Human Molecular Genetics, 2001, Vol. 10, No. 26 3101-3109
© 2001 Oxford University Press
Effect of allelic variation at the NACP–Rep1 repeat upstream of the 
-synuclein gene (SNCA) on transcription in a cell culture luciferase reporter system
Genetic Disease Research Branch, National Human Genome Research Institute, National Institutes of Health, 49 Convent Drive, MSC 4472, Bethesda, MD 20892-4472, USA
Received October 15, 2001; Revised and Accepted October 26, 2001.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Mutations in the
-synuclein gene (SNCA) have been implicated in familial Parkinson’s disease (PD) while certain polymorphic alleles at a microsatellite repeat, NACP–Rep1, located 
10 kb upstream of the gene, have been associated with sporadic PD. In order to study the regulation of the human -synuclein gene, we performed a deletion analysis of 10.7 kb upstream of the translational start site, using the luciferase reporter assay in 293T cells and the neuroblastoma cell line SH-SY5Y. The shortest fragment, 400 bp upstream of the transcriptional start site, was sufficient for transcription in both cell lines. The other constructs led to variable expression levels, with some showing maximum expression and others showing nearly complete extinction of expression. An 880 bp fragment located 10 kb upstream of the gene and containing the NACP–Rep1 polymorphism, was shown to be necessary for normal expression. Additional analysis of the NACP–Rep1 locus and surrounding DNA suggested that two domains flanking the repeat interact to enhance expression while the repeat acts as a negative modulator. Next, we measured the activity of the entire 10.7 kb upstream region in the luciferase reporter assay when each of our different NACP–Rep1 alleles were present. The expression levels varied very significantly among the different alleles over a 3-fold range in the SH-SY5Y cells but showed little or no significant variation in the 293T cells. Given that even small changes in -synuclein expression may, over many decades, predispose to PD, the association of different NACP–Rep1 alleles with PD may be a consequence of polymorphic differences in transcriptional regulation of -synuclein expression resulting from different NACP–Rep1 alleles. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Parkinson’s disease (PD) is the second most common neurodegenerative disease in humans; its etiology is largely unknown. The
-synuclein gene (SNCA) was first identified as the gene encoding a protein of which a subfragment, termed the non-ß-amyloid component, was thought to be a component of Alzheimer’s disease plaques (1). Interest in -synuclein increased substantially when early onset PD, which can occur as an autosomal dominant trait in a few rare families, was shown to result from two different missense mutations in SNCA (2,3). The importance of -synuclein in PD was further underscored by the demonstration of -synuclein in the characteristic protein aggregates, termed Lewy bodies, found in the affected portions of the brains of sporadic PD patients (4). Recently, it was shown that both mice and flies expressing the human -synuclein recapitulate some characteristics of PD (5,6). These findings suggest that -synuclein could have an important role in the development of PD. However, efforts to identify SNCA mutations in sporadic PD have failed (7).
NACP–Rep1 is a polymorphic complex repeat site located 10 kb upstream of the translational start of SNCA (8,9). Five alleles were identified with a size difference of two nucleotides (8,10). The basis for the size difference among the different NACP–Rep1 alleles was unknown. Recently, it was shown that certain alleles of the NACP–Rep1 locus are associated with an increased risk of sporadic PD in German and American populations (11–13) but not in the Japanese population (14). Variation in expression of the gene might play a role in the pathogenesis of the disease in some patients that do not carry the mutated protein. Hence, understanding the regulation of the -synuclein expression could be very important.
In this study we aimed to characterize the -synuclein promoter/enhancer region and to further study the role of the various NACP–Rep1 polymorphic alleles in regulating the expression of the SNCA gene.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Computational analysis of the
-synuclein putative promoter/enhancer regionWe searched for potential transcription binding sites in the sequence upstream of SNCA transcriptional start using the MatInspector V2.2 software. The analysis revealed numerous potential recognition sites for many transcription factors (data not shown). The positions of the binding sites for AP1, C/EBPß, CHOP (GADD 153), N-Myc and Sp1, which gave high score values (core similarity = 1; matrix similarity
0.85), are shown in Figure 1.
|
Analysis of the deleted constructs at the promoter/enhancer region of
-synucleinThe 10.7 kb region upstream of SNCA translational start (9) was used to make eight constructs extending varying distances upstream of the transcriptional start site; all constructs were inserted in a luciferase expression vector and transfected into 293T cells and the neuroblastoma cell line SH-SY5Y. Each plasmid was cotransfected with pRL-TK (293T cells) or pRL-SV40 (SH-SY5Y cells) and the firefly and Renilla luciferases expression were measured. As a control for the luciferase basal expression we cotransfected the commercial promoter-less plasmid, pGL 3-Basic, with the pRL plasmid. For each cotransfection experiment, the relative activity of luciferase was calculated in order to eliminate the effect of transfection efficiency and cell number (Materials and Methods).
