Human Molecular Genetics, 2002, Vol. 11, No. 1 33-42
© 2002 Oxford University Press
Domain disruption and mutation of the bZIP transcription factor, MAF, associated with cataract, ocular anterior segment dysgenesis and coloboma
1University Department of Medical Genetics and Regional Genetic Service, St Marys Hospital, Manchester, M13 0JH, UK, 2Department of Clinical Genetics, The Childrens Hospital at Westmead, Sydney, NSW, Australia, 3Royal Manchester Childrens Hospital, Manchester, UK, 4University Department of Ophthalmology, Manchester Royal Eye Hospital, Manchester, M13 9WH, UK, 5Department of Ophthalmology, The Hospital for Sick Children, Toronto, Ontario, Canada, 6Department of Ophthalmology, Royal Childrens Hospital, Melbourne, Victoria, Australia, 7MRC Human Genetics Unit, Western General Hospital, Edinburgh EH4 2XU, UK and 8Hopital Ophtalmique Jules Gonin, Center Hospitalier Universitaire Vaudois, Lausanne, Switzerland
Received September 4, 2001; Revised and Accepted November 5, 2001.
| ABSTRACT |
|---|
|
|
|---|
Human congenital cataract and ocular anterior segment dysgenesis both demonstrate extensive genetic and phenotypic heterogeneity. We identified a family where ocular developmental abnormalities (cataract, anterior segment dysgenesis and microphthalmia) co-segregated with a translocation, t(5;16)(p15.3;q23.2), in both balanced and unbalanced forms. We hypothesized that this altered the expression of a gene of developmental significance in the human lens and ocular anterior segment. Cloning the 16q23.2 breakpoint demonstrated that it transected the genomic-control domain of MAF, a basic region leucine zipper (bZIP) transcription factor, first identified as an oncogene, which is expressed in vertebrate lens development and regulates the expression of the eye lens crystallins. The homozygous null mutant Maf mouse embryo demonstrates defective lens formation and microphthalmia. Through mutation screening of a panel of patients with hereditary congenital cataract we identified a mutation in MAF in a three-generation family with cataract, microcornea and iris coloboma. The mutation results in the substitution of an evolutionarily highly conserved arginine with a proline at residue 288 (R288P) in the basic region of the DNA-binding domain of MAF. Our findings further implicate MAF/Maf in mammalian lens development and highlight the role of the lens in anterior segment development. The 16q23.2 breakpoint transects the common fragile site, FRA16D, providing a molecular demonstration of a germline break in a common fragile site.
| INTRODUCTION |
|---|
|
|
|---|
Cataract is one of the major causes of treatable blindness in humans. While congenital forms are less common, as are abnormalities of ocular anterior segment development, both are difficult to treat and represent a significant cause of childhood blindness (1,2). A large proportion of congenital isolated cataract, perhaps up to 50%, is inherited with the majority in an autosomal dominant pattern. Mutations in many genes have now been identified in a small percentage of congenital cataract patients, underlining the genetic heterogeneity within this group (3). The majority encode lens fibre-specific proteins such as crystallins or lens fibre transmembrane molecules, whereas two are encoded by the transcription factors PAX6 and PITX3 (4,5).
The lens and the anterior segment are linked in development with a commonality of origin in surface ectoderm components, a necessity for separation of these components for anterior chamber formation and a requirement for signalling from the lens for anterior segment organization (6). This suggests that whereas some cases in the heterogeneous group of conditions known as anterior segment disorders may arise due to abnormalities in neural crest migration, it is likely that others arise due to abnormalities in lens development. In humans, Peters anomaly is a form of anterior segment dysgenesis characterized by central corneal opacity, where cataract may also be present (7), and there may be a spectrum of these anomalies within the one family (8). Mutations in Pax6 (small eye)/PAX6 and Pitx3 (aphakia)/PITX3 can result in such anomalies of the lens and anterior segment in murine and human ocular development (5,911). In humans, mutations in these genes are also described in individuals with isolated cataract (4,5). Peters anomaly may also be associated with other ocular malformations, such as microphthalmia, microcornea and coloboma (12,13). These findings suggest that a gene known more specifically for its involvement in either lens or anterior segment development may be a candidate as a disease-causing gene for either cataract or anterior segment dysgenesis, and that one such gene may be associated with a spectrum of lens and anterior segment anomalies.
Maf is a basic region leucine zipper (bZIP) transcription factor expressed in the lens placode, vesicle and, later, the primary lens fibres (1417). The key role of Maf in eye development is highlighted by the fact that homozygous null mutant mouse embryos exhibit defective lens formation and microphthalmia, and show decreased expression of crystallins (15,17,18). Both homodimers and heterodimers formed by Maf bind to two known Maf response elements (MAREs), with varying affinities and transactivation potentials (19,20). MARE elements are found in the promoters of the crystallin genes and Pitx3 (10,21). The Maf family of bZIP transcription factors was first identified through the v-maf oncogene, an avian retrovirus transforming gene, and maf is the cellular homologue (22). It is a member of the large Maf family (23), which also includes Krml (the product at the mutant kreisler locus, now renamed Mafb), important in hindbrain and otic development in the mouse (24) and Nrl which functions in the neural retina (25). To date, NRL is the sole member of the Maf family associated with a human disease phenotype, autosomal dominant retinitis pigmentosa (26).
