Human Molecular Genetics, 2001, Vol. 10, No. 25 2953-2960
© 2001 Oxford University Press
Interaction between krit1 and icap1
infers perturbation of integrin ß1-mediated angiogenesis in the pathogenesis of cerebral cavernous malformation
Howard Hughes Medical Institute and The Institute of Genetic Medicine, 1Department of Neurological Surgery, The Johns Hopkins University School of Medicine, Baltimore, MD 21205, USA and 2Department of Medicine, Department of Microbiology, Department of Immunology, Department of Molecular Genetics and Jonsson Comprehensive Cancer Center, UCLA School of Medicine, Los Angeles, CA 90095, USA
Received September 24, 2001; Revised and Accepted October 9, 2001.
| ABSTRACT |
|---|
|
|
|---|
Cerebral cavernous malformation (CCM) is a common autosomal dominant disorder characterized by venous sinusoids that predispose to intracranial hemorrhage. CCM is genetically heterogeneous, with loci at 7q, 7p and 3q. Mutations in KRIT1 account for all cases linked to 7q (CCM1), but the pathogenesis of CCM is not understood. Krev Interaction Trapped 1 (krit1) was originally identified through its interaction with the Ras-family GTPase krev1/rap1a in a two-hybrid screen, inferring a role in GTPase signaling cascades. We demonstrated additional 5'-coding exons for krit1, extending the N-terminus by 207 amino acids compared to the previously reported protein. Remarkably, by two-hybrid analysis and co-immunoprecipitation, full-length krit1 fails to interact with krev1/rap1a but shows strong interaction with integrin cytoplasmic domain-associated protein-1 (icap1). Icap1 binds to a NPXY motif in the cytoplasmic domain of ß1 integrin and participates in ß1-mediated cell adhesion and migration. The novel N-terminus of krit1 contains a NPXY motif that it is required for icap1 interaction. Like ß1 integrin, krit1 interacts with the 200 amino acid isoform of icap1 (icap1
), but not a 150 amino acid form that results from alternative splicing (icap1ß). In a competition assay, induced expression of krit1 diminishes the interaction between icap1
and ß1 integrin. Taken together, these data suggest that ß1 integrin and krit1 compete for the same site on icap1
, perhaps constituting a regulatory mechanism. Loss-of-function KRIT1 mutations, as observed in CCM1, would shift the balance with predicted consequences for endothelial cell performance during integrin ß1-dependent angiogenesis. | INTRODUCTION |
|---|
|
|
|---|
Cerebral cavernous malformations (CCMs) are collections of abnormal venous sinusoids found in central nervous system tissue in 0.5% of the population (1,2). Patients with CCMs have a prospective hemorrhage rate of 3.1% per lesion year and a new onset seizure rate of 2.4% per year (3). CCMs are the hallmark feature of CCM, an autosomal dominant disorder that accounts for half of all patients harboring these lesions (4). CCM is a genetically heterogeneous disorder, with loci on 7q (CCM1), 7p (CCM2) and 3q (CCM3) (512). Mutations in KRIT1 account for all cases linked to the CCM1 locus on 7q (4,1318). Krev Interaction Trapped 1 (krit1) was originally identified in a two-hybrid screen designed to identify proteins interacting with krev1/rap1a, a small Ras family GTPase thought to act as an antagonist of ras (19,20). This suggested a role for krit1 in GTPase-mediated signaling leading to the hypothesis that krit1, in conjunction with krev1, functioned as a tumor suppressor (15,21). In this view, mutations in KRIT1 would lead to the formation of cerebral cavernous malformations in a fashion similar to that seen in other neurocutaneous syndromes.
Several groups, including our own, have identified additional coding exons at the 5' end of the krit1 coding sequence. These exons extend the N-terminus of the previously reported krit1 protein by 207 amino acids (2224). Remarkably, when full-length krit1 protein was used in a two-hybrid system, it failed to interact with krev1 (although the originally identified N-terminally-deleted krit1 did). We report here that full-length krit1 interacts with integrin cytoplasmic domain-associated protein-1 (icap1), a modulator of ß1 integrin signal transduction (25,26) suggesting a role for krit1 in ß1 integrin-mediated angiogenesis.
| RESULTS |
|---|
|
|
|---|
Krit1 interacts with icap1 but not krev1/rap1a in a yeast two-hybrid screen
Using a full-length krit1GAL4BD fusion construct, pretransformed MATCHMAKER human brain cDNA libraries were screened by two-hybrid analysis. Among positive clones, those encoding icap1 were most frequently observed (data not shown). To verify interactions, positive clone constructs were purified and reintroduced with the full-length krit1GAL4BD fusion construct; only icap1 continued to show positive interaction with krit1. Icap1 was originally identified through its interaction with integrin ß1 in a yeast two-hybrid screen (25). To further explore putative interactions, yeast strains were co-transformed with GAL4BD fusion constructs encoding full-length krit1 (residues 1736), a truncated form of krit1 (tkrit1; residues 208736) or the integrin ß1 cytoplasmic domain (residues 778798) and GAL4AD fusion constructs encoding full-length icap1 (icap1
; residues 1200), a centrally-deleted icap1 isoform (icap1ß; residues 1127, 178200) or krev1/rap1a. The interaction between SV40 large T antigen and p53 was used as a positive control. Lamin C fusion constructs served as negative controls. All fusion proteins were epitope-tagged and their expression was confirmed by western blot analysis (data not shown).
