at least five times on different days.

 


View larger version (19K):
[in this window]
[in a new window]
 
Figure 3. The thapsigargin-sensitive [Ca2+]i stores of EBV-immortalized cells from CCD patients carrying the novel mutations are significantly smaller than those from control individuals and patients carrying the RYR1 Val2168Met mutation. Conditions as described in Figure 2. The peak [Ca2+]i induced by the addition of 400 nM thapsigargin was calculated as increase in fluorescence ratio. Results are the means (± SD) of the indicated number of experiments. No difference in the thapsigargin-sensitive stores of cells from control individuals and from patients with the Val2168Met mutation was observed (ANOVA: *P < 0.03; **P < 0.0001).

 
We next tested the sensitivity of lymphoblastoid cells carrying the newly identified RYR1-mutations to the RYR-activator 4-chloro-m-cresol. This compound has been shown to activate type 1 and 2 RYR but has no effect on type 3 RYR (2628). When lymphoblastoid cells from CCD patients were stimulated with 300 µM 4-chloro-m-cresol in nominally Ca2+-free EGTA-containing Krebs-Ringer buffer, almost no increase in the [Ca2+]i was observed (Fig. 4A). In contrast, the addition of 300 µM 4-chloro-m-cresol to lymphoblastoid cells from control individuals (Fig. 4B) or from an individual harbouring the MHS mutation Val2168Met (Fig. 4C) caused a substantial increase in the [Ca2+]i. This result supports the view that the calcium released from lymphoblastoid cells of CCD patients in the absence of a pharmacological trigger, probably comes from a RYR1-endowed (4-chloro-m-cresol sensitive) intracellular pool.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 4. Addition of 4-chloro-m-cresol to EBV-immortalized B cells from a CCD patient carrying the Arg4861His results in a smaller release of calcium from intracellular stores compared to that observed in B cells from control groups. Conditions as described in Figure 2. (A) Representative trace from lymphoblastoid cells from an individual carrying the CCD associated Arg4861His RYR1 mutation. (B) Representative trace from lymphoblastoid cells from a control individual and (C) from an individual carrying the Val2168Met RYR1 gene mutation associated with the MHS phenotype. Traces are representative of at least three experiments.

 
Finally, in order to confirm that the ‘unprompted’ calcium release was due to a leaky RYR channel, we carried out experiments in the presence of dantrolene, a specific inhibitor of the skeletal muscle ryanodine receptor (29,30). When cells carrying the newly identified RYR1 mutations were resuspended in Ca2+-free, EGTA-containing medium plus 10 µM dantrolene, the transient increase in [Ca2+]i was abolished (Fig. 5A, bottom). Furthermore, the addition of 400 nM thapsigargin to dantrolene pre-treated lymphoblastoid cells carrying the RYR1 mutation caused a larger increase in [Ca2+]i than that observed in non-dantrolene-treated cells (Fig. 5A, top and bottom). Figure 5B shows that the pre-treatment of lymphoblastoid cells carrying the Arg4861His or the Gly4899Arg mutations with 10 µM dantrolene (hatched boxes) significantly increased the peak [Ca2+]i induced by thapsigargin, restoring the [Ca2+]i to levels similar to those seen in cells from control individuals or individuals carrying the MHS1-associated Val2168Met mutation.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 5. Dantrolene blocks the Ca2+ release from intracellular stores observed in the absence of pharmacological activators and increases the peak calcium released by thapsigargin. Conditions as described in Figure 2. (A) Representative traces from lymphoblastoid cells of an individual carrying the CCD associated Arg4861His RYR1 mutation. Top, the addition of thapsigargin (arrow) after the unprompted calcium release induces a small release of calcium from intracellular calcium stores. Bottom, pre-treatment of cells with 10 µM dantrolene (first arrow) blocks the unprompted calcium release and increases the thapsigargin-induced peak Ca2+ release. (B) Peak Ca2+ induced by thapsigargin in cells from patients carrying the Arg4861His and Gly4899Arg RYR1 mutations is significantly higher in cells pre-treated with 10 µM dantrolene (hatched bars) than in untreated cells. Results are expressed as means (± SD) of experiments carried out five and three times on cells + 10 µM dantrolene carrying the Arg4861His and Gly4899arg mutation, respectively (Student’s t-test for paired samples: *P < 7 x 10–8; **P < 0.017).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In the present work, we have screened 50 individuals of European origin diagnosed as having CCD and identified five different sequence changes in 13 individuals. The presumed mutations cluster in exons 101 and 102 of the RYR1 gene. Arg4861His, Gly4891Arg, Gly4899Arg and Ala4906Val are described here for the first time. The fifth mutation, Ile4898Thr was originally identified in a large Mexican kindred with early onset and severe CCD but was thought to be a ‘private mutation’ restricted to this Mexican family (21). We have found this mutation in three apparently unrelated pedigrees of presumed Italian ancestry. Likewise, the Arg4861His mutation was observed in seven German and Austrian index cases. Therefore, these two mutations may represent founder mutations in the European CCD population. All other mutations described here have been detected in single patients or families. Recently, two other point mutations between amino acids 4637 and 4898 have been reported in CCD patients (22,23), making the C-terminal domain of the RYR1 a hot spot region for CCD causing mutations.