We have identified two families where abnormalities of the lens and the anterior segment of the eye are segregating in association with likely abnormality of MAF function in early ocular development. In the first family, congenital cataract co-segregates with a translocation, t(5;16)(p15.3;q23.2), in balanced and unbalanced forms, and Peters anomaly is also present in unbalanced cases. Our molecular analysis in this family shows that the translocation breakpoint on 16q23.2 lies close to the lens-development gene, MAF, and transects the common fragile site, FRA16D. In the second family, congenital cataract segregates in a three-generation family, and microcornea and iris coloboma are also associated. In this family, we have identified a mutation in the DNA-binding domain of MAF. These findings implicate MAF as a disease gene in the complex pathway of transcriptional regulatory genes involved in human lens development and related ocular anterior segment development.
| RESULTS |
|---|
|
|
|---|
Clinical findings
In family 1 (Fig. 1A), individuals (I.1 and II.3) with a balanced translocation, 46,XY,t(5;16)(p15.3;q23.2) had juvenile-onset progressive cataracts. The cataracts were widespread, cortical pulverulent opacities with anterior and posterior sutural densities (Table 1). These individuals were otherwise well. Individuals with an unbalanced derivative karyotype, 46,XX,der(5),t(5;16)(p15.3;q23.2) also had congenital cataracts but had more severe ocular phenotypes. In one case, there was progression to total cataracts and severe myopia (II.2), while two (III.2 and III.3) had opaque corneas. III.3 had bilateral Peters anomaly, with small cataractous lens remnants, rims of abnormal iris and microphthalmia (Fig. 1B). Those with the unbalanced karyotype were also developmentally delayed, had dysmorphic facial features and one (III.2) died soon after birth due to laryngeal stenosis. Two individuals with cataracts and developmental delay (II.1 and III.1), who did not have karyotypes performed before their deaths, had similar dysmorphic and physical features to those with this unbalanced karyotype.
|
|
In family 2, juvenile-onset cataract segregated in three generations (Table 1; Fig. 1C). The cataracts were cortical, pulverulent lens opacities in a lamellar distribution. Nuclear, pulverulent opacities were present in two cases (I.1 and III.3). There was later progression with posterior subcapsular opacification that necessitated surgery in adult life. In addition to cataract, two affected individuals (II.2 and II.3) had microcornea and one (III.3) also had bilateral iris colobomas (Fig. 1D).
Other individuals, from affected families and isolated cases, with congenital cataract (139 cases), anterior segment anomalies (50 cases) and microphthalmia (28 cases) were also studied.
Translocation breakpoint cloning in family 1
Within family 1, early-onset cataracts were present in all individuals carrying rearranged chromosomes, whether in balanced or unbalanced configuration. The presence of the phenotype in individuals with a balanced translocation strongly suggests that the phenotype is a direct consequence of altered expression of a gene at or close to one of the breakpoints. Individuals with the unbalanced karyotype have a derivative 5 chromosome, der(5), and are trisomic for 16q23.2-ter and monosomic for 5p15.3-ter. Neither of these partial aneuploidies, particularly the well described 5p deletions, is usually associated with cataract or abnormalities of the anterior segment of the eye (2729). This supports the hypothesis that the phenotype relates to an abnormality at one of the breakpoints and implicates specifically the breakpoints of the der(5) chromosome. The Marner cataract, which is described in an autosomal dominant pedigree, has similar lenticular features to those seen in our family and is linked to the long arm of chromosome 16 (30). There are no reports of cataract families linked to 5p15.3. We hypothesized that of the two breakpoints contained on the der(5) chromosome, the gene of interest was more likely to lie on the long arm of chromosome 16, and breakpoint localization was conducted at both 16q23.2 and 5p15.3.
Initially, we used highly polymorphic genetic markers to detect the presence or absence of trisomy of distal 16q in patient III.3 (Fig. 2A). Thereafter more detailed analysis utilized somatic cell hybrids, each containing one of the two derivative chromosomes from balanced translocation patient, II.3 (Fig. 2B). A high resolution physical map of the 16q23.2 breakpoint was constructed and is shown in Figure 2C. The 16q23.2 breakpoint lies in BAC RP11-264L1 (GenBank accession no. AC046158) and sequencing across the breakpoints shows only a 3 bp loss. This lies within the eighth intron of the FOR II product of the WWOX gene (31,32) (Fig. 2C) and is within the 200 kb region spanning the FRA16D common fragile site (33).
|
The 16q23.2 translocation breakpoint is within a region of recurrent de novo somatic translocations in B cells of multiple myeloma patients (Fig. 2C). These are associated with dysregulation of expression of MAF which can function as an oncogene (34), and this is thought to be due to translocated proximity of MAF to the IgH enhancer(s) active in B cells. This suggests that in family 1, the breakpoint lies in the genomic-control domain of MAF, and that translocations at large distances from MAF are able to alter its expression. BLAST analysis of the available sequence from the breakpoint to MAF revealed no other known genes or ESTs expressed in the eye or with features of a gene involved in ocular abnormality. The intragenic disruption of the WWOX gene by the chromosome 16 breakpoint would be expected to lead to a 50% reduction of the FOR II product in the balanced translocation carriers, but should have no effect in the unbalanced individuals. Since both categories have eye defects, it is unlikely that WWOX is implicated. The presence of control elements for one gene within an unrelated neighbouring gene has been observed repeatedly (35).
The 5p15.3 breakpoint was localized to a 3.4 kb region in the partially sequenced BAC CTD-2299B9 (GenBank accession no. AC025775). Analysis of a 750 kb region surrounding this breakpoint revealed no known genes expressed in the eye. An EST cluster identified at
250 kb centromeric to the breakpoint shows similarity to murine Irx2 (iriquois related homeobox 2) and is likely to be the human homologue of this gene. The murine expression pattern of this gene suggests that it is not a likely candidate gene for isolated lens and anterior segment abnormality (36).
