Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (31)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Karthikeyan, G.
Right arrow Articles by Resnick, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Karthikeyan, G.
Right arrow Articles by Resnick, M. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2002, Vol. 11, No. 11 1351-1362
© 2002 Oxford University Press

The mitochondrial protein frataxin prevents nuclear damage

Gopalakrishnan Karthikeyan1, L. Kevin Lewis2 and Michael A. Resnick1,*

1Laboratory of Molecular Genetics, National Institute of Environmental Health Sciences, NIH, PO Box 12233, Research Triangle Park, NC 27709, USA and 2Department of Chemistry and Biochemistry, Southwest Texas State University, San Marcos, TX 78666, USA

Received February 26, 2002; Accepted March 13, 2002


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The mitochondrial protein frataxin helps maintain appropriate iron levels in the mitochondria of yeast and humans. A deficiency of this protein in humans causes Friedreich's ataxia, while its complete absence in yeast ({Delta}yfh1 mutant) results in loss of mitochondrial DNA, apparently due to radicals generated by excess iron. We found that the absence of frataxin in yeast also leads to nuclear damage, as evidenced by inducibility of a nuclear DNA damage reporter, increased chromosomal instability including recombination and mutation, and greater sensitivity to DNA-damaging agents, as well as slow growth. Addition of a human frataxin mutant did not prevent nuclear damage, although it partially complemented the {Delta}yfh1 mutant in preventing mitochondrial DNA loss. The effects in {Delta}yfh1 mutants result from reactive oxygen species (ROS), since (i) {Delta}yfh1 cells produce more hydrogen peroxide, (ii) the effects are alleviated by a radical scavenger and (iii) the glutathione peroxidase gene prevents an increase in mutation rates. Thus, the frataxin protein is concluded to have a protective role for the nucleus as well as the mitochondria.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Friedreich's ataxia (FRDA) is an autosomal recessive neurodegenerative disease that causes physical disability at an early age (1). Patients develop multiple symptoms, including gait and limb ataxia, dysarthria, hypertrophic cardiomyopathy, and diabetes mellitus (15). The FRDA gene is conserved across evolution, with homologues being found in purple bacteria, Caenorhabditis elegans, Drosophila melanogaster and the yeast Saccharomyces cerevisiae (68). The importance of the FRDA gene has been underscored by the recent finding that a knockout of this gene leads to early embryonic lethality in mice (9). The gene codes for frataxin, a protein that helps maintain mitochondrial iron homeostasis (10), and decreased amounts are usually the consequence of GAA triplet repeat expansion within the gene (1113). High iron levels have been found in affected tissues of patients (14). The primary tissues affected by the disease – neurons and cardiomyocytes – require high amounts of ATP. Since mitochondrial function is impaired as a result of iron overload (15), the various physiological disease symptoms observed have been attributed to lowered ATP production in these energy-intensive tissues (16).

The yeast S. cerevisiae has been used as a model system to study frataxin, which also regulates mitochondrial iron homeostasis in this organism (17,18). Yeast frataxin, encoded by the YFH1 gene, binds iron and is reported to form high-molecular-weight complexes that may help regulate levels of iron in vivo (19). Deletion of YFH1 results in a 10-fold excess of iron accumulation within mitochondria (10,20). In addition, {Delta}yfh1 mutants exhibit a deficiency of complex IV and mitochondrial proteins containing Fe–S clusters (15,20,21) and they are unable to grow on non-fermentable carbon sources such as ethanol and glycerol (21,22). This petite phenotype is considered to be due to alterations in mitochondrial DNA, presumably resulting from free-radical damage associated with increased iron in the mitochondria. In addition, {Delta}yfh1 cells are sensitive to agents that cause oxidative damage and to high concentrations of iron and copper (10,20).