Full-length krit1 showed strong evidence of interaction with icap1
. Colonies could be observed within 24 h under high-stringency conditions, at the same time as colonies manifesting the interaction between large T antigen and p53 (Fig. 1). The colonies representing the interaction of icap1
and integrin ß1 appeared 24 h later, suggesting a weaker interaction in this system. Like integrin ß1, krit1 does not interact with icap1ß. Also, in contrast to tkrit1, full-length krit1 does not interact with krev1/rap1a (Fig. 1B). The interaction between tkrit1 and krev1/rap1a is a comparatively weak interaction. Interestingly tkrit1 also interacted weakly with icap1ß (Fig. 1B). All interactions were verified after swapping inserts in the GAL4BD and GAL4AD constructs (data not shown).
|
Krit1 and icap1 co-immunoprecipitate in vitro and in vivo
To further confirm these interactions, in vitro co-immunoprecipitation (co-IP) experiments were carried out using the TnT T7 Quick Coupled Transcription/translation System (Promega). [35S]methionine-labeled target proteins were added to an equal volume of unlabeled bait proteins, then bait proteins were pulled-down using antibody specific to a tagged epitope. In accordance with the yeast two-hybrid data, full-length krit1, like integrin ß1, copurified specifically with icap1
(Fig. 2A), but not icap1ß or krev1 (Fig. 2B). Likewise, tkrit1 did not copurify with icap1
(Fig. 2A). The similarities of the interactions between icap1 and either integrin ß1 or full-length krit1 were intriguing. Based on the interaction data for full-length and truncated forms of krit1, we predicted that the N-terminus of krit1 (HK5; residues 1206) would also interact with icap1, and this proved to be true (Fig. 2A and B). Identical results were obtained for all in vitro co-IP experiments when the identity of bait and target proteins were swapped (data not shown). Remarkably, the isolated region unique to icap1
(icap50; residues 128177) interacted with the isolated N-terminus of krit1 (HK5), but not full-length krit1, suggesting complex regulation of the interaction between icap1
and krit1 (Fig. 2C).
|
In vivo co-IP experiments were also performed using pcDNA3.1/V5/HIS fusions transfected into HeLa cell (Fig. 3). HA-tagged krit1, HK5 and luciferase fusion constructs were co-transfected with a V5-tagged icap1
fusion construct, and then either anti-HA or anti-V5 antibody was used for immunoprecipitation of cell lysates and the opposite antibody was used to probe western blots. The results show that krit1 interacts with icap1
and that the N-terminus of krit1 is essential for this interaction (Fig. 3A). Furthermore, the interaction between transfected krit1 and endogenous icap1
was demonstrated by transfecting HA-tagged krit1 and control fusion constructs into HeLa cells. Anti-icap1 rabbit polyclonal antiserum was then used to pull-down icap1-containing complexes and an anti-HA mouse antibody was used to probe the blot for krit1 fusions. This experiment demonstrated that krit1 interacts with endogenous icap1 (Fig. 3B). This was replicated using the anti-HA mouse antibody to pull-down krit1 fusion-containing complexes and probing western blots with the anti-icap1 rabbit antisera (data not shown).
|
NPXY motif is important in krit1icap1 interaction
The NPXY motif in the integrin ß1 cytoplasmic domain plays a key role in its interaction with icap1 (25). Whereas a similar NPXY motif is present in the cytoplasmic domains of other integrin
subunits, icap1
only binds to ß1 integrin. A similar situation exists for ß3-endonexin which displays restricted binding to a related NITY motif present in the ß3 integrin cytoplasmic domain (27). Therefore, the cytoplasmic domains of different ß integrins may harbor motifs for specific cytoplasmic proteins (25,28,29). There are three NPXY motifs in full-length krit1 (residues 191194, 231234 and 250253); however, the latter two motifs are downstream of the previously inferred but erroneous translation initiation site. Based on the full-length krit1, tkrit1 and HK5 two-hybrid and in vitro co-IP data, we hypothesized that only the NPXY motif encoded by residues 191194 is crucial for the interaction with icap1. Two mutant forms of krit1, N191A (MUT1) and compound mutant N191A/Y194A (MUT2), were assayed for interaction with icap1
. In vitro co-IP data clearly show that mutations in the first NPXY (amino acids 191194) motif of krit1 impair its ability to interact with icap1
(Fig. 4).
|
Krit1 and integrin ß1 compete for icap1 binding site
To further evaluate whether integrin ß1 and krit1 bind to the same site in icap1
, and perhaps compete for this binding site, we determined whether induced expression of krit1 could diminish the interaction between icap1
and integrin ß1 in a yeast two-hybrid system. After 4 and 14 h of induced expression, the percent inhibition of ß-galactosidase activity in krit1-expressing cells, compared to uninduced cells, was 2-fold (P < 0.001) and 10-fold (P = 0.008) that observed in tkrit-expressing cells, respectively, suggesting that krit1 can compete with ß1 integrin for icap1
binding (Fig. 5).
|
| DISCUSSION |
|---|
|
|
|---|
We identified icap1
as a krit1 interactor in a two-hybrid system. This interaction was confirmed by co-IP both in an in vitro translation system and in transfected cultured mammalian cells. Furthermore, we have shown that the interaction with icap1
is dependent on an NPXY motif present in the recently identified N-terminus of krit1. Likewise, an NPXY motif in the cytoplasmic tail of ß1 integrin is required for icap1
binding (25,26). Like ß1 integrin, krit1 interacts with the 200 amino acid isoform of icap1 (icap1
), but not a 150 amino acid form that results from alternative splicing (icap1ß). Thus, it appears that the 50 amino acid sequence unique to icap1
(residues 128177) is critical to support both interactions. The observation that a peptide comprising these 50 residues in isolation (icap50) interacts with the isolated N-terminus of krit1 (HK5) but not full-length krit1 suggests that additional sequence in icap1
contributes to or regulates the interaction between the native proteins. Induced expression of krit1 impairs the interaction between icap1
and the cytoplasmic tail of ß1 integrin. Taken together, these data support a model where krit1 and ß1 integrin compete for the same binding domain in icap1
. In our hands, full-length krit1 fails to interact with krev1 by both two-hybrid analysis and co-IP. The newly identified 207 amino acids at the N-terminus of krit1 may mask a portion of the protein that supported interaction with krev1/rap1a. In the absence of any evidence for alternative translational initiation for krit1, it is difficult to assign any physiologic significance to the potential interaction between krev1/rap1a and the C-terminal portion of krit1.