The different constructs harboring sequences upstream of the transcriptional start site were assayed for expression of luciferase. The control plasmid, pAS-1.46 which includes only sequences downstream of the transcriptional start site gave the lowest luciferase activity in both cell lines, only a few fold over the background activity seen with the empty luciferase vector. The addition of the immediate 400 bp upstream of the transcription start site increased the luciferase expression 5- and 8-fold in 293T and SH-SY5Y cells, respectively. Thus, the shortest fragment, 400 bp upstream of the transcriptional start site, was found to be sufficient for transcription in both cell lines (Fig. 2) and is likely to include the minimal promoter. The other constructs led to variable expression levels, with some showing maximum expression and others showing nearly complete extinction of expression (Fig. 2). As can be seen in Figure 2 there were also differences in relative expression level for each construct between the cell lines. These results illustrate that this genomic region contains promoter/enhancer elements that are likely to belong to the SNCA gene and might contribute to tissue specific regulation of SNCA transcription.
|
Our previous studies showed the importance of the region containing the human NACP–Rep1 repeat in the regulation of expression of the human
-synuclein gene (9). The construct harboring the NACP–Rep1 repeat region at the 5' end (pASP-10.7) resulted in a 60- and 3-fold increase in luciferase expression relative to the basal level of pGL 3-Basic upon transfection into 293T and SH-SY5Y cells, respectively (Fig. 2). The construct in which the NACP–Rep1 repeat region was deleted (pASP-9.8) led to a decrease in the expression level to 15-fold in 293T relative to the basal level of pGL 3-Basic (Fig. 2A). Thus, the 880 bp segment containing NACP–Rep1 contributes a 4-fold increase in the -synuclein promoter activity in 293T cells. The relative expression level of pASP-9.8 in SH-SY5Y cells was similar to the level observed from the control plasmid, pAS-1.46 in which no promoter sequences were included (Fig. 2B). Thus, deletion of the 880 bp region containing the NACP–Rep1 repeat led to the complete elimination of the expression derived by the SNCA promoter in SH-SY5Y cells. However, of interest was that in both cell lines, deletion of an additional 3.6 kb of sequence from the 5' end of the pASP-9.8 construct to generate the pASP-6.2 construct caused a return to the highest levels seen.
We further studied the 880 bp region containing the NACP–Rep1 repeat. A construct carrying a precise deletion of only the NACP–Rep1 (pASP-
NACP) led to a 7- and 3.5-fold increase in expression relative to the 880 bp deletion in 293T and SH-SY5Y cells, respectively (Fig. 3). In 293T cells deletion of the NACP–Rep1 plus 317 bp upstream (pASP-3'NACP) or the NACP–Rep1 plus 452 bp downstream (pASP-5'NACP) of the repeat led to 5.5- or 3.8-fold increase in expression compared to the 880 bp deletion (Fig. 3A). Similar results were shown in SH-SY5Y cells: deletion of the NACP–Rep1 and 317 bp upstream (pASP-3'NACP) or 452 bp downstream (pASP-5'NACP) of the repeat led to 2.3- or 1.6-fold increase in expression compared to the 880 bp deletion (Fig. 3B).
|
Sequence of the different alleles of the complex NACP–Rep1 repeat
According to sequences deposited in GenBank, human NACP–Rep1 alleles are composed of the following dinucleotides: (TC)(TT)(TC)(TA)(CA) with variable numbers of the TC, TA and CA dinucleotide repeats; the sequences of alleles 0 and 1 were reported as (TC)10(TT)1(TC)10(TA)8(CA)10 and (TC)10(TT)1(TC)10(TA)8(CA)11, respectively (accession nos AC015529, AC022357 and AP001947). In order to explore more fully the sequence differences among the different NACP–Rep1 alleles, we screened for individuals carrying alleles designated 0, 1, 2 and 3 based on the size of the alleles (8,10). Next, PCR products from individuals homozygous for alleles 0, 1 or 2 (eight, 12 and two chromosomes, respectively) and from an individual heterozygous for alleles 1 and 3, were subcloned into the pCR-TOPO vector and subsequently sequenced. We approached the problem of defining the actual sequence of these various alleles by sequencing independent, cloned PCR products with the assumption that sequences arising from PCR artifacts will be seen infrequently among the cloned products while the correct allele sequence will be seen repeatedly in the cloned PCR products. Using this approach, we compiled the sequences from the various alleles and observed that variation in the CA element is most likely responsible for the different length alleles. We confirmed that human NACP–Rep1 alleles are composed of the following dinucleotides: (TC)(TT)(TC)(TA)(CA) with variable numbers of the TC, TA and CA dinucleotide repeats (Table 1). Our analysis of all this sequence data suggested that the size variation among the different alleles is mainly due to the numbers of CA repeats, with 10, 11, 12 and 13 repeats present in alleles 0, 1, 2 and 3, respectively. Interestingly, alleles 1 and 0 may represent more than a single allele each since some individuals apparently homozygous for each of these alleles based on the length of the amplified product seemed to carry more than one allele at the sequence level (Table 1). However, these results could not be demonstrated without the use of PCR and it cannot be excluded that these results arise from PCR errors.