Our evidence that the resulting amino acid substitutions are causal of CCD is as follows: (i) the substituted residues are conserved in all known vertebrate RYR genes of type 1, 2 and 3; (ii) the sequence changes co-segregate with the disease in nine multiplex pedigrees; (iii) they are absent from 100 control chromosomes; and (iv) the intracellular calcium homeostasis of lymphoblastoid cells derived from mutation carriers is significantly different from that of controls.

Three of the newly identified mutations result in loss or gain of a positively charged arginine residue, the most frequently observed pathological mutation in RYR1 (31). Two missense substitutions occurred in CpG dinucleotides (Arg4861His, Ala4906Val) of the coding strand, a finding which is in line with the observation that most mutations, but not polymorphisms, in the RYR1 gene occur in CpG dinucleotide sequences (20).

So far, mutations found in the RYR1 gene appear to cluster in specific domains: mutations in the N-terminal regions 1 and 2 are associated with MHS and/or CCD whereas mutations in the C-terminal region 3 seem to be mainly associated with CCD. The functional analysis of cells transfected with cDNA encoding RYR1 mutations in the N-terminal domain have demonstrated that the Ca2+ release channel of such cells is significantly more sensitive to caffeine than that of cells expressing wild-type RYR1 channels (32,33). This hypersensitivity is in line with the clinical symptoms of MHS individuals whose muscles are hyper-reactive to activators of the ryanodine receptor, but is at odds with the clinical features of CCD whose predominant symptoms are chronic muscle weakness and hypotonia.

In this work, we used a novel ex vivo approach to study the effect of RYR1-linked mutations. We took advantage of the fact that B-lymphocytes express the skeletal muscle isoform of this Ca2+ channel (25; Girard et al., manuscript submitted for publication) and were able to study the calcium homeostasis of lymphoblastoid cells from CCD patients with four C-terminal RYR1 mutations. Our results show that cells carrying the endogenous, heterozygous Ile4898Thr mutation have significantly smaller Ca2+ stores than cells carrying a wild-type RYR1 or the MHS-linked mutation Val2168Met. Our data support those of Lynch et al. (21) who transfected human embryonic kidney cells (HEK-293) and found that the expression of the Ile4898Thr cDNA resulted in reduction of thapsigargin-induced Ca2+ release. In contrast, Avila et al. (34) showed that dyspedic mouse skeletal muscle myotubes injected with the RYR1 cDNA carrying the same mutation were ‘uncoupled’, i.e. membrane depolarization was not accompanied by Ca2+ release from the SR, though the resting calcium concentration was not different from control myotubes. This apparent discrepancy may be due to the fact that in skeletal muscle cells, the SR Ca-ATPase is able to compensate for ‘excessive’ leakage through the mutated channel and other downstream effects. In the case of HEK-293 cells or EBV-immortalized B-lymphocytes on the other hand, the Ca2+ pump may not be able to compensate for the excessive leakage, resulting in a net Ca2+ efflux from the endoplasmic reticulum. It should be noted that the ryanodine receptor must assemble into a tetrameric structure in order to function as a calcium channel. Therefore, it is likely that the calcium channels in lymphoblastoid cells from CCD patients are composed of normal and mutated subunits.