{Delta}yfh1 mutants have also been reported to grow more slowly than other petites on fermentable carbon sources such as glucose (10,20). This slow-growth phenotype led us to investigate the possibility that, in addition to maintaining appropriate iron levels in the mitochondria, frataxin might also have a role in protecting compartments outside the mitochondria. We found that a DNA damage-inducible nuclear gene was highly expressed in cells lacking frataxin and that {Delta}yfh1 mutants are genetically unstable. They were also hypersensitive to killing by agents that damage DNA and/or inhibit nuclear DNA replication. The various effects are likely due to reactive oxygen species (ROS). Similar responses were found in {Delta}yfh1 cells expressing mutant FRDA protein derived from a patient. These responses were specific in that the mutant protein could complement the {Delta}yfh1 growth defect and many of the cells retained mitochondrial function. The results demonstrate that a yeast or human-derived mitochondrial protein can have a nuclear protective effect.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
{Delta}yfh1 mutants grow much more slowly than isogenic rho0 strains
The anecdotal reports indicating that {Delta}yfh1 mutants grow slowly (10,20), led us to investigate this phenotype further to better understand the role of the frataxin gene in yeast. Deletion of YFH1 by PCR-mediated gene replacement in strains GK5 and BY4741 resulted in {Delta}yfh1 cells growing more slowly than isogenic YFH1 rho0 mutants generated by ethidium bromide treatment (Fig. 1A). Since the fresh isolates of {Delta}yfh1 mutants were petite (unable to grow on glycerol plates) and were lacking mitochondrial DNA based on quantitative PCR analysis (23), rho0 mutants were used as YFH1+ controls. (We also note that some {Delta}yfh1 isolates exhibited extremely slow growth on glycerol; however, there were no differences in the various tests described below.) All {Delta}yfh1 mutants in the current study grew well at 37°C, unlike strains used in another study (10). {Delta}yfh1-/- diploids grown at 30°C exhibited a similar slow-growth phenotype, while heterozygous diploids formed by crossing {Delta}yfh1 and YFH1 rho0 strains grew at rates comparable to a rho0 diploid, indicating that the mutation is recessive (Fig. 1B).




View larger version (35K):
[in this window]
[in a new window]
 
Figure 1. Growth of {Delta}yfh1 strains in different media. (A) WT, rho0 and {Delta}yfh1 were grown on SC and YPD media to characterize the slow-growth phenotype of {Delta}yfh1 strains. (B) Diploid strains YFH1/YFH1 rho0 ({nabla}) YFH1/{Delta}yfh1 rho0 ({Delta}) and {Delta}yfh1/{Delta}yfh1 (•) were analyzed for growth rate in YPD media. (C) Haploid strains {Delta}yfh1 (•), fet3 {Delta}yfh1 ({Delta}) and YFH1 rho0 ({nabla}) were analyzed for growth rate in YPD media.

 
The reduced growth rate is likely due to higher levels of iron that can lead to increased levels of ROS (see Discussion). The increase in ROS could also result from higher levels of iron that might be imported into the cytoplasm. For example, FET3 encodes a protein that transports iron into cells and is induced in {Delta}yfh1 strains (18). This led us to examine the growth rates of {Delta}fet3{Delta}yfh1 double mutants, since the {Delta}fet3 mutation prevented petite induction in {Delta}yfh1 cells of another strain background that was less prone to petite formation. We deleted the FET3 and YFH1 genes, in that order, from the GK5 strain. The double-mutant cells were petite and grew at the same rate as {Delta}yfh1 cells (Fig. 1C). Thus, the mitochondrial iron levels that occur in {Delta}yfh1 cells were adequate to cause slow growth. However, these results do not rule out the possibility that other iron-import pathways may exist (23) and contribute to the observed damage (see Discussion).

{Delta}yfh1 mutants are sensitive to a DNA-alkylating agent and a replication inhibitor
The slow-growth phenotype of {Delta}yfh1 mutants might be due to increased spontaneous nuclear DNA damage. If so, exposure to agents that can damage nuclear DNA, such as methyl methanesulfonate (MMS), might exacerbate the growth defect. As shown in Figure 2A, diploid {Delta}yfh1 cells were highly sensitive to MMS, a DNA-alkylating agent producing lesions that are repaired primarily by base excision repair (BER) and recombination, while rho0 diploids and heterozygous {Delta}yfh1/YFH1 rho0 diploids were resistant. In contrast, {Delta}yfh1 mutants were not hypersensitive to ultraviolet or gamma radiation (data not shown).




View larger version (54K):
[in this window]
[in a new window]
 
Figure 2. Sensitivity to DNA metabolic and damaging agents. (A) Diploid strains YFH1/YFH1 rho0 ({nabla}), YFH1/{Delta}yfh1 rho0 ({Delta}), and {Delta}yfh1/{Delta}yfh1 (•) were exposed to methyl methanesulfonate at different concentrations for 15 minutes. Cells were washed and plated onto YPD media to determine survival. (B) Diploid strains were dilution-pronged onto YPD and YPD with 200 mM hydroxy urea (HU).

 
We also examined the effect of the replication inhibitor hydroxyurea (HU), which blocks ribonucleotide reductase function. As shown in Figure 2B, no growth was observed when diploid {Delta}yfh1 cells were pronged to 200 mM HU, whereas there was confluent growth of YFH1 rho0 cells. The heterozygous diploid {Delta}yfh1/YFH1 rho0 was resistant to 200 mM HU, demonstrating that the sensitivity was {Delta}yfh1-dependent. Comparable results were obtained with haploid {Delta}yfh1 cells (data not shown). Thus, the {Delta}yfh1 mutation can sensitize cells to agents that affect DNA metabolism.