|
Analysis of the expression derived by constructs carrying different NACP–Rep1 alleles
To determine whether the variable length of the complex repeat is able to modulate the transcription of the
-synuclein gene, an 880 bp region of the native SNCA promoter/enhancer encompassing the NACP–Rep1 site was amplified from individuals carrying each of the alleles and cloned into the ASP-10.7 by replacing its original NACP–Rep1 allele (allele number –1). We further studied the promoter/enhancer activity of the NACP–Rep1 element in the neuroblastoma cells SH-SY5Y since it is more representative of the in vivo tissue in which -synuclein is expressed. Each construct was cotransfected with pRL-SV40 into SH-SY5Y cells and the expression compared to that seen with the promoter-less plasmid, pGL 3-Basic. The different constructs harboring the variable length CA repeat led to different levels of luciferase expression (Fig. 4A). In SH-SY5Y cells, the construct containing the largest repeat (13 CA) resulted in a 2.5-fold increase in activity over that seen with the pASP-10.7, which contains 10 CA repeats. It is of interest to note that this allele had been shown to be associated with sporadic PD in a German and an American population (10,12,13). The promoter activity was suppressed as the length of the repeat decreased to 12 CA, resulting in only a 1.5-fold increase in activity as compared to the shortest repeat. The highest promoter activity was seen with the construct containing the repeat with 11 CA, leading to a 3-fold increase in the expression relative to pASP-10.7 (Fig. 4A). In contrast, there were only minor changes of borderline statistical significance in expression levels seen in 293T cells among the different constructs harboring the variable length of CA repeat (Fig. 4B).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
The vast majority of PD patients do not show Mendelian inheritance of their disease and have no mutations in
-synuclein, yet they have deposits of -synuclein in pathognomonic aggregates, Lewy bodies and Lewy neurites, in the region of the substantia nigra as well as in other locations in the brain (15). One of the more important outstanding questions for research into the molecular pathogenesis of PD is the role of -synuclein in sporadic PD. The involvement of wild-type -synuclein in PD could be the result of post-translational modification or damage to the protein, altered regulation of expression, abnormal degradation or some combination of all three. In this study we explore the role of the region upstream of the SNCA gene in regulation of -synuclein expression and further show the contribution of the polymorphic NACP–Rep1 element to modulating the activity of the -synuclein promoter/enhancer.
First, we examined the region upstream of the SNCA gene for its basal promoter. A comparison of the luciferase reporter gene activity in pASP-1.9 and pASP-1.46 revealed that the 400 bp DNA fragment located immediately 5' of the reported transcriptional start site is sufficient to drive expression. Computational analysis revealed three potential Sp1 binding sites, but no TATA box, in this 400 bp segment. These features resemble previously described promoters of neuron-specific genes, such as Tau (16,17), the 5 subunit of the neuronal nicotinic receptor (18), the N-methyl-D-aspartate receptor subunit (NMDAR1) (19) and the recently characterized promoter of the human parkin gene (20). This is also in the size range of many common basal promoters but does not rule out that the basal promoter might be even shorter than the smallest fragment we studied.
Sequence analysis of the rest of the 10.7 kb DNA fragment upstream of SNCA predicted numerous additional potential binding sites for a number of transcription factors. An examination of promoter/enhancer activity of deletion constructs involving the upstream 10.7 kb sequence of the SNCA gene confirmed the importance of this region in control of -synuclein expression. In both 293T and SH-SY5Y cells, pASP-6.2 showed the highest levels of expression whereas pASP-9.8 had markedly lower expression levels, suggesting that perhaps a silencer element may reside within the 3.6 kb region included in pASP-9.8 but missing from pASP-6.2. The 880 bp segment present in pASP-10.7 and absent in pASP-9.8 can overcome, at least in part, the negative effect on expression of this 3.6 kb segment contained in pASP-9.8 but missing from pASP-6.2. In 293T cells, the effect of this 880 bp segment is striking and largely independent of the particular allele at NACP–Rep1. However, in SH-SY5Y cells different alleles had a significant effect on expression levels over a nearly 3-fold range. However, this effect was not simply linear with allele length but appeared to be biphasic in nature. Interestingly, the fact that the effect of the different alleles on the expression level is striking only in the neuroblastoma cells, implies that neuro-specific trans-acting factor/s might be involved in the modulation of expression driven by the NACP–Rep1 element.
When we studied the 880 bp segment in more detail in order to dissect out the contributions to gene expression of various portions of this segment, the two segments that flank the NACP–Rep1 appeared responsible, in an additive manner, for expression while the NACP–Rep1 itself was shown to have a negative effect on expression in both cell lines. These results suggest a model of two regulatory regions, one located upstream of the NACP–Rep1 and the other downstream of the repeat. The transcription factors binding in these two regions may interact to function in an additive manner while the NACP–Rep1 modulates this interaction to a greater or lesser extent depending on which allele is present at the NACP–Rep1 locus. Exactly how the composition of the repeat can modulate this interaction is unknown, but could perhaps be operating by altering how effectively or efficiently the transcription factors that bind upstream and downstream of the repeat can interact. A number of possible models could be envisioned for how the repeat might modulate the interaction between the two flanking regions such as the length of the repeat altering the phase of potential binding sites on the DNA double helix or on chromatin, or the base composition of the repeat altering the flexibility and secondary structure of the DNA, or both.
Five NACP–Rep1 alleles have previously been identified based on a size difference of two nucleotides (8,10) as determined by gel electrophoresis of the PCR products containing the repeats, but the actual base sequence differences responsible for the various alleles was incompletely known. Here, we show that variation in the CA element is most likely responsible for the different length alleles. However, our sequencing analysis of alleles 0 and 1 indicated that the same sequence variant occurred in more than one clone at positions other than within the CA repeat itself. Since such variants were seen more than once, it is possible that the actual number of alleles at this site might be greater than five (Table 1). However, these variants may still simply be the result of the same artifact occurring repeatedly during the PCR. Distinguishing these possibilities remains a serious challenge and requires comparing large numbers of cloned PCR products from individuals in families and correlating alleles in parents and offspring.