There is an evolving body of evidence implicating ß1 integrins in angiogenesis (3039). Integrins are heterodimeric complexes consisting of
and ß subunits located on the cell surface that both physically link the extracellular matrix to the cytoskeleton and participate in important signal transduction pathways (33,37,40). Multiple ß integrin subfamily members are expressed on endothelial cells (37) and ß1 integrins have been implicated in cellcell adhesion, cellextracellular matrix adhesion, endothelial cell migration/invasion and vacuole/lumen formation during the process of angiogenesis (33,34,36,37,39,41). Through such mechanisms integrins may influence angiogenesis, vascular morphology and vascular integrity (34,37). Teratomas derived from ß1 null embryonic stem cells contain irregular basement membranes and small, irregular, host-derived blood vessels that are loosely embedded in connective tissue (36). Irregular basement membranes are also seen in glomeruli deficient in ß1 integrins (42). Ultrastructural studies of cavernous malformations including our own (43) demonstrate irregular venous channels consisting of endothelial cells with irregular basal lamina in a poorly organized connective tissue matrix. However, the exact role of specific integrin complexes is, as yet, unclear, as activation or blockade of ß1-containing heterodimers can inhibit various aspects of angiogenesis in vitro and in vivo (35). Given the array of heterodimers containing ß1 integrin subunits and the complex nature of the process, signal transduction through ß1 pathways is likely tightly regulated both spatially and temporally during normal angiogenesis. The observations that icap1
is a phosphoprotein and that the extent of phosphorylation is positively regulated by cellmatrix interaction suggests that it may participate in intracellular signaling cascades initiated by the extracellular environment (25,26). The downstream effects include modulation of cellular migration in response to the local character of the connective tissue.
Krit1 contains multiple ankyrin repeats which can be seen in integrin-associated proteins (34) and suggest interaction with the cytoskeleton. Interestingly, integrin-linked kinase 1, another ankyrin domain-containing protein, localizes to focal adhesions and functions as an important regulator of integrin-mediated processes including cell adhesion, growth, survival, matrix deposition and differentiation (44). Krit1 also contains a FERM domain which is often seen in proteins associated with the cytoplasmic aspect of the cell membrane (19). Such motifs might be predicted in a protein found in a focal adhesion plaque formed by the clustering of integrins on the cell surface. Therefore, it is possible that krit1 is suitably positioned to serve as a local reservoir for a regulated pool of icap1
. The prior belief that krit1 interacted with krev1/rap1a prompted the hypothesis that loss of a tumor suppressor function underlies the formation of cavernous malformations and supported speculation that a somatic second hit of the KRIT1 allele unaltered in the germline is required for disease pathogenesis. In this new view, a relative drop in the level of krit1, as would occur in the haploinsufficiency state, could plausibly result in a dysregulated pool of icap1
, promiscuous ß1 integrin-mediated phosphorylation and signaling, and hence local perturbations of angiogenesis. The timing of onset and location of focal lesions would be determined by stochastic events. A prediction of this model that remains to be tested is that overexpression of icap1
could recapitulate the pathogenesis of CCM1.
In conclusion, data provided in this work support a model where krit1 and the cytoplasmic tail of ß1 integrin compete for icap1
binding, constituting a regulatory mechanism. Loss-of-function KRIT1 mutations, as observed in CCM1, would shift the balance with predicted consequences for endothelial cell performance during integrin ß1-dependent angiogenesis. This mechanistic understanding may facilitate identification of other CCM genes and the development of rational therapeutic strategies.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmid construction
For construction of recombinant plasmids all PCR amplifications were carried out with Platinum Pfx DNA Polymerase (Gibco BRL) as specified by the manufacturer. GAL4 binding domain (BD) and activation domain (AD) fusion constructs were assembled by cloning PCR-amplified cDNA fragments into vectors pGBKT7 and pGADT7, respectively (both from Clontech). Primer sequences included: full-length krit1 (residues 1736), primers K02F (ATGGGAAATCCAGAAAA- CATAG) and K05R (GAGTAACAGTTACTTCTCTTTC); for krit1 residues 1207, primers K02F and K5-3R (ATGTAGTGAGTTTTCTGTCTGA); for krit1 residues 208736, primers THK1F (ATGGGCTATAGTGCACTAGAA) and K05; for full-length krev1/rap1a, primers RAP1AF (ATGCGTGAGTACAAGCTAGTG) and RAP1AR (CCTAGAGCAGCAGACATGATT); for full-length icap1
and icap1ß, primers ICAP1F (ATGTTTCGCAAGGGCAAA) and ICAP1R (ATTCAGGGTTTCTCAGATG). All PCR products were amplified from human brain cDNA and subsequently ligated into the TA cloning vector pCR2.1 (Invitrogen). The inserts were excised with EcoRI and cloned into the EcoRI sites in pGADT7 and pGBKT7. All final constructs were sequenced to verify insert orientation and sequence.