A nuclear DNA damage-inducible promoter is constitutively activated in {Delta}yfh1 mutants
While MMS is commonly used to induce lesions in DNA, it can also damage proteins by methylation (24). To resolve if the sensitivity to this agent is due to nuclear DNA damage, a DNA-damage response reporter assay was used (25). The plasmid YEplac112DIN1placZ, containing the promoter of the DNA damage-inducible gene DIN1 (RNR3) fused to the Escherichia coli lacZ gene, was introduced into {Delta}yfh1 and YFH1 rho0 cells. Activation of the DIN1 promoter in response to DNA damage is indicated by the appearance of blue colonies on Xgal plates (Fig. 3A). Since {Delta}yfh1 colonies patched onto medium containing Xgal formed a deep blue color while rho0 patches remained white (Fig. 3A), there appears to be substantial spontaneous nuclear damage in this mutant.




View larger version (135K):
[in this window]
[in a new window]
 
Figure 3. Constitutive din1 expression and its alleviation by a radical scavenger. (A) Strains bearing the din1–lacZ plasmid were lightly replica-plated onto Xgal plates to determine DIN1 induction, which is indicated by blue color. (B) The radical scavenger N-acetylcysteine (NAC) reduces the appearance of blue color on Xgal plates in {Delta}yfh1 strains. (C) NAC does not prevent induction of DIN1 in {Delta}yfh1 strains by 1 mM methyl methanesulfonate (MMS). rho0 strains bearing the plasmid also induce DIN1 in response to MMS. Maximal color is observed on day 3.

 
{Delta}yfh1 strains exhibit increased chromosome instability, including recombination
The above results demonstrating that nuclear DNA damage arises when there is a deficiency of frataxin led us to examine effects on chromosome stability. We compared illegitimate mating in {Delta}yfh1 mutants versus wild-type cells. This mating occurs primarily as a result of loss of chromosome III, although it also can be due to chromosome arm loss or recombination (2628). It is detected by the ability of haploid cells of the same mating type to give rise to diploids or by MATa/MAT{alpha} diploids being able to mate with haploids.

Patches of {Delta}yfh1 and rho0 strains were replica-plated onto lawns of mating testers. As expected, haploid {Delta}yfh1 MAT{alpha} strains mated with the MATa tester to give a confluent mating patch. However, as shown in Figure 4, many papillae were observed on plates containing the MAT{alpha} tester. Diploid {Delta}yfh1 cells also showed an increased frequency of papillae when given the opportunity to mate with either MATa or MAT{alpha} tester strains. We conclude that the {Delta}yfh1 defect leads to a decrease in chromosome stability.



View larger version (50K):
[in this window]
[in a new window]
 
Figure 4. Illegitimate mating tests. Strains were grown as patches on YPD media and lightly imprinted on a lawn of mating-type testers on media lacking the appropriate amino acids in order to score illegitimate mating.

 
To further address the genetic consequence of a frataxin deficiency, we examined recombination in {Delta}yfh1 mutants using the sister chromatid exchange (SCE) assay described by Fasullo et al. (29). YFH1 was deleted from strain YB146 containing the SCE cassette and isogenic rho0 isolates were obtained following ethidium bromide treatment (see Materials and Methods). Recombination rates were estimated by determining the frequencies of recombination in seven independent isolates (see Materials and Methods) and using the method of the median to determine the rates of recombination (30). The spontaneous recombination rates were approximately 6-fold higher in a {Delta}yfh1 mutant as compared with the control rho0 strain (Table 1). We conclude that the absence of frataxin can lead to various kinds of nuclear genome instability (including mutation, as described below).


View this table:
[in this window]
[in a new window]
 
Table 1. Rates of sister chromatid recombination in a petite and a frataxin deletion strain
 
The toxic effects of supplemental iron are reversible by a free-radical scavenger
FRDA is a disease that appears to be associated with iron imbalance and high levels of iron accumulation in the mitochondria as the disease progresses. The yeast frataxin mutant also accumulates iron within the mitochondria, and high concentrations of iron added to the medium inhibit the growth of {Delta}yfh1 cells. The presence of 5 mM iron in the medium was inhibitory to the {Delta}yfh1 mutants in the strain backgrounds used in this study, and, as shown in Figure 5A, there was a 4–5 order-of-magnitude reduction in survival in {Delta}yfh1 mutants compared with rho0 control cells.



View larger version (46K):
[in this window]
[in a new window]
 
Figure 5. Sensitivity to iron and alleviation by NAC. (A) Strains were dilution-pronged onto SC media with 5 mM iron (FeCl3). {Delta}yfh1 strains show severe inhibition of growth at this concentration of iron. (B) The radical scavenger NAC alleviates the growth inhibition of {Delta}yfh1 strains on 5mM iron.