Our study suggests that a microsatellite located a long distance upstream of a gene may play a role in transcriptional regulation of that gene. Several studies in the past have implicated dinucleotide repeats in regulating transcription activity. Expression of the PAX-6 gene (21), the human NRAMP1 gene (22), COL1A2 (23) and MMP-9 (24,25) were shown to be regulated by polymorphic dinucleotide repeats in their 5' flanking region, and some alleles of these polymorphic repeat sequences were shown to enhance their expression. It is important to note that in most of the genes studied, the combined dinucleotide repeat was at a distance of 
1.5 kb upstream of the transcriptional start site. Here, we demonstrated that a complex, mixed dinucleotide repeat can influence gene expression from a much longer distance of 10 kb, such as might be seen with a long-range enhancer or a locus control region. It has been proposed that alternating sequences of purine–pyrimidine has the potential to adopt a Z-DNA conformation (26,27) which was suggested to be involved in the regulation of gene expression (28–30). Indeed, the repeats implicated in gene regulation described above all contain CA or GT dinucleotides of variable length; the NACP–Rep1 site includes both TA and CA dinucleotides, with polymorphic variation in the CA dinucleotide associated with changes in the function of the SNCA promoter/enhancer. Further studies to determine if there is non B-DNA conformation of the NACP–Rep1 repeat in vivo are of interest.
Three previous studies have reported an association between certain alleles of the NACP–Rep1 locus and sporadic PD (11–13) whereas another study failed to replicate the finding in a Japanese population (14). There are obvious intricacies and difficulties in the analysis and interpretation of association studies of a complex disease trait such as PD when microsatellite loci are used. One problem is that because of the difficulties inherent in sequencing PCR products containing dinucleotide microsatellite repeats, assigning alleles at the NACP–Rep1 locus has relied on determining the size of the PCR products by gel electrophoresis. However, such size determinations are not straightforward. Even when the same PCR primers are used, various instruments and electrophoresis conditions used in different laboratories may lead to variation in the measurements of fragment size and problems with comparing association studies if two laboratories use the same allele number to refer to different alleles. An additional challenge with a complex, mixed microsatellite like NACP–Rep1 is that size alone may not be adequate for defining alleles if two DNA fragments of the same size differ in their composition, having more of one kind of repeat and fewer of another. Two alleles of the same overall length but with different base compositions may have different functional consequences.
We have shown that the various NACP–Rep1 alleles, cloned into the same reporter construct, have different effects on expression of a reporter gene driven by the SNCA promoter/enhancer region. Although one can not exclude that the association between the NACP–Rep1 and sporadic PD is the result of another site in linkage disequilibrium with NACP–Rep1, our experiments lend support to the hypothesis that it is the NACP–Rep1 microsatellite itself that has a biological function in the regulation of SNCA gene expression. Thus, one can speculate that polymorphism at this microsatellite might be involved in sporadic PD via its effect on the expression of the SNCA gene contributing, among other factors, to the risk for disease.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Computational analysis: a prediction of the promoter/enhancer region
The analysis of potential transcription factor binding sites was performed on the sequence of the 10.7 kb upstream segment of SNCA (GenBank accession no. AF163864) using the MatInspector V2.2 software (BCM Gene finder).
Luciferase reporter constructs
A 10.7 kb DNA fragment upstream of the SNCA translation start site was amplified from the human PAC 27M07 (GenBank accession no. AF163864, positions 19 040–29 776) as previously described by Touchman et al. (9). The full-length promoter/enhancer plasmid is designated pASP-10.7 (Fig. 1). Seven plasmids containing a series of progressive deletions were constructed by using the following restriction sites (Fig. 1): pASP-9.8, StuI in the insert (position 19 889) and the KpnI site in the vector; pASP-6.2, PacI in the insert (position 23 565) and the KpnI site in the vector; pASP-4.1, SacI in the insert (position 25 637) and the vector; pASP-3.8, SpeI in the insert (position 25 955) and the vector; pASP-3.4, HindIII in the insert (position 26 404) and the vector; pASP-1.9, SalI in the insert (position 27 882) and the KpnI site in the vector. The control plasmid, pAS-1.46, which includes only sequences downstream of the transcriptional start site, was constructed by PCR using the forward primer CCTTCTGCCTTTCCACCCTCGTGAG (positions 28 439–28 463) and the reverse primer CCTTTACACCACACTGGAAAACATAAA (8). Next, we removed each promoter construct by restriction endonuclease digestion at the MluI–XhoI sites of pCR-XL-TOPO and cloned each into the MluI–XhoI sites of the pGL-3 Basic vector (Promega, Madison, WI) which contains the firefly luciferase coding sequence but lacks eukaryotic promoter or enhancer elements. All the plasmids are designated, as mentioned above, as ‘pASP-’ followed by the insert size.
The plasmids that contain different alleles at the NACP–Rep1 site were constructed by inserting sequence verified segments of the NACP–Rep1 region derived by PCR amplification of genomic DNA from individuals from the CEPH collection carrying alleles 1, 2 or 3, using the forward primer ASP-F TGAAGTTAACCTCCCCTCAATACC and the reverse primer NACP-R AAGAAGACAGCCATCTGCAAGCC (positions 19 897–19 922). Each of the three PCR products was cloned into the pCR-XL-TOPO vector. The sequence of each of the alleles at the NACP–Rep1 site was determined. Next, each construct was cut at the StuI site in the insert and the MluI site in the vector and cloned into these sites of the pASP-10.7 plasmid, replacing its original StuI–MluI fragment. The plasmids carrying the NACP–Rep1 alleles are designated pASP-1, pASP-2 and pASP-3 according to the allele number each carries.