For mammalian expression systems, constructs encoding HA-tagged forms of krit1 were created by PCR-amplifying Krit1 cDNA fragments from pGADT7Krit1 with primers which incorporated an HA peptide coding sequence. For the full-length N-terminally HA-tagged construct (HAKrit1:1736), primers HK02F5HA (CCACCATGGCCTACCCCTACGACGTGCCCGACTACGCCATGGGAAATCCAGAAAA) and K05R were used. For the krit1 N-terminus HA-tagged construct (HAKrit1:1207), primers HK02F5HA and K5-32R (CTAATGTAGTGAGTTTTCTGTCTGA) were used; for the truncated krit1 (N-terminally deleted) construct (HAKrit1:208736), primers HATHK1F (CCACCATGGCCTACCCCTACGACGTGCCCGACTACGCCATGGGCTATAGTGCACT) and K05R were used. For the C-terminal V5-tagged icap1
construct (Icap1
:1200V5), primer pair ICAP1C1F (CCACCATGTTTCGCAAGGGCAAA) and ICAP2R (GGGTTTCTCAGATGTTAA) were used. For the V5-tagged internal icap1 fragment construct (Icap1
:128177V5), primers HAICAPNF (CCACCATGGCCTACCCCTACGACGTGCCCGACTACGCCGATGTTTTGCACAGGCA) and ICAPNR (CAGGCTGTTGCACTGATAAAC) were used. All mammalian expression constructs were fashioned by subcloning the appropriate PCR product into pcDNA3.1/V5/HIS-TOPO (Invitrogen). The construct for the HA-tagged form of luciferase (HALuc) was previously described by Mendell et al. (45). A construct encoding the integrin ß1 cytoplasmic tail (residues 778798) was previously described by Chang et al. (25). A full-length integrin ß1 expression construct (H-X07979M) was obtained from Invitrogen.
Yeast two-hybrid analysis
For yeast two-hybrid library screening, all vectors, yeast strains, reagents and methods were derived from the MATCHMAKER Two-Hybrid System 3 (Clontech). For initial screening, a full-length krit1GAL4BD fusion construct was used as bait and transformed into yeast strain AH109, which was mated with strain Y187 pretransformed with a MATCHMAKER human brain cDNA library and plated on SD -Trp/-Leu/-His/-Ade medium at 30°C for 618 days for maximum stringency selections. Colony-lift filter assays were then performed to identify positive clones. Yeast transformations were performed by the small-scale lithium acetate method (Clontech). AH109 co-transformants containing GAL4AD and GAL4BD fusion constructs were plated on SD -Trp/-Leu medium. Stationary-phase cultures (5 µl) were spotted on selective medium and incubated at 30°C for 35 days. Both solid- and liquid-phase ß-galactosidase activity assays were performed using reagents and methods supplied in the MATCHMAKER Two-Hybrid System 3.
Protein preparation, immunoprecipitation and western analysis
Protein was isolated from Saccharomyces cerevisiae strains harboring fusion constructs as described in the MATCHMAKER Two-Hybrid System 3. Equal amounts of protein, as confirmed by Coomassie staining, were subjected to sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDSPAGE) (412% polyacrylamide) and transferred to nitrocellulose. Immunoblotting to quantify relative expression levels of fusion proteins utilized antibodies directed against HA (monoclonal from Covance, polyclonal from Clontech), V5 and myc epitopes (both from Invitrogen) using methods described by Mendell et al. (45).
Plasmid mutagenesis
Two point mutations in krit1 were created by amplifying Krit1 cDNA fragments from pGADT7Krit1 with primers that harbored each point mutation. Primers KMUT2F (GATTCAGTAGCATATGCAGGAGCTATGACATTAGTTTTTATCCG) and KMUT2R (CGGATAAAAACTAATGTCATAGCTCCTGCATATGCTACTGAATC) were used to make mutation N191A. Primers KMUT1F (CCTGATTCAGTAGCAGCTGCAGGAGCTATGACATTAGTTTTTATCCG) and KMUT1R (CGGATAAAAACTAATGTCATAGCTCCTGCAGCTGCTACTGAATCAGG) were subsequently used to create both mutations N191A and Y194A in a single expression construct. PCRs were performed using the QuickChange site-directed mutagenesis kit (Stratagene) as specified by the manufacturer.
Tissue culture and transfections
HeLa cells were cultured in Dulbeccos modified Eagles medium supplemented with 10% fetal calf serum and an antibioticantimycotic mixture (Gibco BRL). Transfections were carried out with Hela Monster reagent (PanVera) as described by the manufacturer. For transfection of HAkrit1 fusions, 10 µg of plasmid was used per 10 cm diameter dish.
In vitro translation and co-immunoprecipitation
For in vitro co-IP experiments, 1 µg of pcDNA3.1/V5/HIS constructs and/or GAL4BD or GAL4AD fusion constructs was used in the TnT Quick Coupled Transcription/translation System (Promega) in the presence of unlabeled or labeled (S35) methionine as specified by the manufacturer. Before co-IP, all labeled proteins were run on 412% polyacrylamide gels, transferred to nitrocellulose and quantified using an Instant Imager (Packard). In vitro translation of epitope-tagged unlabeled proteins was confirmed by western analysis. Five microliters of labeled lysate (target) was mixed with 5 µl of the appropriate unlabeled (bait) and incubated at 37°C for 30 min. 490 µl of cold buffer B4 [50 mM HEPES (pH 7.6), 150 mM NaC1, 5 mM MgC12, 0.2% Nonidet P-40, EDTA-free complete protease inhibitor (Roche)] was then added to each tube. One microgram of the appropriate antibody directed against the bait epitope-tagged protein (anti-HA, -V5 or -myc) and 10 µl of a 50% slurry of protein G-Sepharose beads (Amersham) were mixed with the lysate mixture and incubated for 3 h. Following collection by centrifugation, beads were washed in 1 ml of buffer B4 four times. After final washing and resuspension in 20 µl of 2x SDS sample buffer, samples were boiled and centrifuged briefly. A 20 µl volume of each sample was then subjected to SDSPAGE (412% polyacrylamide), transferred to nitrocellulose and assayed using autoradiography and an Instant Imager.