 
Since the toxic effects of iron have been associated with products generated through iron-catalyzed Fenton chemistry, a free-radical scavenger might reverse this sensitivity. To test this, we used N-acetylcysteine (NAC), a commonly used free-radical scavenger that is not an iron chelator (3132). Serial dilutions of cells were exposed to 5 mM iron with and without 20 mM NAC added to the plates [this concentration of NAC was found to be optimal (33) (data not shown)]. As shown in Figure 5B, survival increased 2–4 orders of magnitude, indicating that much of the iron toxicity could be reversed by NAC. NAC also improved the growth of {Delta}yfh1 cells in standard yeast growth media (data not shown).

The ability of NAC to reverse the growth-inhibitory effects of exogenous iron suggested that the DNA instability and sensitivity to DNA-damaging agents of {Delta}yfh1 mutants were mediated by an excess of free radicals. To test this, cells were examined for inducibility of the din1–lacZ construct in the presence and absence of 20 mM NAC. As shown in Figure 3B, lacZ expression was reduced on plates containing NAC. To control for the possibility that NAC might generally inhibit the appearance of the blue color, the effect of NAC on MMS induction of din1–lacZ was examined. The concentration of MMS employed (1 mM) was not lethal to {Delta}yfh1 cells, but could induce DNA damage and turn on DIN1 expression. As seen in Figure 3C, NAC did not prevent MMS-induced din1–lacZ expression in either the {Delta}yfh1 or the rho0 cells. Thus, we conclude that the spontaneous nuclear damage in {Delta}yfh1 cells is caused by free radicals and that protection against this damage can be provided by a free-radical scavenger.

{Delta}yfh1 cells produce increased amounts of hydrogen peroxide
The nuclear damage in {Delta}yfh1 cells could result from excess hydrogen peroxide (H2O2) production caused by high iron concentrations within the mitochondria (see Fig. 8A). Since H2O2 is diffusible, it should be detectable external to the cells. To test this, logarithmically growing cells were incubated in phosphate buffer and the appearance of H2O2 in the buffer was determined using an Amplex Red Hydrogen Peroxide Assay Kit (see Materials and Methods). As shown in Figure 6, the level of H2O2 was 2–4-fold higher in {Delta}yfh1 strains compared with the control cells. There was no apparent difference between the rho0 or rho+YFH1+ strains.




View larger version (35K):
[in this window]
[in a new window]
 
Figure 8. Model for H2O2-mediated damage. (A) Superoxide radicals are generated by the action of excess iron on oxygen. Superoxide can be converted to H2O2 either spontaneously or by superoxide dismutase. Because the H2O2 is freely diffusible, it can traverse membranes and damage nuclear DNA. The presence of frataxin may prevent this cascade of events by sequestering the iron. (B) This model depicts H2O2 diffusion across membranes into the nucleus and extracellular medium.

 


View larger version (11K):
[in this window]
[in a new window]
 
Figure 6. Hydrogen peroxide (H2O2) detection in cell supernatants. H2O2 was estimated in supernatants of diploid strains that were suspended in PBS and incubated for 40 minutes.

 
A glutathione peroxidase, {Delta}yfh1 double mutant exhibits high mutation rates
Since H2O2 appeared to be a source of DNA damage in the {Delta}yfh1 mutant, we anticipated that deletion of the peroxidase gene, GPX1, might increase genome instability, including the appearance of mutations. The GPX1 and YFH1 genes were deleted, and canavanine resistance (canR) mutation rates were determined by the method of the median (30) in {Delta}gpx1, {Delta}yfh1, {Delta}gpx1{Delta}yfh1 and rho0 mutants (see Materials and Methods). There was no apparent difference in growth rates between {Delta}yfh1 and {Delta}gpx1{Delta}yfh1 double mutants. Forward mutation of the arginine permease resulting in resistance to canavanine is frequently used to examine endogenous sources of mutation (34). As shown in Table 2, the mutation rates of the {Delta}gpx1, {Delta}yfh1 and rho0 mutants are comparable to each other. In contrast, there is a dramatic increase in mutation rate in the {Delta}gpx1{Delta}yfh1 double mutant. These results support the view that an important source of nuclear damage in frataxin mutants is H2O2, and that there is a large potential for inducing mutations that is greatly reduced through a peroxidase detoxification mechanism.