Although the single channel properties of the RYR1 carrying the Ile4898Thr mutation are still not known, there is other evidence that substitution of this hydrophobic residue has a strong effect on the properties of the calcium release channel. Gao et al. (35) demonstrated that substitution of Ile4898 by Ala, Val or Leu, results in a channel which remains blocked in sub-conductance states and fails to close even in the presence of EGTA, i.e. at a free calcium concentration far below that of living cells. This would result in increased leakage of Ca2+ from intracellular stores. Likewise, substitutions of other amino acids in this region of the RYR1 cDNA, which is thought to make up the pore structure, should have similar effects and in fact our results show that lymphoblastoid cells from patients carrying the Gly4899Arg, Arg4893Trp and Arg4861His mutations all have reduced thapsigargin-sensitive Ca2+ stores. It should be noted that: (i) the [Ca2+]i measurements were carried out in a population of cells; (ii) all the cell lines which were established from CCD patients exhibited a release of calcium from intracellular stores in the absence of pharmacological activators of the RYR; (iii) all experiments described in the present work were carried out in calcium-free/EGTA-containing medium, thus once the intracellular calcium stores of the cells had been depleted they could not be re-filled, leading to a single transient in the [Ca2+]i.

The addition of 4-chloro-m-cresol, a specific activator of type 1 and 2 RYR (2628), failed to elicit an increase in the [Ca2+]i of the CCD-derived lymphoblasts indicating that the RYR1-containing intracellular stores had already been depleted. Such unprompted calcium transients were never seen in cell lines of control individuals or individuals carrying the MHS-linked mutation Val2168Met (Girard et al., manuscript submitted for publication). Transients could be blocked by the addition of dantrolene, a specific inhibitor of the skeletal muscle ryanodine receptor (29,30). Furthermore, dantrolene pre-treatment of CCD lymphoblasts restored the thapsigargin-induced Ca2+-peak to control levels supporting the view that the smaller intracellular calcium stores observed in these cells are due to a leaky RYR calcium channel.

Whatever mechanism is responsible for this increase in leakiness, we found that lymphoblastoid cells carrying CCD-associated mutations in domain 3 of the RYR1 exhibit release of [Ca2+]i in the absence of pharmacological activators of a RYR1; this may be a distinguishing feature of cells with mutations in the pore region of the RYR1 calcium channel. If the situation were similar in CCD muscle, lower sarcoplasmic and higher cytosolic Ca2+ concentrations could readily explain the predominant symptom of chronic muscle weakness.

In conclusion, our data suggest a new mutational hot spot for CCD in the C-terminal domain of the RYR1 and confirm the importance of the transmembrane/luminal region (region 3) in channel function. Therefore, this region should be considered as the prime target for mutation screening in CCD patients. The ‘ectopic’ expression of RYR1 in lymphoblastoid cells from patients can be used as a non-invasive approach to test the function of presumed RYR1 mutations ex vivo and to further our understanding of the pathophysiology of CCD.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Patient selection
The patients are a cohort of unselected persons from various European neuromuscular and genetic centres (who are not part of a study) diagnosed clinically and/or histologically as having CCD. DNA samples from 50 unrelated patients were collected after informed consent. Nine patients are members of multiplex pedigrees which had been used previously for linkage studies (36) (Table1). Detailed clinical and histopathological records which fulfilled the accepted criteria for CCD (37) were available from 21 patients. A summary of these data is given in Table 1. Medical documentation of the remaining cases was incomplete and is not detailed here. Mutations were found in four patients from the latter group and these are also included in Table 1.

Mutation screening
PCR amplification of exons 98, 99, 100, 101, 102 and 103 of RYR1 was performed on 200 ng genomic DNA under standard PCR conditions (denaturation at 95°C for 5 min followed by 30 cycles of 95°C for 30 s, annealing at primer-specific annealing temperatures for 30 s, extension at 72°C for 30 s and a final extension step of 72°C for 5 min). Primer sequences, PCR product sizes and annealing temperatures were as follows: exon 98F, tgtgtctacacagcctgatgc/98R, ggggagagatgcttgagtgt/243 bp/59°C; exon 99F, ctggtgagcccaggacac/99R, agagtccctccccagtctgt/193 bp/59°C; exon 100F, agagtgctcctcgtgtgtcc/100R, tatcccttcaccacccactg/275 bp/61°C; exon 101F, ggtagagccacagggactga/101R, gagaaggaagggtcccagag/276 bp/63°C; exon 102F, aatgtcgaatgaatgcgtga/102R, ctgggcctgcattcttagc/268 bp/55°C; exon 103F, aagccctggaggtaggtagc/103R, tgaatcccgtaatccctctg/191 bp/59°C. Screening for mutations was performed by SSCA (38). Fragments were labelled by incorporation of 32P-dCTP during PCR. After heat denaturation the single strands were separated on a 6% polyacrylamide gel with or without 10% glycerol in the monomer mixture. Electrophoresis was run at 6°C. PCR fragments with aberrant SSCA patterns were directly sequenced using the forward and reverse primers of the amplification reaction and a terminator cycle sequencing kit (Thermo Sequenase kit; Amersham Life Science, Freiburg, Germany) with 33P-ddNTPs.