MAF mutation in family 2 with dominant cataract and coloboma
MAF mRNA exists in single- (4.4 kb) and two-exon (2.3 kb) forms due to alternative RNA processing. The resultant proteins are identical in their first 372 amino acids which include all known functional domains, have similar expression patterns in human tissues and differ by the addition of 30 amino acids at the C-terminal end in the second form (34) (Fig. 2D). We screened the coding regions of both forms for mutations using single-strand conformation polymorphism/heteroduplex analysis. We identified a mutation in MAF in a family where autosomal dominant juvenile-onset cataract is segregating in three generations (Fig. 1C). One individual also has iris coloboma and two of five affected individuals have microcornea. Analysis of genomic DNA revealed a G
C transition at nucleotide position 1670 of MAF (GenBank accession no. AF055376) (Fig. 1F). This mutation substitutes a highly conserved arginine with proline at amino acid position 288 (R288P) in the basic region DNA-binding domain of MAF. The mutation also destroys an MspI restriction enzyme site, which confirmed full co-segregation between the mutation and the disease phenotypes (Fig. 1E). It was not seen in 217 other subjects with a range of eye anomalies or in 496 normal control chromosomes.
Arg288 of the MAF protein is the first residue of the basic region involved in DNA binding in this bZIP protein (Fig. 3A). This region is preceded by an extended homology region that is also critical for DNA binding (37). The arginine residue is conserved in all known large Mafs (Fig. 3B). Replacement of this hydrophilic basic residue with proline is expected to lead to abnormality of helical conformation.
|
| DISCUSSION |
|---|
|
|
|---|
MAF is a highly attractive candidate gene for human ocular developmental abnormalities; it is expressed during lens differentiation, homozygous loss of function in the mouse leads to abnormal lens development and microphthalmia, and it regulates crystallin expression (15,17,18,38,39). Our two families show a combination of cataract and anterior segment anomalies, and this is recognized in a few cases that have been associated with mutations in PAX6, PITX3, EYA1 and FOXE3 (4,5,40,41). Family 1 members with a spectrum of features, including cataract and Peters anomaly, carry a t(5;16)(p15.3;q23.2) translocation in balanced and unbalanced forms. They have a break in a region on 16q23.2 which is associated with altered regulation of MAF in oncogenic translocations (34). In family 2, a mutation in MAF cosegregates with a dominant form of cataract, and microcornea and iris coloboma are also associated. The mutation results in the substitution of a conserved residue of the DNA-binding domain of MAF and is absent from 496 control chromosomes. The findings in these two families implicate MAF as a disease-causing gene in the lens leading to cataract formation and also suggest a broader role for MAF in anterior segment development.
Through breakpoint cloning in the t(5;16) family with lens and anterior segment developmental anomalies, we have discovered a translocation in the likely genomic-control domain of the lens development gene MAF. Long-range disruption is thought to affect the expression of Mafb in the original kreisler mouse where an inversion breakpoint is situated
30 kb from the Mafb transcription unit (24). Position effects have also been observed at several loci in humans, including PAX6 and SOX9 (35,42). In family 1 the breakpoint is
1 Mb from MAF. Position effects resulting from genomic disturbance at distances of
1 Mb from the affected gene have been described for SOX9 in both humans and mice (42,43). In multiple myeloma cell lines, translocation breakpoints at similarly large distances from MAF have previously been demonstrated to dysregulate MAF expression (34). This suggests that the MAF genomic-control domain is very large (Fig. 2C) and that MAF dysregulation, in the absence of other lens-related genes in the breakpoint regions, is likely to be responsible for the cataract and anterior segment abnormality in this family.
The substitution mutation of MAF in family 2 occurs in a conserved arginine (R288) residue at the start of the basic region DNA-binding domain, immediately C-terminal to the extended homology region DNA-binding domain (Fig. 3A and B). A substitution mutation in the basic region of the bZIP domain of Mafb has been described in mice with the kreisler phenotype (24). Analysis of deletion and some substitution mutation constructs of both the basic and extended homology regions of Maf demonstrate in vitro impairment of DNA-binding ability on gel shift analysis (20,37). Sequence comparisons show that R288 is the ninth residue of a 15 amino acid sequence that resembles a helixturnhelix DNA-binding motif (44). The R288P mutation replaces a hydrophilic residue with a proline in a region involved in
-helical conformation and DNA binding. We performed electrophoretic mobility shift assays (EMSAs) using constructs from normal MAF and the R288P mutant and a labelled MARE oligonucleotide. We could not discern abolition of DNA binding on the gel shift assay in the R288P mutant (data not shown). We note that for other substitution mutations in the DNA-binding domain of MAF, functional effects have been shown by alterations in
-helicity upon binding to MAREs using circular dichroism spectroscopy, alterations in trypsin cleavage (44) and by an increase in transforming activity in the absence of a change on gel shift analysis (45). At least three missense mutations in the DNA-binding domains of FOXC1 and PITX2 have been shown to confer normal or near-normal DNA-binding activity on gel-shift analysis but markedly abnormal (both decreased and increased) transactivation activity (46,47). We suggest that the proline substitution does not cause a simple loss of DNA-binding ability, but changes MAF activity in another way such as dysregulation of DNA-binding ability, change in transactivation potential or a change in binding to other proteins with which MAF interacts. Given the conserved nature of the R288 amino acid in the large Mafs from zebrafish to humans, its position in the helixturnhelix of the ancillary DNA-binding domain, the cosegregation of the R288P mutation with the disease phenotype in family 2, the particular amino acid substitution of a hydrophobic proline for a hydrophilic arginine and the absence of this mutation in 496 independent chromosomes from normal controls, we consider that mutation of this arginine residue is likely to have important functional consequences for MAF. The finding of one mutation in a panel of 140 congenital cataract patients is not surprising given the marked heterogeneity in causation of congenital cataracts (48). Similarly, in a panel of 161 anterior segment dysgenesis patients with and without cataract, one mutation affecting a mother and daughter was found in FOXE3 and none was found in two other recognized anterior segment and cataract disease genes, PITX2 and PITX3 (40).