View this table:
[in this window]
[in a new window]
 
Table 2. Impact of defects in the frataxin ({Delta}yfh1) and glutathione peroxidase ({Delta}gpx1) genes on forward (to canR) mutation rates
 
Human FRDA mutant protects against petite formation but not nuclear DNA damage
The human FRDA gene product can complement a yeast {Delta}yfh1 mutant when expressed from a glyceraldehyde-3-phosphate dehydrogenase promoter (35). A G130V FRDA mutation was also shown to complement the yeast mutant, whereas W173G FRDA was unable to complement the {Delta}yfh1 defect and cells rapidly became petite and accumulated iron in their mitochondria (35). Given the difference between the mutants, we examined them for their ability to complement the growth defect and to protect cells from HU and MMS in our {Delta}yfh1 strain background. Plasmids bearing the human FRDA gene and its variants (described in 35) were transformed into strain GK5 and the YFH1 gene was subsequently deleted. In this strain background, the FRDA wild-type gene, the G130V mutant and, surprisingly, even the plasmid bearing the W173G mutant could complement the yeast {Delta}yfh1 mutation so that isolates appeared to grow normally and were not petite (Fig. 7A). Upon closer examination, we observed that 70% of the cells within a W173G clone gave rise to petite colonies, suggesting that the strain is partially defective for frataxin function. Similarly, while FRDA and the G130V mutant were able to protect {Delta}yfh1 cells from HU and MMS (Fig. 7A and data not shown), the {Delta}yfh1 cells containing the W173G mutant were strongly growth-inhibited by 200 mM HU and 2 mM MMS (Fig. 7A,B).





View larger version (128K):
[in this window]
[in a new window]
 
Figure 7. Complementation of {Delta}yfh1 by human FRDA mutants. (A) GK5 wild-type strain, {Delta}yfh1 and {Delta}yfh1 cells with plasmids FRDA, W173G and G130V were dilution-pronged onto YPD- , YPG- and YPD-+HU-containing media. The {Delta}yfh1 yeast strain with W173G shows growth on YPG, indicating that cells retain mitochondrial function, but strong inhibition on YPD+HU plates, indicating effects on nuclear DNA metabolism. (B) A high percentage of cells with W173G were arrested in G2 following treatment with HU and MMS. Gray bars are for G2 cells after growth on YPD; black bars correspond to cells grown on YPD+200 mM HU and hatched bars are for cells grown on YPD+2 mM MMS. (C) Strains with the W173G human mutant activate the DIN1 gene, as indicated by blue color on Xgal plates.

 
We also examined the {Delta}yfh1 cells containing the FRDA plasmids for the impact of HU and MMS on cell cycle progression. Both MMS and HU can cause a G2 checkpoint arrest, which is detected in yeast as an increase in large budded cells (36,37). Cells were grown on plates containing 200 mM HU or 2 mM MMS. They were examined after 2 days. Approximately 90% of the W173G-bearing cells in HU and 40% in MMS were large-budded. The frequencies of G2 cells were much lower in the WT strain or the {Delta}yfh1 strain complemented by the human FRDA or G130V mutant (Fig. 7A, B).

The effects of external agents on {Delta}yfh1 cells expressing the W173G frataxin hypomorphic mutation could be due to increased internal lesions. As shown in Figure 7C, the cells with the W173G mutation exhibited a strong din1–lacZ nuclear damage response, whereas there was no induction in cells containing the FRDA gene or the G130V mutant. Furthermore, since the strains containing the human genes were not petite, these results also suggest that the effects of HU and MMS described above for the {Delta}yfh1 strains were not specific to yeast frataxin mutants that also happen to be petite.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Frataxin is required for maintenance of iron homeostasis in the mitochondria. While decreases in the amount of protein result in the disease Friedreich's ataxia, the specific reason(s) for the disease state have not been established. Because frataxin normally forms multimeric, high-molecular-weight complexes with iron, the absence of this protein results in a large accumulation of iron in the mitochondria. Results from model systems suggest that this iron overload affects mitochondrial function (21,22). Excess iron in the presence of oxygen can generate superoxide and hydroxyl radicals (21), both of which are ROS (Fig. 8A). High ROS levels could cause damage to mitochondrial DNA and Fe–S-containing proteins, which are radical-sensitive (15,19,20).

While frataxin is a mitochondrial protein, the observation that {Delta}yfh1 cells grow more slowly than isogenic rho0 petite cells (this study, 10 and 20) led us to investigate a possible role for this protein elsewhere in the cell. The increase in iron-associated reactions in the mitochondria of {Delta}yfh1 mutants could also lead to the appearance of ROS in other cellular compartments (see the model in Fig. 8B). The slow growth did not appear to be associated with increased iron influx, since deletion of the iron transporter gene FET3 did not alter the growth rate; instead, the {Delta}yfh1 defect in iron homeostasis resulted in nuclear chromosomal damage, which might explain the slow-growth phenotype. Other iron-import pathways appear to be activated in the absence of FET3 (23), and might be an additional source of damage via Fenton reactions in the cytoplasm. However, direct measurements of iron in {Delta}yfh1 mutants have only revealed increases in the mitochondria (10,20), suggesting that they are the major source of increased ROS, such as H2O2.