Mammalian cell expression and co-immunoprecipitation
For in vivo co-IP experiments, cells growing in 10 cm dishes were co-transfected with 5 µg of each expression construct. Ten micrograms was used in experiments relying upon a single transfected construct. All transfection and co-IP steps were performed as described by Mendell et al. (45). A 20 µl volume of each sample was subjected to SDSPAGE (412% polyacrylamide) and transferred to nitrocellulose.
Immunoblotting with anti-HA rabbit polyclonal antibody (Clontech) or mouse monoclonal antibody HA.11 (Covance) or anti-V5 (Invitrogen) was carried out as specified by the manufacturer. Affinity bands were visualized using the Supersignal West Dura chemiluminescent substrate (Pierce).
Competition assay
When yeast cells are cultured in the presence of methionine, the MET25 promoter is repressed (46). The MET25 promoter was excised with BssII from plasmid p415MET (MET25p/LEU2/CEN/ARS) (a gift from Dr Forrest Spencers laboratory) and ligated into high copy vector pRS422 (ADE2/2µ) to create the vector p422MET25 (MET25p/ADE2/2µ). PCR products encoding HA-tagged forms of full-length krit1 (residues 1736) and N-terminally truncated krit1 (residues 208736) were generated as previously described and ligated into p422MET25 to create constructs p422MET25krit1 and p422MET25tkrit1, respectively. Each vector was co-transformed with both pGADT7icap1 and pGBKT7ß1 integrin cytoplasmic domain fusion constructs into strain Y190 and plated on SD -Trp/-Leu/-Ade medium at 30°C for 5 days. Liquid cultures derived from individual transformants were grown to log phase, aliquoted, resuspended in SD -Trp/-Leu/-Ade liquid medium without or with added methionine (500 µM) and incubated at 30°C for 4 or 14 h prior to performance of a standard liquid phase ß-galactosidase assay (Clontech). Percent inhibition of interaction between icap-1
and ß1 integrin was calculated by determining the ratio of ß-galactosidase activity in the absence of methionine (expression of krit1) to that in the presence of methionine (no expression of krit1). Results shown for each experiment reflect the performance of three independent assays for each of two independent transformants.
| ACKNOWLEDGEMENTS |
|---|
We thank Josh Mendell, Dan Arking, Colette ap Rhys, Forrest Spencer, Joseph Hanna, Marina Lee and Cheryl Dunbar Warren for valuable discussions and technical assistance. This work was supported by the Center for Inherited Neurovascular Disease (www.cind.org), the Salisbury Family Foundation and the Howard Hughes Medical Institute (H.C.D.) and Public Health Service grant CA78375 (D.D.C.).
| FOOTNOTES |
|---|
+ To whom correspondence should be addressed at: The Johns Hopkins University School of Medicine, Ross 858, 720 Rutland Avenue, Baltimore, MD 21205, USA. Tel: +1 410 614 0701; Fax: +1 410 614 2256; Email: hdietz@jhmi.edu
| REFERENCES |
|---|
|
|
|---|
1 Otten, P., Pizzolato, G.P., Rilliet, B. and Berney, J. (1989) 131 cases of cavernous angioma (cavernomas) of the CNS, discovered by retrospective analysis of 24, 535 autopsies. Neurochirurgie, 35, 8283.[Web of Science][Medline]
2 Del Curling, O.,Jr, Kelly, D.L.,Jr, Elster, A.D. and Craven, T.E. (1991) An analysis of the natural history of cavernous angiomas. J. Neurosurg., 75, 702708.[Web of Science][Medline]
3 Moriarity, J.L., Wetzel, M., Clatterbuck, R.E., Javedan, S., Sheppard, J.M., Hoenig-Rigamonti, K., Crone, N.E., Breiter, S.N., Lee, R.R. and Rigamonti, D. (1999) The natural history of cavernous malformations: a prospective study of 68 patients. Neurosurgery, 44, 11661171.[Web of Science][Medline]
4 Davenport, W.J., Siegel, A.M., Dichgans, J., Drigo, P., Mammi, I., Pereda, P., Wood, N.W. and Rouleau, G.A. (2001) CCM1 gene mutations in families segregating cerebral cavernous malformations. Neurology, 56, 540543.
5 Dubovsky, J., Zabramski, J.M., Kurth, J., Spetzler, R.F., Rich, S.S., Orr, H.T. and Weber, J.L. (1995) A gene responsible for cavernous malformations of the brain maps to chromosome 7q. Hum. Mol. Genet., 4, 453458.
6 Marchuk, D.A., Gallione, C.J., Morrison, L.A., Clericuzio, C.L., Hart, B.L., Kosofsky, B.E., Louis, D.N., Gusella, J.F., Davis, L.E. and Prenger, V.L. (1995) A locus for cerebral cavernous malformations maps to chromosome 7q in two families. Genomics, 28, 311314.[Web of Science][Medline]
7 Gunel, M., Awad, I.A., Anson, J. and Lifton, R.P. (1995) Mapping a gene causing cerebral cavernous malformation to 7q11.2q21. Proc. Natl Acad. Sci. USA, 92, 66206624.