As in the MAF mutation family, our analysis of the t(5;16) family suggests that the functional effect of this translocation is to lead to altered gene expression rather than downregulation or haploinsufficiency. All individuals carrying the der(5), as either balanced or unbalanced translocations (Fig. 4), have ocular abnormalities. This suggests that the rearrangement is giving rise to a dominant rather than a haploinsufficient effect, since individuals with der(5) in the presence of two normal copies of chromosome 16 have the eye phenotype, and deletions of distal 5p are not associated with these ocular abnormalities (28,29). Since simple 16q duplication is not usually associated with the ocular phenotypic abnormalities seen in this family (27), this alteration is most likely in timing and/or tissue specificity of expression. This is supported by our finding that the two MAF alleles in family 1 balanced translocation patient, II.3, show bi-allelic expression in his adult fibroblasts (data not shown). It is proposed in the translocation multiple myeloma cell lines that MAF overexpression occurs because of translocation to a region with a strong IgH enhancer. This is of specific relevance in the B cell lineage where the IgH enhancer is active, but there is no evidence that MAF would be overexpressed in other tissues where the IgH enhancer is not active. Similarly, in our family it is logical to expect that the different genomic and chromatin context in which MAF is placed by the translocation is of relevance for the spatiotemporal expression of MAF and its role in tissue-specific differentiation. In the eye, this would be expected to be during lens differentiation, when the ocular transcription factors that normally control MAF expression would face, on the translocation chromosome, a different chromosome domain tertiary structure and enhancer context than normal. This tissue specificity of the likely effect of the translocation is supported by the finding in our translocation family that no individuals with balanced or unbalanced karyotypes have developed multiple myeloma or other forms of cancer, including the 73-year-old paternal grandfather (family 1, I.1). Since the specific translocation effect on MAF in eye development is likely to occur in early embryogenesis, confirmation of this conclusion will have to come from studies of animals transgenic for MAF control elements in order to assay the effects in a developing mammal. Our analyses of both our families suggest that it is dysregulation of MAF rather than haploinsufficiency that is leading to abnormal lens and anterior segment development. Maf haploinsufficiency is also not pathogenic in the mouse, since heterozygous null mutants show normal ocular development (17,18). It is noteworthy that the individuals with the unbalanced translocation (Fig. 4), who have two normal copies of MAF as well as the rearranged one, show more severe ocular abnormalities. The extra copy of MAF may contribute to the more severe ocular phenotype as seen with increased dosage effects of Pax6 and FOXC1 in the eye (49,50).
|
There is a spectrum of eye abnormalities present in these families which links lens and anterior segment development. The cataract formation is likely to occur through aberrant MAF interactions with other lens development genes, including PITX3, PAX6 and the crystallins. Pitx3 and the crystallins have MAREs in their promoters (10,15,17,18) and Pax6 may have a synergistic role in crystallin gene regulation (39,51). Since Maf expression in the eye occurs in the developing lens, this suggests that the anterior segment abnormalities in our families arise primarily due to defects in development of the lens and ectodermal derivatives, and emphasizes the importance of the lens in anterior segment development. Iris coloboma is caused by defective closure of the optic fissure or abnormality of development of the iris stroma and epithelium, and is generally considered a separate entity from cataract. Interestingly, Pax6 is also associated with coloboma in the small eye heterozygous mouse (52). This is intriguing, as in vitro studies show that Pax6 can activate Maf expression (53), as well as interact with Maf at the protein level (54). The finding of iris coloboma in family 2 broadens the possible role of MAF in development of the anterior segment.
In conclusion, we have shown that the genomic-control domain of the MAF gene is disrupted by a translocation in a family with lens and anterior segment abnormalities, and that a mutation affecting a conserved residue of the ancillary DNA-binding domain of this bZIP transcription factor co-segregates with affection status in family 2. Our analyses suggest that in both cases MAF gain or abnormality of function in the developing lens at a key stage of embryogenesis can lead to abnormal lens and anterior segment development. These findings further implicate MAF/Maf in lens development and suggest an associated role in formation of the anterior segment.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Construction of somatic cell hybrids, family 1
From family 1, lymphoblastoid cell lines were established from whole blood from the balanced translocation patient (II.3) and his daughter with the unbalanced translocation (III.3). Somatic cell hybrids were created from the lymphoblastoid cell line II.3 as described previously (55).
Marker typing, family 1
PCR amplification for the analysis of microsatellite polymorphisms (Genethon) was performed on genomic DNA from II.3 and III.3. Genomic DNA (40 ng) was suspended in a 20 µl reaction containing 10 pmol of each forward and reverse primers, 0.75 mM dATP, dGTP, dCTP, dTTP, 67 mM TrisHCl pH 8.0, 3.7 mM MgCl2, 6.7 µM EDTA, 16 mM (NH4)2SO4, 0.085 mg/ml BSA and 0.1 U Taq DNA polymerase. Samples were processed through 30 cycles of amplification consisting of 45 s at 94°C (denaturation), 45 s at the appropriate annealing temperature and 1 min at 72°C (extension). The final step was lengthened to 10 min. Amplification products were electrophoresed on 8% polyacrylamide gels at 400 V for
2 h. The bands were detected by silver staining. Marker typing for hybrid identification and physical mapping was performed using reaction conditions as described above, with electrophoresis on 2% agarose gels. Custom primers for the physical mapping were designed based on available sequence data. All primers were synthesized commercially (MWG-Biotech AG). Primer sequences (5'3'): 230, GCAAGCGATGTGTGTCTGGATTAAG; 231, GCAGATTCCAGATTTTACCAGCG; 220, GCCTCTAGTAATGCCTGGAGTGAG; 221, GTCTCTTCCATCTCAGAGTGTCCTG.