The {Delta}yfh1 mutation greatly increased sensitivity to the DNA-methylating agent MMS and the DNA-synthesis inhibitor HU. Although MMS can damage proteins in addition to DNA (24), the major impact on survival is generally considered to result from lesions in chromosomal DNA. Moreover, we found that there was a high spontaneous induction of the DNA damage-responsive promoter of the RNR3 gene. This induction could be due to blocks in DNA synthesis caused by oxidized bases (38) or intermediates produced during repair of oxidized DNA by base excision repair, such as abasic sites or nicks. The enhanced sensitivity to HU might be due to a combination of elevated levels of damage, along with a reduction in pools of dNTPs. Further evidence for increased levels of chromosomal damage in {Delta}yfh1 cells was demonstrated by the increase in illegitimate mating that results from chromosome instability, primarily chromosome loss (2628).

The {Delta}yfh1 mutation does not lead to a general sensitivity to DNA-damaging agents. Neither camptothecin (unpublished), which interferes with topoisomerases, nor ultraviolet (UV) or gamma radiation, which cause several types of DNA lesions, increased killing in {Delta}yfh1 cells. It is interesting that gamma radiation does not seem to have an effect on {Delta}yfh1 cells. Possibly this is due to radiation damage producing radicals that are concentrated in ‘tracks’ that lead to double strand breaks. This contrasts with the diffuse radical damage mediated by H2O2 in {Delta}yfh1 cells. The differences in sensitivity to MMS and UV may indicate that the increased spontaneous lesions are not subject to nucleotide excision repair.

An increase in mutation and/or recombination rates is one of the hallmarks of nuclear DNA damage. The frataxin deficiency resulted in a 6-fold increase in SCE recombination rates. The forward mutation rate to canavanine resistance in {Delta}yfh1 strains was greatly increased when a {Delta}gpx1 mutation was introduced into the {Delta}yfh1 mutant, demonstrating that there is a considerable potential for mutation when frataxin is absent. The increases in chromosome loss, recombination and mutation are consistent with other observations reported here, and collectively demonstrate that the frataxin defect results in nuclear instability.

The protective role that frataxin plays in preventing damage to nuclear DNA is likely due to its control of iron distribution within the mitochondria. Using the human frataxin gene and mutants, it was possible to distinguish between effects that might be in part related to the mitochondrial deficiency of {Delta}yfh1 mutants versus control of iron distribution. Creation of the {Delta}yfh1 mutation in cells expressing the human frataxin gene or mutants did not lead to petite colonies for the wild-type and G130V alleles used in this study, suggesting that the human proteins could complement the frataxin defect. The {Delta}yfh1 cells expressing the human W173G mutant protein accumulate iron within the mitochondria (35), whereas wild-type and G130V proteins do not. However, the hypomorphic mutant W173G, which results in low amounts of mature frataxin in yeast (35), exhibited partial complementation for loss of mitochondrial function. Also, there was a clear nuclear damage response resulting in din1–lacZ induction and increased growth inhibition by HU and MMS (Fig. 7). The inhibition was due to most cells arresting in the G2 phase of the cell cycle (Fig. 7A, B and MMS data not shown), where they became swollen and dumbbell-shaped – a characteristic DNA-damage response (39). These results with the W173G mutant support the view that excess iron within the mitochondria is responsible for the nuclear DNA damage reported here. We note that the expression and damage response system that we have developed provides a means for both addressing reduced frataxin function and assessing the nature of human frataxin mutants. By varying the levels of induction using a rheostatable promoter [as has been reported recently for the analysis of human p53 mutant defects in yeast reporter assays (40)], it should be possible to evaluate the extent of functional defect of human frataxin mutants, as well as the importance of various amounts of wild-type protein.

The strains used in the present study were prone to petite formation when the {Delta}yfh1 gene was deleted, as found in other studies (22), and they were also highly sensitive to low concentrations of iron. These features will be useful in characterizing the effects of various frataxin levels, as evident from the results with the human proteins expressed in this strain. Reports of little or no petite formation in {Delta}yfh1 mutants and lack of induction of oxidative-stress genes (23) could be due to strain background differences. Strain background can markedly influence response to DNA lesions (39). Having a yeast model system that is highly responsive to the {Delta}yfh1 defects is particularly relevant, since FRDA patients express various levels of frataxin.