To test for the segregation of a mutation in the family, DNA from the available relatives (affected and unaffected) of the index patients was analysed by mutation-specific restriction enzyme digestion using AciI for Arg4861His, BsrI for Ile4898Thr and SacII for Ala4906Val, and by direct sequencing for the remaining two mutations.

Lymphoblastoid cell lines
Mononuclear cells were isolated from peripheral blood leukocytes and EBV-transformed according to the protocol of Neitzel (39). Cells were cultured in RPMI medium supplemented with 10% fetal calf serum, 2 mM L-glutamine and 100 Units of penicillin and streptomycin.

Intracellular Ca2+ measurements
Changes in the intracellular calcium concentration of the lymphoblastoid cells were monitored with the fluorescent calcium indicator fura-2/AM (Sigma, St Louis, MO) (final concentration 5 µM) as described by Zorzato et al. (26) and Grynkiewicz et al. (40). Fura-2 loaded cells (0.7 x 106/ml) were washed once by centrifugation, resuspended in Ca2+-free Krebs-Ringer medium containing 0.5 mM EGTA and placed in a cuvette thermostated at 37°C. Fluorescence changes (ratio 340/380 nm) were measured in a Perkin-Elmer spectrofluorimeter equipped with a magnetic stirrer. All measurements were made in Ca2+-free Krebs-Ringer buffer containing 0.5 mM EGTA. Experiments were performed at least four times on two different days. Where indicated 300 µM 4-chloro-m-cresol (Fluka Chemicals, Buchs, Switzerland), 400 nM thapsigargin (Sigma) or 10 µM dantrolene (Procter and Gamble Pharmaceuticals, Weiterstadt, Germany) were added.

Statistical methods
Data are expressed as means ± SD. The peak Ca2+ released by thapsigargin in cells from controls or individuals carrying the Val2168Met, Arg4893Trp, Arg4861His, Ile4898Thr and Gly4899Arg RYR1 mutations was compared using one-way ANOVA. Where significant, Fishers’s protected least significant difference (PLSD) post hoc test was performed. Peak Ca2+ released by thapsigargin in the presence or absence of dantrolene were compared using the Student’s t-test for paired samples. Significance was set to 5%.


    ACKNOWLEDGEMENTS
 
We greatly appreciate the co-operation of the many CCD patients and their doctors who contributed individual samples to this study. We would like to thank Dr Thierry Girard for helpful discussions. This work was supported by grants from Telethon Italy (no. 1259) and the Department of Anaesthesia, Kantonsspital Basel.


    FOOTNOTES
 
+ To whom correspondence should be addressed. Tel: +49 931 888 4063; Fax: +49 931 888 4069; Email: crm@biozentrum.uni-wuerzburg.de Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
1 Shy, G.M. and Magee, K.R. (1956) A new congenital non-progressive myopathy. Brain, 79, 160–160.

2 Isaacs, H., Heffron, J.J. and Badenhorst, M. (1975) Central core disease. A correlated genetic, histochemical, ultramicroscopic and biochemical study. J. Neurol. Neurosurg. Psychiatry, 38, 1177–1186.[Abstract/Free Full Text]

3 Shuaib, A., Paasuke, R.T. and Brownell, K.W. (1987) Central core disease. Clinical features in 13 patients. Medicine (Baltimore), 66, 389–396.[Medline]

4 Hayashi, K., Miller, R.G. and Brownell, A.K. (1989) Central core disease: ultrastructure of the sarcoplasmic reticulum and T-tubules. Muscle Nerve, 12, 95–102.[Web of Science][Medline]

5 Greenfield, J.G., Cornman, T. and Shy, G.M. (1958) The prognostic value of the muscle biopsy in the ‘floppy infant’. Brain, 81, 461.[Free Full Text]