Physical mapping of breakpoint regions and flanking sequence analysis, family 1
For breakpoint localization, BACs were identified by using sequence tagged sites (STS) within each region. Sequenced data were analysed using BLAST (http://www.ncbi.nlm.nih.gov/BLAST/index.html). Contigs were developed using the Washington University human genomic physical map tracking database (http://genome.wustl.edu/cgi-bin/ace/ctc_choices/ctc.ace), the Los Alamos National Laboratory BAC Mapping Project (http://www-ls.lanl.gov/) and BLAST comparison of sequenced BACs. In regions of unordered BAC sequences, fragments were assembled in relation to each other and flanking BACs. The UK HGMP Resource Centre (http://www.hgmp.mrc.ac.uk/) NIX suite of programmes, which includes GRAIL, Fex, Hexon, MZEF, Genemark, Genefinder, Fgene, BLAST against many databases (including Ecoli, EST, STS, EMBL, trEMBL, SWISS-PROT), Polyah, RepeatMasker and tRNAscan, was used to analyse the sequence surrounding the breakpoints for genes.
The breakpoints on 16q23.2 and 5p15.3 were refined using long-range PCR on genomic DNA from II.3. Primers close to either side of the breakpoints on the two derivative chromosomes were used in the Expand 20 kbPlus PCR System (Roche). Amplified products were purified on a centricon-100 column (Amicon). Direct sequencing of PCR products was performed using the BigDyeTM Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems) on a fluorescent sequencer (ABI 377).
Mutation analysis and confirmation
PCR amplification of the coding regions of both forms of the MAF gene was performed (primers on request). Genomic DNA from one affected individual from each pedigree was amplified. PCR reactions and cycling times were performed as above. Due to the high GC content, some reactions required the addition of enhancing agents: either DMSO at 10% or both DMSO at 10% and betaine at 1 M final concentration. For SSCP/heteroduplex analysis, 1 vol PCR product was mixed with 1 vol formamide loading dye and denatured at 96°C for 5 min prior to loading on an 8% acrylamide/bis-acrylamide gel. Gels were run at 350 V overnight at 4°C and silver stained. In cases where an SSCP shift was observed, direct sequencing of PCR products was performed as above. For restriction enzyme analysis, PCR products were subject to digestion using MspI (New England BioLabs) at 37°C for 1 h. Resulting fragments were analysed by electrophoresis in a 3% agarose gel, stained with ethidium bromide and visualized under UV light.
| ACKNOWLEDGEMENTS |
|---|
|
|
|---|
We thank Andrew Read, David McLeod, Peter Rowe, John Christodoulou and John Grigg for comments on the manuscript. We thank the Cytogenetics Departments at St Marys Hospital, Manchester, and The Manchester Childrens Hospital for cytogenetic analysis, William Fergusson for establishing the cell lines, and Nichola Farrar for technical assistance. R.V. J. is a Neil Hamilton Fairley Research Fellow (Reference 997006) with the National Health and Medical Research Council of Australia and also acknowledges a Paediatric Travelling Fellowship from the Royal Australasian College of Physicians. This work is also supported by the Birth Defects Foundation. We also acknowledge support from the Jack Brockhoff Foundation and the Swiss National Science Foundation, grant number 65250.01. R.P. is supported by Action Research and G.C.M.B. is a Wellcome Trust Clinician Scientist Fellow (Reference 51390/Z).
| FOOTNOTES |
|---|
|
|
|---|
+ To whom correspondence should be addressed. Tel: +44 161 276 6264; Fax: +44 161 276 6145; Email: robynj@central.cmht.nwest.nhs.uk
| REFERENCES |
|---|
|
|
|---|
1 Taylor,D. (1998) The Doyne Lecture. Congenital cataract: the history, the nature and the practice. Eye, 12, 936.
2 Gollamudi,S.R., Traboulsi,E.I., Chamon,W., Stark,W.J. and Maumenee,I.H. (1994) Visual outcome after surgery for Peters anomaly. Ophthalmic. Genet., 15, 3135.[ISI][Medline]
3 Francis,P.J., Berry,V., Bhattacharya,S.S. and Moore,A.T. (2000) The genetics of childhood cataract. J. Med. Genet., 37, 481488.
4 Glaser,T., Jepeal,L., Edwards,J.G., Young,S.R., Favor,J. and Maas,R.L. (1994) PAX6 gene dosage effect in a family with congenital cataracts, aniridia, anophthalmia and central nervous system defects. [Published erratum appears in Nat. Genet. (1994) 8, 203.] Nat. Genet., 7, 463741.