8 Johnson, E.W., Iyer, L.M., Rich, S.S., Orr, H.T., Gil-Nagel, A., Kurth, J.H., Zabramski, J.M., Marchuk, D.A., Weissenbach, J., Clericuzio, C.L. et al. (1995) Refined localization of the cerebral cavernous malformation gene (CCM1) to a 4-cM interval of chromosome 7q contained in a well-defined YAC contig. Genome Res., 5, 368380.
9 Gunel, M., Awad, I.A., Finberg, K., Steinberg, G.K., Craig, H.D., Cepeda, O., Nelson-Williams, C. and Lifton, R.P. (1996) Genetic heterogeneity of inherited cerebral cavernous malformation. Neurosurgery, 38, 12651271.[Web of Science][Medline]
10 Polymeropoulos, M.H., Hurko, O., Hsu, F., Rubenstein, J., Basnet, S., Lane, K., Dietz, H., Spetzler, R.F. and Rigamonti, D. (1997) Linkage of the locus for cerebral cavernous hemangiomas to human chromosome 7q in four families of Mexican-American descent. Neurology, 48, 752757.
11 Craig, H.D., Gunel, M., Cepeda, O., Johnson, E.W., Ptacek, L., Steinberg, G.K., Ogilvy, C.S., Berg, M.J., Crawford, S.C., Scott, R.M. et al. (1998) Multilocus linkage identifies two new loci for a mendelian form of stroke, cerebral cavernous malformation, at 7p1513 and 3q25.227. Hum. Mol. Genet., 7, 18511858.
12 Laberge, S., Labauge, P., Marechal, E., Maciazek, J. and Tournier-Lasserve, E. (1999) Genetic heterogeneity and absence of founder effect in a series of 36 French cerebral cavernous angiomas families. Eur. J. Hum. Genet., 7, 499504.[Web of Science][Medline]
13 Laberge-le Couteulx, S., Jung, H.H., Labauge, P., Houtteville, J.P., Lescoat, C., Cecillon, M., Marechal, E., Joutel, A., Bach, J.F. and Tournier-Lasserve, E. (1999) Truncating mutations in CCM1, encoding KRIT1, cause hereditary cavernous angiomas. Nat. Genet., 23, 189193.[Web of Science][Medline]
14 Sahoo, T., Johnson, E.W., Thomas, J.W., Kuehl, P.M., Jones, T.L., Dokken, C.G., Touchman, J.W., Gallione, C.J., Lee-Lin, S.Q., Kosofsky, B. et al. (1999) Mutations in the gene encoding KRIT1, a Krev-1/rap1a binding protein, cause cerebral cavernous malformations (CCM1). Hum. Mol. Genet., 8, 23252333.
15 Zhang, J., Clatterbuck, R.E., Rigamonti, D. and Dietz, H.C. (2000) Mutations in KRIT1 in familial cerebral cavernous malformations. Neurosurgery, 46, 12721277.[Web of Science][Medline]
16 Eerola, I., Plate, K.H., Spiegel, R., Boon, L.M., Mulliken, J.B. and Vikkula, M. (2000) KRIT1 is mutated in hyperkeratotic cutaneous capillary-venous malformation associated with cerebral capillary malformation. Hum. Mol. Genet., 9, 13511355.
17 Lucas, M., Solano, F., Zayas, M.D., Garcia-Moreno, J.M., Gamero, M.A., Costa, A.F. and Izquierdo, G. (2000) Spanish families with cerebral cavernous angioma do not bear 742C
T Hispanic American mutation of the KRIT1 gene. Ann. Neurol., 47, 836.
18 Lucas, M., Costa, A.F., Montori, M., Solano, F., Zayas, M.D. and Izquierdo, G. (2001) Germline mutations in the CCM1 gene, encoding Krit1, cause cerebral cavernous malformations. Ann. Neurol., 49, 529532.[Web of Science][Medline]
19 Serebriiskii, I., Estojak, J., Sonoda, G., Testa, J.R. and Golemis, E.A. (1997) Association of Krev-1/rap1a with Krit1, a novel ankyrin repeat-containing protein encoded by a gene mapping to 7q2122. Oncogene, 15, 10431049.[Web of Science][Medline]
20 Kawasaki, H., Springett, G.M., Mochizuki, N., Toki, S., Nakaya, M., Matsuda, M., Housman, D.E. and Graybiel, A.M. (1998) A family of cAMP-binding proteins that directly activate Rap1. Science, 282, 22752279.
21 Serebriiskii, I., Khazak, V. and Golemis, E.A. (1999) A two-hybrid dual bait system to discriminate specificity of protein interactions. J. Biol. Chem., 274, 1708017087.
22 Zhang, J., Clatterbuck, R.E., Rigamonti, D. and Dietz, H.C. (2000) Cloning of the murine Krit1 cDNA reveals novel mammalian 5' coding exons. Genomics, 70, 392395.[Web of Science][Medline]
23 Sahoo, T., Goenaga-Diaz, E., Serebriiskii, I.G., Thomas, J.W., Kotova, E., Cuellar, J.G., Peloquin, J.M., Golemis, E., Beitinjaneh, F., Green, E.D. et al. (2001) Computational and experimental analyses reveal previously undetected coding exons of the KRIT1 (CCM1) gene. Genomics, 71, 123126.[Web of Science][Medline]
24 Eerola, I., McIntyre, B. and Vikkula, M. (2001) Identification of eight novel 5'-exons in cerebral capillary malformation gene-1 (CCM1) encoding KRIT1. Biochim. Biophys. Acta, 1517, 464467.[Medline]
25 Chang, D.D., Wong, C., Smith, H. and Liu, J. (1997) ICAP-1, a novel ß1 integrin cytoplasmic domain-associated protein, binds to a conserved and functionally important NPXY sequence motif of ß1 integrin. J. Cell Biol., 138, 11491157.