6 Larach, M.G., Localio, A.R., Allen, G.C., Denborough, M.A., Ellis, F.R., Gronert, G.A., Kaplan, R.F., Muldoon, S.M., Nelson, T.E., Ording, H. et al. (1994) A clinical grading scale to predict malignant hyperthermia susceptibility. Anesthesiology, 80, 771–779.[Web of Science][Medline]

7 MacLennan, D.H. and Phillips, M.S. (1992) Malignant hyperthermia. Science, 256, 789–794.[Abstract/Free Full Text]

8 Jurkat-Rott, K., McCarthy, T. and Lehmann-Horn, F. (2000) Genetics and pathogenesis of malignant hyperthermia. Muscle Nerve, 23, 4–17.[Web of Science][Medline]

9 Mickelson, J.R., Gallant, E.M., Litterer, L.A., Johnson, K.M., Rempel, W.E. and Louis, C.F. (1988) Abnormal sarcoplasmic reticulum ryanodine receptor in malignant hyperthermia. J. Biol. Chem., 263, 9310–9315.[Abstract/Free Full Text]

10 MacKenzie, A.E., Korneluk, R.G., Zorzato, F., Fujii, J., Phillips, M., Iles, D., Wieringa, B., Leblond, S., Bailly, J., Willard, H.F. et al. (1990) The human ryanodine receptor gene: its mapping to 19q13.1, placement in a chromosome 19 linkage group and exclusion as the gene causing myotonic dystrophy. Am. J. Hum. Genet., 46, 1082–1089.[Web of Science][Medline]

11 McCarthy, T.V., Healy, J.M., Heffron, J.J., Lehane, M., Deufel, T., Lehmann-Horn, F., Farrall, M. and Johnson, K. (1990) Localization of the malignant hyperthermia susceptibility locus to human chromosome 19q12–13.2. Nature, 343, 562–564.[Medline]

12 Iles, D.E., Lehmann-Horn, F., Scherer, S.W., Tsui, L.C., Olde Weghuis, D., Suijkerbuijk, R.F., Heytens, L., Mikala, G., Schwartz, A., Ellis, F.R. et al. (1994) Localization of the gene encoding the {alpha}2/{Delta}-subunits of the L-type voltage-dependent calcium channel to chromosome 7q and analysis of the segregation of flanking markers in malignant hyperthermia susceptible families. Hum. Mol. Genet., 3, 969–975.[Abstract/Free Full Text]

13 Sudbrak, R., Procaccio, V., Klausnitzer, M., Curran, J.L., Monsieurs, K., van Broeckhoven, C., Ellis, R., Heyetens, L., Hartung, E.J., Kozak-Ribbens, G. et al. (1995) Mapping of a further malignant hyperthermia susceptibility locus to chromosome 3q13.1. Am. J. Hum. Genet., 56, 684–691.[Web of Science][Medline]

14 Monnier, N., Procaccio, V., Stieglitz, P. and Lunardi, J. (1997) Malignant-hyperthermia susceptibility is associated with a mutation of the {alpha}1-subunit of the human dihydropyridine-sensitive L-type voltage-dependent calcium-channel receptor in skeletal muscle. Am. J. Hum. Genet., 60, 1316–1325.[Web of Science][Medline]

15 Robinson, R.L., Monnier, N., Wolz, W., Jung, M., Reis, A., Nuernberg, G., Curran, J.L., Monsieurs, K., Stieglitz, P., Heytens, L. et al. (1997) A genome wide search for susceptibility loci in three European malignant hyperthermia pedigrees. Hum. Mol. Genet., 6, 953–961.[Abstract/Free Full Text]

16 Phillips, M.S., Fujii, J., Khanna, V.K., DeLeon, S., Yokobata, K., de Jong, P.J. and MacLennan, D.H. (1996) The structural organization of the human skeletal muscle ryanodine receptor (RYR1) gene. Genomics, 34, 24–41.[Web of Science][Medline]

17 Takeshima, H., Nishimura, S., Matsumoto, T., Ishida, H., Kangawa, K., Minamino, N., Matsuo, H., Ueda, M., Hanaoka, M., Hirose, T. et al. (1989) Primary structure and expression from complementary DNA of skeletal muscle ryanodine receptor. Nature, 339, 439–445.[Medline]

18 Zorzato, F., Fujii, J., Otsu, K., Phillips, M., Green, N.M., Lai, F.A., Meissner, G. and MacLennan, D.H. (1990) Molecular cloning of cDNA encoding human and rabbit forms of the Ca2+ release channel (ryanodine receptor) of skeletal muscle sarcoplasmic reticulum. J. Biol. Chem., 265, 2244–2256.[Abstract/Free Full Text]