5 Semina,E.V., Ferrell,R.E., Mintz-Hittner,H.A., Bitoun,P., Alward,W.L., Reiter,R.S., Funkhauser,C., Daack-Hirsch,S. and Murray,J.C. (1998) A novel homeobox gene PITX3 is mutated in families with autosomal-dominant cataracts and ASMD. Nat. Genet., 19, 167170.[ISI][Medline]
6 Beebe,D.C. and Coats,J.M. (2000) The lens organizes the anterior segment: specification of neural crest cell differentiation in the avian eye. Dev. Biol., 220, 424431.[ISI][Medline]
7 Waring,G.O., Rodrigues,M.M. and Laibson,P.R. (1975) Anterior chamber cleavage syndrome. A stepladder classification. Surv. Ophthalmol., 20, 327.[Medline]
8 Withers,S.J., Gole,G.A. and Summers,K.M. (1999) Autosomal dominant cataracts and Peters anomaly in a large Australian family. Clin. Genet., 55, 240247.[ISI][Medline]
9 Grindley,J.C., Davidson,D.R. and Hill,R.E. (1995) The role of Pax-6 in eye and nasal development. Development, 121, 14331442.[Abstract]
10 Semina,E.V., Murray,J.C., Reiter,R., Hrstka,R.F. and Graw,J. (2000) Deletion in the promoter region and altered expression of Pitx3 homeobox gene in aphakia mice. Hum. Mol. Genet., 9, 15751585.
11 Hanson,I.M., Fletcher,J.M., Jordan,T., Brown,A., Taylor,D., Adams,R.J., Punnett,H.H. and van Heyningen,V. (1994) Mutations at the PAX6 locus are found in heterogeneous anterior segment malformations including Peters anomaly. Nat. Genet., 6, 168173.[ISI][Medline]
12 Traboulsi,E.I. and Maumenee,I.H. (1992) Peters anomaly and associated congenital malformations. Arch. Ophthalmol., 110, 17391742.[Abstract]
13 Salmon,J.F., Wallis,C.E. and Murray,A.D. (1988) Variable expressivity of autosomal dominant microcornea with cataract. Arch. Ophthalmol., 106, 505510.[Abstract]
14 Sakai,M., Imaki,J., Yoshida,K., Ogata,A., Matsushima-Hibaya,Y., Kuboki,Y., Nishizawa,M. and Nishi,S. (1997) Rat maf related genes: specific expression in chondrocytes, lens and spinal cord. Oncogene, 14, 745750.[ISI][Medline]
15 Kawauchi,S., Takahashi,S., Nakajima,O., Ogino,H., Morita,M., Nishizawa,M., Yasuda,K. and Yamamoto,M. (1999) Regulation of lens fiber cell differentiation by transcription factor c-Maf. J. Biol. Chem., 274, 1925419260.
16 Yoshida,K., Imaki,J., Koyama,Y., Harada,T., Shinmei,Y., Oishi,C., Matsushima-Hibiya,Y., Matsuda,A., Nishi,S., Matsuda,H. et al. (1997) Differential expression of maf-1 and maf-2 genes in the developing rat lens. Invest. Ophthalmol. Vis. Sci., 38, 26792683.
17 Ring,B.Z., Cordes,S.P., Overbeek,P.A. and Barsh,G.S. (2000) Regulation of mouse lens fiber cell development and differentiation by the Maf gene. Development, 127, 307317.[Abstract]
18 Kim,J.I., Li,T., Ho,I.C., Grusby,M.J. and Glimcher,L.H. (1999) Requirement for the c-Maf transcription factor in crystallin gene regulation and lens development. Proc. Natl Acad. Sci. USA, 96, 37813785.
19 Kataoka,K., Nishizawa,M. and Kawai,S. (1993) Structurefunction analysis of the maf oncogene product, a member of the b-Zip protein family. J. Virol., 67, 21332141.
20 Kataoka,K., Noda,M. and Nishizawa,M. (1996) Transactivation activity of Maf nuclear oncoprotein is modulated by Jun, Fos and small Maf proteins. Oncogene, 12, 5362.[ISI][Medline]
21 Ogino,H. and Yasuda,K. (1998) Induction of lens differentiation by activation of a bZIP transcription factor, L-Maf. Science, 280, 115118.
22 Nishizawa,M., Kataoka,K., Goto,N., Fujiwara,K.T. and Kawai,S. (1989) v-maf, a viral oncogene that encodes a "leucine zipper" motif. Proc. Natl Acad. Sci. USA, 86, 77117715.
23 Blank,V. and Andrews,N.C. (1997) The Maf transcription factors: regulators of differentiation. Trends Biochem. Sci., 22, 437441.[ISI][Medline]
24 Cordes,S.P. and Barsh,G.S. (1994) The mouse segmentation gene kr encodes a novel basic domain-leucine zipper transcription factor. Cell, 79, 10251034.[ISI][Medline]
25 Swaroop,A., Xu,J.Z., Pawar,H., Jackson,A., Skolnick,C. and Agarwal,N. (1992) A conserved retina-specific gene encodes a basic motif/leucine zipper domain. Proc. Natl Acad. Sci. USA, 89, 266270.
26 Bessant,D.A., Payne,A.M., Mitton,K.P., Wang,Q.L., Swain,P.K., Plant,C., Bird,A.C., Zack,D.J., Swaroop,A. and Bhattacharya,S.S. (1999) A mutation in NRL is associated with autosomal dominant retinitis pigmentosa. Nat. Genet., 21, 355356.[ISI][Medline]
27 Houlston,R.S., Renshaw,R.M., James,R.S., Ironton,R. and Temple,I.K. (1994) Duplication of 16q22
qter confirmed by fluorescence in situ hybridisation and molecular analysis. J. Med. Genet., 31, 884887.[Abstract]
28 Van Buggenhout,G.J., Pijkels,E., Holvoet,M., Schaap,C., Hamel,B.C. and Fryns,J.P. (2000) Cri du chat syndrome: changing phenotype in older patients. Am. J. Med. Genet., 90, 203315.[ISI][Medline]
29 Gersh,M., Goodart,S.A., Pasztor,L.M., Harris,D.J., Weiss,L. and Overhauser,J. (1995) Evidence for a distinct region causing a cat-like cry in patients with 5p deletions. Am. J. Hum. Genet., 56, 14041410.[ISI][Medline]
30 Marner,E., Rosenberg,T. and Eiberg,H. (1989) Autosomal dominant congenital cataract. Morphology and genetic mapping. Acta Ophthalmol., 67, 151158.[Medline]
31 Bednarek,A.K., Laflin,K.J., Daniel,R.L., Liao,Q., Hawkins,K.A. and Aldaz,C.M. (2000) WWOX, a novel WW domain-containing protein mapping to human chromosome 16q23.324.1, a region frequently affected in breast cancer. Cancer Res., 60, 21402145.