The plasmid harboring the NACP–Rep1 deletion, pASP-NACP (Fig. 1), was constructed using the SOE PCR method (31). The region upstream of the NACP–Rep1 site (positions 19 040–19 355) was amplified from pASP-1 using the forward primer ASP-F and the reverse primer CTGATGCCTTCCATAGCTACTAATCCATCC which includes a tail of 10 bp complementary to the 5' of the region downstream the NACP–Rep1. The region downstream of the NACP–Rep1 site (positions 19 439–19 922) was amplified from pASP-1 using the reverse primer NACP-R and the forward primer GTAGCTATGGAAGGCATCAGATATCTCATG, which includes a tail of 10 bp complementary to the 3' of the region upstream the NACP–Rep1. These two PCR products share a complementary 20 bp fragment. Next, PCR was performed to combine the PCR products of the regions upstream and downstream of the NACP–Rep1 using the forward primer and the reverse primer. The PCR products of the regions upstream and downstream of the NACP–Rep1 were mixed and denatured at 100°C for 10 min and transferred immediately to ice, then added to the PCR mixture and subjected to 30 cycles of PCR as follows: 94°C for 2 min, 55°C for 2 min, 72°C for 2 min, followed by 72°C for 10 min. The combined PCR product was cloned into the pCR-XL-TOPO vector and its sequence and orientation in the vector determined. Next the construct was cut at the StuI site in the insert and the MluI site in the vector and cloned into these sites of the pASP-10.7 plasmid, replacing its original StuI–MluI fragment.
Plasmids carrying a deletion of the NACP–Rep1 and the region upstream of the repeat, pASP-3'NACP, or a deletion of the NACP–Rep1 and a 452 bp fragment downstream of the repeat, pASP-5'NACP (Fig. 1), were constructed as follows. For pASP-3'NACP, the region downstream of the NACP–Rep1 (position 19 439–19 922) was amplified using the reverse primer NACP-R and the forward primer GAAGGCATCAGATATCTCATG. For pASP-5'NACP, the region upstream of the NACP–Rep1 (position 19 040–19 355) was amplified using the forward primer NACP-F and the reverse primer AGGCCTCATAGCTACTAATCCATCC in which a StuI site was inserted. Each PCR product was cloned into the pCR-XL-TOPO vector and its sequence was determined. Next, each construct was cut at the StuI site in the insert and the MluI site in the vector and cloned into these sites of the pASP-10.7 plasmid, replacing its original StuI–MluI fragment.
Cell culture and transfection
293T, a transformed human kidney cell, and SH-SY5Y, a human neuroblastoma cell line (American Type Culture Collection), were grown in Dulbecco’s modified Eagle’s medium (DMEM) (glucose at 4.5 g/l) and DMEM/F-12 1:1 medium, respectively, supplemented with 10% fetal bovine serum, 2 mM glutamine, 100 U/ml penicillin and 100 mg/ml streptomycin. Cells were maintained at 37°C in a humidified 5% CO2 incubator. A total of 2.5 x 105 293T cells and 1 x 106 SH-SY5Y cells were plated onto each well of a six-well dish the day prior to transfection. To test the expression of each construct, in 293T cells, 100 ng of pASP-10.7, pASP-1, pASP-2 and pASP-3, an amount of each deleted pASP plasmid that was calculated to be a molar equivalent of 100 ng of pASP-10.7, or 33 ng of the pGL 3-Basic plasmid was used. Each test plasmid was mixed with 1 ng of the reference plasmid, pRL-TK (harboring the HSV thymidine kinase promoter upstream of Renilla luciferase), and transfected by the calcium phosphate method using a mammalian transfection kit (Stratagene, La Jolla, CA) according to the manufacturer’s instructions. Cells were incubated for 24 h at 37°C, washed with phosphate-buffered saline, and incubated in fresh medium for an additional 24 h. For each cotransfection experiment into SH-SY5Y cells, 2 µg of pASP-10.7, pASP-1, pASP-2 and pASP-3 or the molar equivalent of each of the deleted pASPs plasmids, or 660 ng of pGL 3-Basic and 10 ng of the reference plasmid, pRL-SV40 (harboring the SV40 early enhancer/promoter region upstream of Renilla luciferase), were mixed and cotransfected using the FuGENETM 6 Transfection Reagent (Roche, Indianapolis, IN) according to the manufacturer’s instructions. Cells were incubated for 48 h at 37°C prior to harvesting.
The three wells were independently transfected in parallel with three individually prepared aliquots of transfection reaction and the results from all three replicates were averaged. Each triplicate experiment was repeated three to six times on separate days.
For each construct, three to six experiments were performed. For each construct in each cell line, one experiment consisted of performing the transfection and expression assay in triplicate on three wells of cultured cells independently transfected in parallel with three individually prepared aliquots of transfection reaction.