19 Samso, M. and Wagenknecht, T. (1998) Contributions of electron microscopy and single-particle techniques to the determination of the ryanodine receptor three-dimensional structure. J. Struct. Biol., 121, 172–180.[Web of Science][Medline]

20 McCarthy, T.V., Quane, K.A. and Lynch, P.J. (2000) Ryanodine receptor mutations in malignant hyperthermia and central core disease. Hum. Mutat., 15, 410–417.[Web of Science][Medline]

21 Lynch, P.J., Tong, J., Lehane, M., Mallet, A., Giblin, L., Heffron, J.J., Vaughan, P., Zafra, G., MacLennan, D.H. and McCarthy, T.V. (1999) A mutation in the transmembrane/luminal domain of the ryanodine receptor is associated with abnormal Ca2+ release channel function and severe central core disease. Proc. Natl Acad. Sci. USA, 96, 4164–4169.[Abstract/Free Full Text]

22 Scacheri, P.C., Hoffman, E.P., Fratkin, J.D., Semino-Mora, C., Senchak, A., Davis, M.R., Laing, N.G., Vedanarayanan, V. and Subramony, S.H. (2000) A novel ryanodine receptor gene mutation causing both cores and rods in congenital myopathy. Neurology, 55, 1689–1696.[Abstract/Free Full Text]

23 Monnier, N., Romero, N.B., Lerale, J., Nivoche, Y., Qi, D., MacLennan, D.H., Fardeau, M. and Lunardi, J. (2000) An autosomal dominant congenital myopathy with cores and rods is associated with a neomutation in the RYR1 gene encoding the skeletal muscle ryanodine receptor. Hum. Mol. Genet., 9, 2599–2608.[Abstract/Free Full Text]

24 Brown, R.L., Pollock, A.N., Couchman, K.G., Hodges, M., Hutchinson, D.O., Waaka, R., Lynch, P., McCarthy, T.V. and Stowell, K.M. (2000) A novel ryanodine receptor mutation and genotype–phenotype correlation in a large malignant hyperthermia New Zealand Maori pedigree. Hum. Mol. Genet., 9, 1515–1524.[Abstract/Free Full Text]

25 Sei, Y., Gallagher, K.L. and Basile, A.S. (1999) Skeletal muscle type ryanodine receptor is involved in calcium signaling in human B lymphocytes. J. Biol. Chem., 274, 5995–6002.[Abstract/Free Full Text]

26 Zorzato, F., Scutari, E., Tegazzin, V., Clementi, E. and Treves, S. (1993) Chlorocresol: an activator of ryanodine receptor-mediated Ca2+ release. Mol. Pharmacol., 44, 1192–1201.[Abstract]

27 Herrmann-Frank, A., Richter, M., Sarkozi, S., Mohr, U. and Lehmann-Horn F. (1996) 4-Chloro-m-cresol, a potent and specific activator of the skeletal muscle ryanodine receptor. Biochim. Biophys. Acta, 1289, 31–40.[Medline]

28 Fessenden, J.D., Wang, Y., Moore, R.A., Chen, S.R., Allen, P.D. and Pessah, I.N. (2000) Divergent functional properties of ryanodine receptor types 1 and 3 expressed in a myogenic cell line. Biophys. J., 79, 2509–2525.[Web of Science][Medline]

29 Paul-Pletzer, K., Palnitkar, S.S., Jimenez, L.S., Morimoto, H. and Parness, J. (2001) The skeletal muscle ryanodine receptor identified as a molecular target of [3H]-azidodantrolene by photoaffinity labeling. Biochemistry, 40, 531–542.[Medline]

30 Zhao, F., Li, P., Chen, S.R., Louis, C.F. and Fruen, B.R. (2001) Dantrolene inhibition of ryanodine receptor Ca2+ release channels. Molecular mechanism and isoform selectivity. J. Biol. Chem., 276, 13810–13816.[Abstract/Free Full Text]

31 Loke, J. and MacLennan, D.H. (1998) Malignant hyperthermia and central core disease: disorders of Ca2+ release channels. Am. J. Med., 104, 470–486.[Web of Science][Medline]