Since the free-radical scavenger NAC was effective in reducing the impact of the {Delta}yfh1 mutation, we propose that reduced levels of frataxin result in high levels of free radicals that can cause damage in the mitochondria and the nucleus. The consequences in the former are loss of mitochondrial DNA, rendering cells petite (10,22) (this study). The consequences in the latter are decreased chromosome stability and decreased resistance to agents that can cause DNA damage or alter DNA metabolism.

A source of DNA damage could be H2O2 production and subsequent radical formation. While previous studies demonstrated increased sensitivity to exogenous H2O2, we have established that {Delta}yfh1 cells produce a relatively high level of H2O2 (Fig. 6). As depicted in Figure 8A, B, the large excess of iron that is present within the mitochondria of {Delta}yfh1 cells, or possibly is imported into the cytoplasm, could catalyze superoxide radical formation in the presence of oxygen (21). This could lead to the generation of H2O2 either spontaneously or by the action of superoxide dismutase (41). It is also formally possible that associated with the frataxin defect is a reduced ability to detoxify H2O2. Since H2O2 is uncharged (unlike other ROS), it is freely diffusible and can traverse the mitochondrial membranes and enter the nuclear compartment.

The potential for H2O2 to cause nuclear DNA damage demonstrated by the increase in mutation rates exhibited by the {Delta}gpx1{Delta}yfh1 double mutants suggests not only that the frataxin deficiency lead to nuclear damage but also that the effects might be greater if there were not peroxidase detoxification. Taken together with the increase in nuclear DNA recombination rates, these results prove that there is nuclear DNA damage caused by the ROS, H2O2. Our results of several strong nuclear responses that are ROS-mediated in frataxin mutants appear to differ from reports of a lack of change in global genome expression, particularly induction of genes that respond to oxidative damage (23,42). This lack of induction of oxidative damage response genes might be due to the basal levels being sufficient to deal with the damage. Also, there are several repair mechanisms that deal with oxidative damage, including base excision repair, mismatch repair and recombination (4345). It is possible that concerted action by all these pathways helps limit the damage in {Delta}yfh1 cells. We are currently in the process of evaluating the role that these repair pathways may play in response to the nuclear DNA damage observed in {Delta}yfh1 cells.

It is also possible that some of the damage to nuclear DNA is caused by radicals transmitted between the membranes of perinuclear mitochondria and the nucleus via lipid peroxides (46). Alternatively, some mitochondria might lose their integrity because of oxidative degradation of the membranes, so that release of radicals could lead to nuclear damage.

There have been reports that FRDA patients can respond positively to free-radical scavengers/antioxidants such as idebenone (47,48). The results with yeast and human cells also lead us to suggest that there is a nuclear component to FRDA that may impact on the development of therapies. It is interesting that in early reports on the phenotypes of cells derived from FRDA patients, there was enhanced sensitivity to DNA-damaging agents (49), analogous to our results with the yeast mutant. Interestingly, there is also an increased frequency of mutations in a 135 bp window upstream from the GAA repeat region within the FRDA gene (11) observed in cells from FRDA patients. An increase in ROS in the nucleus, along with reduced nucleosome organization because of triplex formation (50,51), might account for this increased mutation. A recent report suggesting a link between FRDA and breast cancer (52) further supports the view that damage can occur when there are reduced amounts of frataxin in the mitochondria.

Finally, our findings suggest a novel relationship between mitochondria, mitochondrial proteins and the nucleus. The possibility that mitochondrial processes might impact on nuclear metabolism was previously suggested by the observations that petite mutants have slightly increased nuclear DNA mutation rates (53). Our study is the first to demonstrate that substantial nuclear DNA damage can arise in cells lacking a mitochondria-localized protein. This suggests that other mitochondrial proteins may also play a protective role with regard to nuclear damage.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Yeast strains and general genetic and molecular methods
Yeast cells were grown at 30°C on standard YPD (yeast extract, peptone, dextrose) or synthetic complete media (SC) (54). Yeast transformation and gene disruption were performed according to the methods of Gietz and Schiestl (55). Oligonucleotides for YFH1 gene disruption were purchased from Life-Technologies. Primers containing 60 bases of homology to YFH1 and 18 bases of homology to the vector PFA6MX4 were used. The following strains were employed for this study: GK5 (MAT{alpha} ade5–1 his7–2 leu2–3, 112 trp1–289 ura3–52) derived from ALE100 (CG379) (56), BY4741 (MATa his3{Delta}1, leu2{Delta}0, met15{Delta}0, ura3{Delta}0) (57) and YB146 (MATa ura3–52 his3–{Delta}200 ade2–101 lys2–801 trp1{Delta}1 gal3- rp1::[his3-{Delta}3'::Hocs his3-{Delta}5] (29). Diploid strains were constructed by mating GK5 with ALE100. Isogenic rho0 strains were obtained by ethidium bromide treatment (58,59).