Luciferase assay
293T and SH-SY5Y cells were washed and lysed in 150 and 200 µl of passive lysis buffer (Promega), respectively. Firefly luciferase and Renilla luciferase activities were measured with 5 µl of 293T or 10 and 20 µl of SH-SY5Y cell lysate using the Dual-Luciferase Reporter assay system (Promega) in a luminometer (EG&G Wallac, Germany). ‘Relative activity’ was defined as the ratio of firefly luciferase activity to Renilla luciferase activity and was calculated by dividing luminescence intensity obtained in the assay for firefly luciferase by that obtained for Renilla luciferase. ‘Fold expression’ is defined as the ratio of the relative activity seen with each test plasmid carrying a portion of the SNCA upstream region to the basal relative activity and was calculated by dividing the average value of relative activity of each construct to the relative activity of the pGL 3-Basic plasmid without any insert. Overall statistical significance of differences in expression among all the different deletion constructs were analyzed by ANOVA while pairwise comparisons of between different constructs were made with the two-tailed Student’s t-test (Smith’s Statistical Package freeware, http://www.economics.pomona.edu/StatSite/SSP.html).
Genotyping the NACP–Rep1 alleles and sequence determination of the different alleles
For NACP–Rep1 alleles were genotyping by size by previously published methods (10). The region of the NACP–Rep1 polymorphism was amplified by PCR with the primers Rep1 (CCTGGCATATTTGATTGCAA) and Rep2 (GACTGGCCCAAGATTAACCA). The forward primer, Rep1, contained the conjugated fluorophore FAM (Gibco BRL, Gaithersburg, MD). Two microliters of each PCR product, 2.5 µl of formamide, 0.5 µl of loading buffer and 0.5 µl of size standard (Prism Genescan-350 Tamra; Applied Biosystems, Foster City, CA) were denatured at 95°C for 5 min and separated on an ABI 377 automated DNA sequencer with Genescan and Genotyper software. The convention established by Xia et al. (8) for naming alleles was used (PCR product length of 265 bp = allele –1, 267 bp = allele 0, 269 bp = allele 1, 271 bp = allele 2, 273 bp = allele 3).
The determination of the sequences of the different alleles and the basis of the size difference was performed as follows: PCR products from individuals homozygous for alleles 0, 1, 2 (four, six and one individuals, respectively) and an individual compound heterozygous for alleles 1 and 3 were cloned into the pCR-TOPO vector (Invitrogen, Carlsbad, CA) and subsequently sequenced by standard dideoxy chain termination methods using fluorescently labeled nucleotides and the sequence determined on an ABI 377 sequencer (Seqwright).
|
ACKNOWLEDGEMENTS |
|---|
We thank Dr Brian Potterf for his help in setting up luciferase assays and Dr Jennifer Johnston for her help with the Genescan analysis. This work was performed within the Intramural Research Program of the National Human Genome Research Institute.
|
FOOTNOTES |
|---|
+ To whom correspondence should be addressed. Tel: +1 301 402 2039; Fax: +1 301 402 2170; Email: rlnuss@nhgri.nih.gov
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
1 Ueda, K., Fukushima, H., Masliah, E., Xia, Y., Iwai, A., Yoshimoto, M., Otero, D.A., Kondo, J., Ihara, Y. and Saitoh, T. (1993) Molecular cloning of cDNA encoding an unrecognized component of amyloid in Alzheimer disease. Proc. Natl Acad. Sci. USA, 90, 11282–11286.
2 Polymeropoulos, M.H., Lavedan, C., Leroy, E., Ide, S.E., Dehejia, A., Dutra, A., Pike, B., Root, H., Rubenstein, J., Boyer, R. et al. (1997) Mutation in the -synuclein gene identified in families with Parkinson’s disease. Science, 276, 2045–2047.
3 Kruger, R., Kuhn, W., Muller, T., Woitalla, D., Graeber, S., Kosel, S., Przuntek, H., Epplen, J.T., Schols, L. and Riess, O. (1998) Ala30Pro mutation in the gene encoding -synuclein in Parkinson’s disease. Nat. Genet., 18, 106–108.[Web of Science][Medline]
4 Spillantini, M.G., Schmidt, M.L., Lee, V.M., Trojanowski, J.Q., Jakes, R. and Goedert, M. (1997) -Synuclein in Lewy bodies. Nature, 388, 839–840.[Medline]
5 Masliah, E., Rockenstein, E., Veinbergs, I., Mallory, M., Hashimoto, M., Takeda, A., Sagara, Y., Sisk, A. and Mucke, L. (2000) Dopaminergic loss and inclusion body formation in -synuclein mice: implications for neurodegenerative disorders. Science, 287, 1265–1269.
6 Feany, M.B. and Bender, W.W. (2000) A Drosophila model of Parkinson’s disease. Nature, 404, 394–398.[Medline]
7 Golbe, L.I. (1999) -Synuclein and Parkinson’s disease. Mov. Disord., 14, 6–9.[Web of Science][Medline]
8 Xia, Y., Rohan de Silva, H.A., Rosi, B.L., Yamaoka, L.H., Rimmler, J.B., Pericak-Vance, M.A., Roses, A.D., Chen, X., Masliah, E., DeTeresa, R. et al. (1996) Genetic studies in Alzheimer’s disease with an NACP/-synuclein polymorphism. Ann. Neurol., 40, 207–215.[Web of Science][Medline]
9 Touchman, J.W., Dehejia, A., Chiba-Falek, O., Cabin, D.E., Schwartz, J.R., Orrison, B.M., Polymeropoulos, M.H. and Nussbaum, R.L. (2001) Human and mouse -synuclein genes: comparative genomic sequence analysis and identification of a novel gene regulatory element. Genome Res., 11, 78–86.