32 Ried,K., Finnis,M., Hobson,L., Mangelsdorf,M., Dayan,S., Nancarrow,J.K., Woollatt,E., Kremmidiotis,G., Gardner,A., Venter,D. et al. (2000) Common chromosomal fragile site FRA16D sequence: identification of the FOR gene spanning FRA16D and homozygous deletions and translocation breakpoints in cancer cells. Hum. Mol. Genet., 9, 16511663.
33 Mangelsdorf,M., Ried,K., Woollatt,E., Dayan,S., Eyre,H., Finnis,M., Hobson,L., Nancarrow,J., Venter,D., Baker,E. et al. (2000) Chromosomal fragile site FRA16D and DNA instability in cancer. Cancer Res., 60, 16831689.
34 Chesi,M., Bergsagel,P.L., Shonukan,O.O., Martelli,M.L., Brents,L.A., Chen,T., Schrock,E., Ried,T. and Kuehl,W.M. (1998) Frequent dysregulation of the c-maf proto-oncogene at 16q23 by translocation to an Ig locus in multiple myeloma. Blood, 91, 44574463.
35 Kleinjan,D.A., Seawright,A., Schedl,A., Quinlan,R.A., Danes,S. and van Heyningen,V. (2001) Aniridia-associated translocations, DNase hypersensitivity, sequence comparison and transgenic analysis redefine the functional domain of PAX6. Hum. Mol. Genet., 10, 20492059.
36 Bosse,A., Zulch,A., Becker,M.B., Torres,M., Gomez-Skarmeta,J.L., Modolell,J. and Gruss,P. (1997) Identification of the vertebrate Iroquois homeobox gene family with overlapping expression during early development of the nervous system. Mech. Dev., 69, 169181.[ISI][Medline]
37 Kerppola,T.K. and Curran,T. (1994) A conserved region adjacent to the basic domain is required for recognition of an extended DNA binding site by Maf/Nrl family proteins. Oncogene, 9, 31493158.[ISI][Medline]
38 Ogino,H. and Yasuda,K. (2000) Sequential activation of transcription factors in lens induction. Dev. Growth Differ., 42, 437448.[ISI][Medline]
39 Sharon-Friling,R., Richardson,J., Sperbeck,S., Lee,D., Rauchman,M., Maas,R., Swaroop,A. and Wistow,G. (1998) Lens-specific gene recruitment of zeta-crystallin through Pax6, Nrl-Maf, and brain suppressor sites. Mol. Cell Biol., 18, 20672076.
40 Semina,E.V., Brownell,I., Mintz-Hittner,H.A., Murray,J.C. and Jamrich,M. (2001) Mutations in the human forkhead transcription factor FOXE3 associated with anterior segment ocular dysgenesis and cataracts. Hum. Mol. Genet., 10, 231236.
41 Azuma,N., Hirakiyama,A., Inoue,T., Asaka,A. and Yamada,M. (2000) Mutations of a human homologue of the Drosophila eyes absent gene (EYA1) detected in patients with congenital cataracts and ocular anterior segment anomalies. Hum. Mol. Genet., 9, 363366.
42 Pfeifer,D., Kist,R., Dewar,K., Devon,K., Lander,E.S., Birren,B., Korniszewski,L., Back,E. and Scherer,G. (1999) Campomelic dysplasia translocation breakpoints are scattered over 1 Mb proximal to SOX9: evidence for an extended control region. Am. J. Hum. Genet., 65, 111124.[ISI][Medline]
43 Bishop,C.E., Whitworth,D.J., Qin,Y., Agoulnik,A.I., Agoulnik,I.U., Harrison,W.R., Behringer,R.R. and Overbeek,P.A. (2000) A transgenic insertion upstream of sox9 is associated with dominant XX sex reversal in the mouse. Nat. Genet., 26, 490494.[ISI][Medline]
44 Dlakic,M., Grinberg,A.V., Leonard,D.A. and Kerppola,T.K. (2001) DNA sequence-dependent folding determines the divergence in binding specificities between Maf and other bZIP proteins. EMBO J., 20, 828840.[ISI][Medline]
45 Kataoka,K., Noda,M. and Nishizawa,M. (1994) Maf nuclear oncoprotein recognizes sequences related to an AP-1 site and forms heterodimers with both Fos and Jun. Mol. Cell Biol., 14, 700712.
46 Priston,M., Kozlowski,K., Gill,D., Letwin,K., Buys,Y., Levin,A.V., Walter,M.A. and Heon,E. (2001) Functional analyses of two newly identified PITX2 mutants reveal a novel molecular mechanism for AxenfeldRieger syndrome. Hum. Mol. Genet., 10, 16311638.