32 Tong, J., Oyamada, H., Demaurex, N., Grinstein, S., McCarthy, T.V. and MacLennan, D.H. (1997) Caffeine and halothane sensitivity of intracellular Ca2+ release is altered by 15 calcium release channel (ryanodine receptor) mutations associated with malignant hyperthermia and/or central core disease. J. Biol. Chem., 272, 26332–26339.[Abstract/Free Full Text]

33 Tong, J., McCarthy, T.V. and MacLennan, D.H. (1999) Measurement of resting cytosolic Ca2+ concentrations and Ca2+ store size in HEK-293 cells transfected with malignant hyperthermia or central core disease mutant Ca2+ release channels. J. Biol. Chem., 274, 693–702.[Abstract/Free Full Text]

34 Avila, G., O’Brien, J.J. and Dirksen, R.T. (2001) Excitation–contraction uncoupling by a human central core disease mutation in the ryanodine receptor. Proc. Natl Acad. Sci. USA, 98, 4215–4220.[Abstract/Free Full Text]

35 Gao, L., Tripathy, A., Lu, X. and Meissner, G. (1997) Evidence for a role of C-terminal amino acid residues in skeletal muscle Ca2+ release channel (ryanodine receptor) function. FEBS Lett., 412, 223–226.[Web of Science][Medline]

36 Schwemmle, S., Wolff, K., Palmucci, L.M., Grimm, T., Lehmann-Horn, F., Hubner, C., Hauser, E., Iles, D.E., MacLennan, D.H. and Muller, C.R. (1993) Multipoint mapping of the central core disease locus. Genomics, 17, 205–207.[Web of Science][Medline]

37 Middelton, L.T. and Moser, H. (1994) Diagnostic Criteria for Neuromuscular Disorders. European Neuromuscular Centre, Baarn, The Netherlands, pp. 70–72.

38 Orita, M., Iwahana, H., Kanazawa, H., Hayashi, K. and Sekiya, T. (1989) Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphisms. Proc. Natl Acad. Sci. USA, 86, 2766–2770.[Abstract/Free Full Text]

39 Neitzel, H. (1986) A routine method for the establishment of permanent growing lymphoblastoid cell lines. Hum. Genet., 73, 320–326.[Web of Science][Medline]

40 Grynkiewicz, G., Poenie, M. and Tsien, R.Y. (1985) A new generation of Ca2+ indicators with greatly improved fluorescence properties. J. Biol. Chem., 260, 3440–3450.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
T. R. Shannon
Ryanodine receptor Ca2+ sensitivity and excitation-contraction coupling in muscular dystrophy and heart failure: similar and yet different
Am J Physiol Heart Circ Physiol, December 1, 2009; 297(6): H1965 - H1966.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Xu, Y. Wang, N. Yamaguchi, D. A. Pasek, and G. Meissner
Single Channel Properties of Heterotetrameric Mutant RyR1 Ion Channels Linked to Core Myopathies
J. Biol. Chem., March 7, 2008; 283(10): 6321 - 6329.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
E. Zvaritch, F. Depreux, N. Kraeva, R. E. Loy, S. A. Goonasekera, S. Boncompagni, A. Kraev, A. O. Gramolini, R. T. Dirksen, C. Franzini-Armstrong, et al.
An Ryr1I4895T mutation abolishes Ca2+ release channel function and delays development in homozygous offspring of a mutant mouse line
PNAS, November 20, 2007; 104(47): 18537 - 18542.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
D. Fischer, M. Herasse, A. Ferreiro, H. M. Barragan-Campos, J. Chiras, L. Viollet, S. Maugenre, J. -P. Leroy, N. Monnier, J. Lunardi, et al.
Muscle imaging in dominant core myopathies linked or unlinked to the ryanodine receptor 1 gene
Neurology, December 26, 2006; 67(12): 2217 - 2220.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Zhao, N. Weisleder, X. Han, Z. Pan, J. Parness, M. Brotto, and J. Ma
Azumolene Inhibits a Component of Store-operated Calcium Entry Coupled to the Skeletal Muscle Ryanodine Receptor
J. Biol. Chem., November 3, 2006; 281(44): 33477 - 33486.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
H. Zhou, N. Yamaguchi, L. Xu, Y. Wang, C. Sewry, H. Jungbluth, F. Zorzato, E. Bertini, F. Muntoni, G. Meissner, et al.
Characterization of recessive RYR1 mutations in core myopathies
Hum. Mol. Genet., September 15, 2006; 15(18): 2791 - 2803.
[Abstract] [Full Text] [PDF]