26 Zhang, X.A. and Hemler, M.E. (1999) Interaction of the integrin ß1 cytoplasmic domain with ICAP-1 protein. J. Biol. Chem., 274, 1119.
27 Eigenthaler, M., Hofferer, L., Shattil, S.J. and Ginsberg, M.H. (1997) A conserved sequence motif in the integrin ß3 cytoplasmic domain is required for its specific interaction with ß3-endonexin. J. Biol. Chem., 272, 76937698.
28 Gawaz, M., Besta, F., Ylanne, J., Knorr, T., Dierks, H., Bohm, T. and Kolanus, W. (2001) The NITY motif of the ß-chain cytoplasmic domain is involved in stimulated internalization of the ß3 integrin A isoform. J. Cell Sci., 114, 11011113.[Abstract]
29 Kolanus, W., Nagel, W., Schiller, B., Zeitlmann, L., Godar, S., Stockinger, H. and Seed, B. (1996)
L ß 2 integrin/LFA-1 binding to ICAM-1 induced by cytohesin-1, a cytoplasmic regulatory molecule. Cell, 86, 233242.[Web of Science][Medline]
30 Yamada, K.M. and Geiger, B. (1997) Molecular interactions in cell adhesion complexes. Curr. Opin. Cell Biol., 9, 7685.[Web of Science][Medline]
31 Kolanus, W. and Seed, B. (1997) Integrins and inside-out signal transduction: converging signals from PKC and PIP3. Curr. Opin. Cell Biol., 9, 725731.[Web of Science][Medline]
32 Kolanus, W. and Zeitlmann, L. (1998) Regulation of integrin function by inside-out signaling mechanisms. Curr. Top. Microbiol. Immunol., 231, 3349.[Web of Science][Medline]
33 Howe, A., Aplin, A.E., Alahari, S.K. and Juliano, R.L. (1998) Integrin signaling and cell growth control. Curr. Opin. Cell Biol., 10, 220231.[Web of Science][Medline]
34 Hemler, M.E. (1998) Integrin associated proteins. Curr. Opin. Cell Biol., 10, 578585.[Web of Science][Medline]
35 Kim, S., Bell, K., Mousa, S.A. and Varner, J.A. (2000) Regulation of angiogenesis in vivo by ligation of integrin
5ß1 with the central cell-binding domain of fibronectin. Am. J. Pathol., 156, 13451362.
36 Bloch, W., Forsberg, E., Lentini, S., Brakebusch, C., Martin, K., Krell, H.W., Weidle, U.H., Addicks, K. and Fassler, R. (1997) ß 1 integrin is essential for teratoma growth and angiogenesis. J. Cell Biol., 139, 265278.
37 Brooks, P.C. (1996) Role of integrins in angiogenesis. Eur. J. Cancer, 32A, 24232429.
38 Collo, G. and Pepper, M.S. (1999) Endothelial cell integrin
5ß1 expression is modulated by cytokines and during migration in vitro. J. Cell Sci., 112, 569578.[Abstract]
39 Gamble, J., Meyer, G., Noack, L., Furze, J., Matthias, L., Kovach, N., Harlant, J. and Vadas, M. (1999) B1 integrin activation inhibits in vitro tube formation: effects on cell migration, vacuole coalescence and lumen formation. Endothelium, 7, 2334.[Web of Science][Medline]
40 David, F.S., Zage, P.E. and Marcantonio, E.E. (1999) Integrins interact with focal adhesions through multiple distinct pathways. J. Cell Physiol., 181, 7482.[Web of Science][Medline]
41 Howe, A.K. and Juliano, R.L. (1998) Distinct mechanisms mediate the initial and sustained phases of integrin-mediated activation of the Raf/MEK/mitogen-activated protein kinase cascade. J. Biol. Chem., 273, 2726827274.
42 Kreidberg, J.A. (2000) Functions of
3ß1 integrin. Curr. Opin. Cell Biol., 12, 548553.[Web of Science][Medline]
43 Clatterbuck, R.E., Eberhart, C.G., Crain, B.J. and Rigamonti, D. (2001) Ultrastructural and immunocytochemical evidence that an incompetent bloodbrain barrier is related to the pathophysiology of cavernous malformations. J. Neurol. Neurosurg. Psychiatry, 71, 188192.
44 Huang, Y. and Wu, C. (1999) Integrin-linked kinase and associated proteins (review). Int. J. Mol. Med., 3, 563572.[Web of Science][Medline]
45 Mendell, J.T., Medghalchi, S.M., Lake, R.G., Noensie, E.N. and Dietz, H.C. (2000) Novel Upf2p orthologues suggest a functional link between translation initiation and nonsense surveillance complexes. Mol. Cell. Biol., 20, 89448957.