47 Saleem,R.A., Banerjee-Basu,S., Berry,F.B., Baxevanis,A.D. and Walter,M.A. (2001) Analyses of the effects that disease-causing missense mutations have on the structure and function of the winged-helix protein FOXC1. Am. J. Hum. Genet., 68, 627641.[ISI][Medline]
48 Francis,P.J., Berry,V., Moore,A.T. and Bhattacharya,S. (1999) Lens biology: development and human cataractogenesis. Trends Genet., 15, 191196.[ISI][Medline]
49 Schedl,A., Ross,A., Lee,M., Engelkamp,D., Rashbass,P., van Heyningen,V. and Hastie,N.D. (1996) Influence of PAX6 gene dosage on development: overexpression causes severe eye abnormalities. Cell, 86, 7182.[ISI][Medline]
50 Lehmann,O.J., Ebenezer,N.D., Jordan,T., Fox,M., Ocaka,L., Payne,A., Leroy,B.P., Clark,B.J., Hitchings,R.A., Povey,S. et al. (2000) Chromosomal duplication involving the forkhead transcription factor gene FOXC1 causes iris hypoplasia and glaucoma. Am. J. Hum. Genet., 67, 11291135.[ISI][Medline]
51 Cvekl,A. and Piatigorsky,J. (1996) Lens development and crystallin gene expression: many roles for Pax-6. Bioessays, 18, 621630.[ISI][Medline]
52 Hogan,B.L., Hirst,E.M., Horsburgh,G. and Hetherington,C.M. (1988) Small eye (Sey): a mouse model for the genetic analysis of craniofacial abnormalities. Development, 103, 115119.
53 Sakai,M., Serria,M.S., Ikeda,H., Yoshida,K., Imaki,J. and Nishi,S. (2001) Regulation of c-maf gene expression by Pax6 in cultured cells. Nucleic Acids Res., 29, 12281237.
54 Kataoka,K., Yoshitomo-Nakagawa,K., Shioda,S. and Nishizawa,M. (2001) A set of Hox proteins interact with the Maf oncoprotein to inhibit its DNA binding, transactivation, and transforming activities. J. Biol. Chem., 276, 819826.
55 Lawson,C.T., Toomes,C., Fryer,A., Carette,M.J., Taylor,G.M., Fukushima,Y. and Dixon,M.J. (1995) Definition of the blepharophimosis, ptosis, epicanthus inversus syndrome critical region at chromosome 3q23 based on the analysis of chromosomal anomalies. Hum. Mol. Genet., 4, 963967.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
P. Wang, X. Liang, J. Yi, and Q. Zhang Novel SOX2 Mutation Associated With Ocular Coloboma in a Chinese Family Arch Ophthalmol, May 1, 2008; 126(5): 709 - 713. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Puk, J. Loster, C. Dalke, D. Soewarto, H. Fuchs, B. Budde, P. Nurnberg, E. Wolf, M. H. de Angelis, and J. Graw Mutation in a Novel Connexin-like Gene (Gjf1) in the Mouse Affects Early Lens Development and Causes a Variable Small-Eye Phenotype Invest. Ophthalmol. Vis. Sci., April 1, 2008; 49(4): 1525 - 1532. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Hansen, W. Yao, H. Eiberg, K. W. Kjaer, K. Baggesen, J. F. Hejtmancik, and T. Rosenberg Genetic Heterogeneity in Microcornea-Cataract: Five Novel Mutations in CRYAA, CRYGD, and GJA8 Invest. Ophthalmol. Vis. Sci., September 1, 2007; 48(9): 3937 - 3944. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kataoka Multiple Mechanisms and Functions of Maf Transcription Factors in the Regulation of Tissue-Specific Genes J. Biochem., June 1, 2007; 141(6): 775 - 781. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Perveen, J. Favor, R.V. Jamieson, D.W. Ray, and G.C.M. Black A heterozygous c-Maf transactivation domain mutation causes congenital cataract and enhances target gene activation Hum. Mol. Genet., May 1, 2007; 16(9): 1030 - 1038. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Debacker, B. Winnepenninckx, N. Ben-Porat, D. FitzPatrick, R. Van Luijk, S. Scheers, B. Kerem, and R Frank Kooy FRA18C: a new aphidicolin-inducible fragile site on chromosome 18q22, possibly associated with in vivo chromosome breakage J. Med. Genet., May 1, 2007; 44(5): 347 - 352. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Asai-Coakwell, C. Backhouse, R. J. Casey, P. J. Gage, and O. J. Lehmann Reduced Human and Murine Corneal Thickness in an Axenfeld-Rieger Syndrome Subtype Invest. Ophthalmol. Vis. Sci., November 1, 2006; 47(11): 4905 - 4909. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Liu, T. Ke, Z. Wang, Q. Yang, W. Chang, F. Jiang, Z. Tang, H. Li, X. Ren, X. Wang, et al. Identification of a CRYAB Mutation Associated with Autosomal Dominant Posterior Polar Cataract in a Chinese Family. Invest. Ophthalmol. Vis. Sci., August 1, 2006; 47(8): 3461 - 3466. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Liu and U. Francke Identification of cis-regulatory elements for MECP2 expression Hum. Mol. Genet., June 1, 2006; 15(11): 1769 - 1782. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. K. McEwen, A. Woolfe, D. Goode, T. Vavouri, H. Callaway, and G. Elgar Ancient duplicated conserved noncoding elements in vertebrates: A genomic and functional analysis Genome Res., April 1, 2006; 16(4): 451 - 465. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. El Achkar, M. Gerbault-Seureau, M. Muleris, B. Dutrillaux, and M. Debatisse Premature condensation induces breaks at the interface of early and late replicating chromosome bands bearing common fragile sites PNAS, December 13, 2005; 102(50): 18069 - 18074. [Abstract] [Full Text] [PDF] |
||||