10 Hellman, N.E., Grant, E.A. and Goate, A.M. (1998) Failure to replicate a protective effect of allele 2 of NACP/-synuclein polymorphism in Alzheimer’s disease: an association study. Ann. Neurol., 44, 278–281.[Web of Science][Medline]
11 Kruger, R., Vieira-Saecker, A.M., Kuhn, W., Berg, D., Muller, T., Kuhnl, N., Fuchs, G.A., Storch, A., Hungs, M., Woitalla, D. et al. (1999) Increased susceptibility to sporadic Parkinson’s disease by a certain combined -synuclein/apolipoprotein E genotype. Ann. Neurol., 45, 611–617.[Web of Science][Medline]
12 Tan, E.K., Matsuura, T., Nagamitsu, S., Khajavi, M., Jankovic, J. and Ashizawa, T. (2000) Polymorphism of NACP–Rep1 in Parkinson’s disease: an etiologic link with essential tremor? Neurology, 54, 1195–1198.
13 Farrer, M., Maraganore, D.M., Lockhart, P., Singleton, A., Lesnick, T.G., de Andrade, M., West, A., de Silva, R., Hardy, J. and Hernandez, D. (2001) -Synuclein gene haplotypes are associated with Parkinson’s disease. Hum. Mol. Genet., 10, 1847–1851.
14 Izumi, Y., Morino, H., Oda, M., Maruyama, H., Udaka, F., Kameyama, M., Nakamura, S. and Kawakami, H. (2001) Genetic studies in Parkinson’s disease with an -synuclein/NACP gene polymorphism in Japan. Neurosci. Lett., 300, 125–127.[Web of Science][Medline]
15 Mezey, E., Dehejia, A.M., Harta, G., Suchy, S.F., Nussbaum, R.L., Brownstein, M.J. and Polymeropoulos, M.H. (1998) -Synuclein is present in Lewy bodies in sporadic Parkinson’s disease. Mol. Psychiatry, 3, 493–499.[Web of Science][Medline]
16 Sadot, E., Heicklen-Klein, A., Barg, J., Lazarovici, P. and Ginzburg, I. (1996) Identification of a tau promoter region mediating tissue-specific-regulated expression in PC12 cells. J. Mol. Biol., 256, 805–812.[Web of Science][Medline]
17 Heicklen-Klein, A. and Ginzburg, I. (2000) Tau promoter confers neuronal specificity and binds Sp1 and AP-2. J. Neurochem., 75, 1408–1418.[Web of Science][Medline]
18 Campos-Caro, A., Carrasco-Serrano, C., Valor, L.M., Viniegra, S., Ballesta, J.J. and Criado, M. (1999) Multiple functional Sp1 domains in the minimal promoter region of the neuronal nicotinic receptor 5 subunit gene. J. Biol. Chem., 274, 4693–4701.
19 Bai, G. and Kusiak, J.W. (1995) Functional analysis of the proximal 5'-flanking region of the N-methyl-D-aspartate receptor subunit gene, NMDAR1. J. Biol. Chem., 270, 7737–7744.
20 West, A., Farrer, M., Petrucelli, L., Cookson, M., Lockhart, P. and Hardy, J. (2001) Identification and characterization of the human parkin gene promoter. J. Neurochem., 78, 1146–1152.[Web of Science][Medline]
21 Okladnova, O., Syagailo, Y.V., Tranitz, M., Stober, G., Riederer, P., Mossner, R. and Lesch, K.P. (1998) A promoter-associated polymorphic repeat modulates PAX-6 expression in human brain. Biochem. Biophys. Res. Commun., 248, 402–405.[Web of Science][Medline]
22 Searle, S. and Blackwell, J.M. (1999) Evidence for a functional repeat polymorphism in the promoter of the human NRAMP1 gene that correlates with autoimmune versus infectious disease susceptibility. J. Med. Genet., 36, 295–299.
23 Akai, J., Kimura, A. and Hata, R.I. (1999) Transcriptional regulation of the human type I collagen 2 (COL1A2) gene by the combination of two dinucleotide repeats. Gene, 239, 65–73.[Web of Science][Medline]
24 Peters, D.G., Kassam, A., St Jean, P.L., Yonas, H. and Ferrell, R.E. (1999) Functional polymorphism in the matrix metalloproteinase-9 promoter as a potential risk factor for intracranial aneurysm. Stroke, 30, 2612–2616.
25 Shimajiri, S., Arima, N., Tanimoto, A., Murata, Y., Hamada, T., Wang, K.Y. and Sasaguri, Y. (1999) Shortened microsatellite d(CA)21 sequence down-regulates promoter activity of matrix metalloproteinase 9 gene. FEBS Lett., 455, 70–74.[Web of Science][Medline]
26 Hamada, H. and Kakunaga, T. (1982) Potential Z-DNA forming sequences are highly dispersed in the human genome. Nature, 298, 396–398.[Medline]
27 Nordheim, A. and Rich, A. (1983) The sequence (dC-dA)n X (dG-dT)n forms left-handed Z-DNA in negatively supercoiled plasmids. Proc. Natl Acad. Sci. USA, 80, 1821–1825.
28 Hamada, H., Seidman, M., Howard, B.H. and Gorman, C.M. (1984) Enhanced gene expression by the poly(dT-dG).poly(dC-dA) sequence. Mol. Cell. Biol., 4, 2622–2630.
29 Schroth, G.P., Chou, P.J. and Ho, P.S. (1992) Mapping Z-DNA in the human genome. Computer-aided mapping reveals a nonrandom distribution of potential Z-DNA-forming sequences in human genes. J. Biol. Chem., 267, 11846–11855.