46 Mumberg, D., Muller, R. and Funk, M. (1994) Regulatable promoters of Saccharomyces cerevisiae: comparison of transcriptional activity and their use for heterologous expression. Nucleic Acids Res., 22, 57675768.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
N. Limaye, L. M. Boon, and M. Vikkula From germline towards somatic mutations in the pathophysiology of vascular anomalies Hum. Mol. Genet., April 15, 2009; 18(R1): R65 - R74. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Chen, G. Tanriover, H. Yano, R. Friedlander, A. Louvi, and M. Gunel Apoptotic Functions of PDCD10/CCM3, the Gene Mutated in Cerebral Cavernous Malformation 3 Stroke, April 1, 2009; 40(4): 1474 - 1481. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Boulday, A. Blecon, N. Petit, F. Chareyre, L. A. Garcia, M. Niwa-Kawakita, M. Giovannini, and E. Tournier-Lasserve Tissue-specific conditional CCM2 knockout mice establish the essential role of endothelial CCM2 in angiogenesis: implications for human cerebral cavernous malformations Dis. Model. Mech., March 1, 2009; 2(3-4): 168 - 177. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M. Hogan, J. Bussmann, H. Wolburg, and S. Schulte-Merker ccm1 cell autonomously regulates endothelial cellular morphogenesis and vascular tubulogenesis in zebrafish Hum. Mol. Genet., August 15, 2008; 17(16): 2424 - 2432. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Lei, D. Liu, Y. Huang, I. Jovin, S.-Y. Shai, T. Kyriakides, R. S. Ross, and F. J. Giordano Endothelial Expression of 1 Integrin Is Required for Embryonic Vascular Patterning and Postnatal Vascular Remodeling Mol. Cell. Biol., January 15, 2008; 28(2): 794 - 802. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Glading, J. Han, R. A. Stockton, and M. H. Ginsberg KRIT-1/CCM1 is a Rap1 effector that regulates endothelial cell cell junctions J. Cell Biol., October 22, 2007; 179(2): 247 - 254. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Brouillard and M. Vikkula Genetic causes of vascular malformations Hum. Mol. Genet., October 15, 2007; 16(R2): R140 - R149. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Bouvard, A. Aszodi, G. Kostka, M. R. Block, C. Albiges-Rizo, and R. Fassler Defective osteoblast function in ICAP-1-deficient mice Development, July 15, 2007; 134(14): 2615 - 2625. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Battistini, R. Rocchi, A. Cerase, A. Citterio, L. Tassi, G. Lando, M. C. Patrosso, R. Galli, P. Brunori, D. L. Sgro, et al. Clinical, Magnetic Resonance Imaging, and Genetic Study of 5 Italian Families With Cerebral Cavernous Malformation Arch Neurol, June 1, 2007; 64(6): 843 - 848. [Abstract] [Full Text] [PDF] |
||||
![]() |
N Revencu and M Vikkula Cerebral cavernous malformation: new molecular and clinical insights J. Med. Genet., September 1, 2006; 43(9): 716 - 721. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Mably, L. P. Chuang, F. C. Serluca, M.-A. P. K. Mohideen, J.-N. Chen, and M. C. Fishman santa and valentine pattern concentric growth of cardiac myocardium in the zebrafish Development, August 15, 2006; 133(16): 3139 - 3146. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Seker, K. L. Pricola, B. Guclu, A. K. Ozturk, A. Louvi, and M. Gunel CCM2 Expression Parallels That of CCM1 Stroke, February 1, 2006; 37(2): 518 - 523. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Verlaan, J. Roussel, S. B. Laurent, C. E. Elger, A. M. Siegel, and G. A. Rouleau CCM3 mutations are uncommon in cerebral cavernous malformations Neurology, December 27, 2005; 65(12): 1982 - 1983. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Zawistowski, L. Stalheim, M. T. Uhlik, A. N. Abell, B. B. Ancrile, G. L. Johnson, and D. A. Marchuk CCM1 and CCM2 protein interactions in cell signaling: implications for cerebral cavernous malformations pathogenesis Hum. Mol. Genet., September 1, 2005; 14(17): 2521 - 2531. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-N. Fournier, S. Dupe-Manet, D. Bouvard, F. Luton, S. Degani, M. R. Block, S. F. Retta, and C. Albiges-Rizo Nuclear Translocation of Integrin Cytoplasmic Domain-associated Protein 1 Stimulates Cellular Proliferation Mol. Biol. Cell, April 1, 2005; 16(4): 1859 - 1871. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. W. Plummer, C. J. Gallione, S. Srinivasan, J. S. Zawistowski, D. N. Louis, and D. A. Marchuk Loss of p53 Sensitizes Mice with a Mutation in Ccm1 (KRIT1) to Development of Cerebral Vascular Malformations Am. J. Pathol., November 1, 2004; 165(5): 1509 - 1518. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-C. Tille and M.S. Pepper Hereditary Vascular Anomalies: New Insights Into Their Pathogenesis Arterioscler. Thromb. Vasc. Biol., September 1, 2004; 24(9): 1578 - 1590. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Whitehead, N. W. Plummer, J. A. Adams, D. A. Marchuk, and D. Y. Li Ccm1 is required for arterial morphogenesis: implications for the etiology of human cavernous malformations Development, March 15, 2004; 131(6): 1437 - 1448. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Jobard, B. Bouadjar, F. Caux, S. Hadj-Rabia, C. Has, F. Matsuda, J. Weissenbach, M. Lathrop, J.-F. Prud'homme, and J. Fischer Identification of mutations in a new gene encoding a FERM family protein with a pleckstrin homology domain in Kindler syndrome Hum. Mol. Genet., April 15, 2003; 12(8): 925 - 935. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Reich, J. Winkler, A. Straube, H.J. Steiger, and A. Peraud Molecular genetic investigations in the CCM1 gene in sporadic cerebral cavernomas Neurology, April 8, 2003; 60(7): 1135 - 1138. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Marchuk, S. Srinivasan, T. L. Squire, and J. S. Zawistowski Vascular morphogenesis: tales of two syndromes Hum. Mol. Genet., April 2, 2003; 12(90001): R97 - 112. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gunel, M. S. H. Laurans, D. Shin, M. L. DiLuna, J. Voorhees, K. Choate, C. Nelson-Williams, and R. P. Lifton KRIT1, a gene mutated in cerebral cavernous malformation, encodes a microtubule-associated protein PNAS, August 6, 2002; 99(16): 10677 - 10682. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

