Home page
BrainHome page
S. Wu, M C. A. Ibarra, M. C. V. Malicdan, K. Murayama, Y. Ichihara, H. Kikuchi, I. Nonaka, S. Noguchi, Y. K. Hayashi, and I. Nishino
Central core disease is due to RYR1 mutations in more than 90% of patients
Brain, June 1, 2006; 129(6): 1470 - 1480.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Ducreux, F. Zorzato, C. Muller, C. Sewry, F. Muntoni, R. Quinlivan, G. Restagno, T. Girard, and S. Treves
Effect of Ryanodine Receptor Mutations on Interleukin-6 Release and Intracellular Calcium Homeostasis in Human Myotubes from Malignant Hyperthermia-susceptible Individuals and Patients Affected by Central Core Disease
J. Biol. Chem., October 15, 2004; 279(42): 43838 - 43846.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
S Shepherd, F Ellis, J Halsall, P Hopkins, and R Robinson
RYR1 mutations in UK central core disease patients: more than just the C-terminal transmembrane region of the RYR1 gene
J. Med. Genet., March 1, 2004; 41(3): e33 - 33.
[Full Text] [PDF]


Home page
Br J AnaesthHome page
R. R. Johi, R. Mills, P. J. Halsall, and P. M. Hopkins
Anaesthetic management of coronary artery bypass grafting in a patient with central core disease and susceptibility to malignant hyperthermia on statin therapy
Br. J. Anaesth., November 1, 2003; 91(5): 744 - 747.
[Abstract] [Full Text] [PDF]


Home page
BrainHome page
N. B. Romero, N. Monnier, L. Viollet, A. Cortey, M. Chevallay, J. P. Leroy, J. Lunardi, and M. Fardeau
Dominant and recessive central core disease associated with RYR1 mutations and fetal akinesia
Brain, November 1, 2003; 126(11): 2341 - 2349.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
N. Monnier, A. Ferreiro, I. Marty, A. Labarre-Vila, P. Mezin, and J. Lunardi
A homozygous splicing mutation causing a depletion of skeletal muscle RYR1 is associated with multi-minicore disease congenital myopathy with ophthalmoplegia
Hum. Mol. Genet., May 15, 2003; 12(10): 1171 - 1178.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
A. Tammaro, A. Bracco, S. Cozzolino, M. Esposito, A. Di Martino, G. Savoia, L. Zeuli, G. Piluso, S. Aurino, and V. Nigro
Scanning for Mutations of the Ryanodine Receptor (RYR1) Gene by Denaturing HPLC: Detection of Three Novel Malignant Hyperthermia Alleles
Clin. Chem., May 1, 2003; 49(5): 761 - 768.
[Abstract] [Full Text] [PDF]


Home page
JGPHome page
G. Avila, K. M. S. O'Connell, and R. T. Dirksen
The Pore Region of the Skeletal Muscle Ryanodine Receptor Is a Primary Locus for Excitation-Contraction Uncoupling in Central Core Disease
J. Gen. Physiol., March 31, 2003; 121(4): 277 - 286.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
F. Zorzato, N. Yamaguchi, L. Xu, G. Meissner, C. R. Muller, P. Pouliquin, F. Muntoni, C. Sewry, T. Girard, and S. Treves
Clinical and functional effects of a deletion in a COOH-terminal lumenal loop of the skeletal muscle ryanodine receptor
Hum. Mol. Genet., February 15, 2003; 12(4): 379 - 388.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
D. Jiang, B. Xiao, L. Zhang, and S.R. W. Chen
Enhanced Basal Activity of a Cardiac Ca2+ Release Channel (Ryanodine Receptor) Mutant Associated With Ventricular Tachycardia and Sudden Death
Circ. Res., August 9, 2002; 91(3): 218 - 225.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
H. Jungbluth, C. R. Muller, B. Halliger-Keller, M. Brockington, S. C. Brown, L. Feng, A. Chattopadhyay, E. Mercuri, A. Y. Manzur, A. Ferreiro, et al.
Autosomal recessive inheritance of RYR1 mutations in a congenital myopathy with cores
Neurology, July 23, 2002; 59(2): 284 - 287.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (55)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Tilgen, N.
Right arrow Articles by Treves, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tilgen, N.
Right arrow Articles by Treves, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?