30 Rich, A. (1994) Speculation on the biological roles of left-handed Z-DNA. Ann. N. Y. Acad. Sci., 726, 1–17.[Web of Science]
31 Warrens, A.N., Jones, M.D. and Lechler, R.I. (1997) Splicing by overlap extension by PCR using asymmetric amplification: an improved technique for the generation of hybrid proteins of immunological interest. Gene, 186, 29–35.[Web of Science][Medline]
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  S. Lesage and A. Brice Parkinson's disease: from monogenic forms to genetic susceptibility factors Hum. Mol. Genet., April 15, 2009; 18(R1): R48 - R59. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. R. Scherzer, J. A. Grass, Z. Liao, I. Pepivani, B. Zheng, A. C. Eklund, P. A. Ney, J. Ng, M. McGoldrick, B. Mollenhauer, et al. GATA transcription factors directly regulate the Parkinson's disease-linked gene {alpha}-synuclein PNAS, August 5, 2008; 105(31): 10907 - 10912. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Fuchs, A. Tichopad, Y. Golub, M. Munz, K. J. Schweitzer, B. Wolf, D. Berg, J. C. Mueller, and T. Gasser Genetic variability in the SNCA gene influences {alpha}-synuclein levels in the blood and brain FASEB J, May 1, 2008; 22(5): 1327 - 1334. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Winkler, J. Hagenah, S. Lincoln, M. Heckman, K. Haugarvoll, K. Lohmann-Hedrich, V. Kostic, M. Farrer, and C. Klein {alpha}-Synuclein and Parkinson disease susceptibility Neurology, October 30, 2007; 69(18): 1745 - 1750. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. L. Clough and L. Stefanis A novel pathway for transcriptional regulation of {alpha}-synuclein FASEB J, February 1, 2007; 21(2): 596 - 607. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Pittman, H.-C. Fung, and R. de Silva Untangling the tau gene association with neurodegenerative disorders Hum. Mol. Genet., October 15, 2006; 15(suppl_2): R188 - R195. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. M. Maraganore, M. de Andrade, A. Elbaz, M. J. Farrer, J. P. Ioannidis, R. Kruger, W. A. Rocca, N. K. Schneider, T. G. Lesnick, S. J. Lincoln, et al. Collaborative analysis of alpha-synuclein gene promoter variability and Parkinson disease. JAMA, August 9, 2006; 296(6): 661 - 670. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Leng and D.-M. Chuang Endogenous alpha-synuclein is induced by valproic acid through histone deacetylase inhibition and participates in neuroprotection against glutamate-induced excitotoxicity. J. Neurosci., July 12, 2006; 26(28): 7502 - 7512. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. W. Shults Lewy bodies PNAS, February 7, 2006; 103(6): 1661 - 1668. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Bonsch, T. Lederer, U. Reulbach, T. Hothorn, J. Kornhuber, and S. Bleich Joint analysis of the NACP-REP1 marker within the alpha synuclein gene concludes association with alcohol dependence Hum. Mol. Genet., April 1, 2005; 14(7): 967 - 971. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Li, N. West, E. Colla, O. Pletnikova, J. C. Troncoso, L. Marsh, T. M. Dawson, P. Jakala, T. Hartmann, D. L. Price, et al. Aggregation promoting C-terminal truncation of {alpha}-synuclein is a normal cellular process and is enhanced by the familial Parkinson's disease-linked mutations PNAS, February 8, 2005; 102(6): 2162 - 2167. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Gispert, C. Trenkwalder, L. Mota-Vieira, V. Kostic, and G. Auburger Failure to Find {alpha}-Synuclein Gene Dosage Changes in 190 Patients With Familial Parkinson Disease Arch Neurol, January 1, 2005; 62(1): 96 - 98. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Li, C. Lesuisse, Y. Xu, J. C. Troncoso, D. L. Price, and M. K. Lee Stabilization of {alpha}-Synuclein Protein with Aging and Familial Parkinson's Disease-Linked A53T Mutation J. Neurosci., August 18, 2004; 24(33): 7400 - 7409. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. K. Tan, A. Chai, Y. Y. Teo, Y. Zhao, C. Tan, H. Shen, V. R. Chandran, M. L. Teoh, Y. Yih, R. Pavanni, et al. Alpha-synuclein haplotypes implicated in risk of Parkinson's disease Neurology, January 13, 2004; 62(1): 128 - 131. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Theuns, J. Remacle, R. Killick, E. Corsmit, K.'l Vennekens, D. Huylebroeck, M. Cruts, and C. V. Broeckhoven Alzheimer-associated C allele of the promoter polymorphism -22C>T causes a critical neuron-specific decrease of presenilin 1 expression Hum. Mol. Genet., April 15, 2003; 12(8): 869 - 877. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. CHIBA-FALEK and R.L. NUSSBAUM Regulation of {alpha}-Synuclein Expression: Implications for Parkinson's Disease Cold Spring Harb Symp Quant Biol, January 1, 2003; 68(0): 409 - 416. [Abstract] [PDF]
|
|
|
|
|
|
A. B. West, D. Maraganore, J. Crook, T. Lesnick, P. J. Lockhart, K. M. Wilkes, G. Kapatos, J. A. Hardy, and M. J. Farrer Functional association of the parkin gene promoter with idiopathic Parkinson's disease Hum. Mol. Genet., October 15, 2002; 11(22): 2787 - 2792. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||