Din1–lacZ induction assays.
A din1–lacZ damage-induction reporter system was derived by amplifying the DIN1 (RNR3) promoter region from genomic DNA (primers DINSTR: ggatccagaaggaaacactcaagggtgttg and BtDin: ctgcagatttattgctgctgctattcttgcttg). The PCR product was digested with BamHI and PstI and cloned into BamHI/PstI-cut YEplac112 (2 µm TRP1) to give plasmid YEplac112DIN1p. The lacZ-containing PstI fragment from plasmid pMC1871 (Pharmacia) was cloned into the PstI site of YEplac112DIN1p to produce YEplac112DIN1placZ. This plasmid was used to monitor chromosomal damage. Xgal plates were prepared by buffering SC medium with 0.1 M sodium phosphate buffer and adding 1.6 ml Xgal (50 mg/ml) (Promega). Patches of cells grown on SC–TRP media were lightly imprinted onto Xgal plates and analyzed after 2–3 days of incubation at 30°C.

Illegitimate mating.
Illegitimate mating, which provides an indirect measure of loss of chromosome III, as well as less common recombination events (2628) was assayed in the following manner. Strains were grown on YPD plates. About 5x106 cells of mating-type tester strains (MATa and MAT{alpha}) with multiple genetic markers were resuspended in 1 ml YPD broth and spread onto plates lacking appropriate amino acids to select for mating. Patches grown on YPD plates were lightly imprinted over the tester strains and examined for the presence of colonies after 2–3 days of incubation.

Growth rate, survival, mutation/recombination rate and H2O2 measurements
Growth.
To evaluate growth characteristics, log-phase cells were inoculated into YPD broth at <=1x107 cells/ml. All growth-rate measurements were done in duplicate using a hemocytometer with independent clonal isolates. The effects of iron and HU were determined using serial dilution pronging onto YPD plates containing HU or onto SC plates containing FeCl3. Approximately 5x106 cells were resuspended in 200 µl of water in a 96-well microtiter dish and serial 10-fold dilutions were pronged onto appropriate plates. Plates were analyzed after 2 days of incubation at 30°C. The free radical scavenger NAC was added to media at a final concentration of 20 mM.

MMS survival curves.
Diploid strains were grown overnight in YPD medium, diluted to approximately 1x107 cells/ml and treated with MMS. Treated cells were incubated at room temperature for 15 minutes, washed, diluted and spread onto YPD agar plates. Plates were examined after 3 days of incubation.

Mutation and recombination rate measurements.
Single colony isolates of the various strains were patched on YPD plates and grown for 2 days. The entire patch was harvested and resuspended in 250 µl of water. Ten microliters of the cells were diluted appropriately and plated on YPD plates to estimate the total number of cells present in the patch. 100 µl of cells were plated on selective plates. The colonies were counted after 3 days' incubation at 30°C. The mutation rates were determined by the method of the median (30).

H2O2 analysis.
Log-phase cells were inoculated into YPD broth at <=5x106 cells/ml and triplicate cultures were grown for 6 hours. Cells were washed and resuspended in 0.5 ml PBS and incubated at 30°C for 40 minutes (there was no increase in H2O2 beyond 30 minutes). The cells were then spun down and the PBS supernatant was passed through a Millex HA (Millipore) 0.45 µm filter. Triplicates of each supernatant were assayed for the presence of H2O2 by using the Amplex Red Hydrogen Peroxide Assay Kit (Molecular Probes Inc.) and assay conditions specified by the kit. Horseradish peroxidase reacts with H2O2 and Amplex Red to generate resorufin, which is detected with a fluorimeter. The horseradish peroxidase and Amplex Red reagent (in DMSO) were added to water to make the final assay solution, which was then added to the cell supernatant. The three independent cultures were assayed and the results were averaged.

Note added in proof
It is interesting to note, in light of our observation that frataxin can prevent nuclear damage, that there may be a role for frataxin in protecting cells from tumorigenesis based on the recent report by Shoichet et al. (2002) Frataxin promotes antioxidant defense in a thiol-dependent manner resulting in diminished malignant transformation in vitro. Hum. Mol. Genet., 11, 815–821.


    ACKNOWLEDGEMENTS
 
We thank Grazia Isaya for the human frataxin plasmids and Dr Ed Perkins for providing the din1–lacZ plasmid. We are especially grateful to Dr Ben van Houten for his constant enthusiasm and suggestions throughout this work. We thank Drs Bill Copeland, Ron Mason, Leroy Worth and Irwin Fridovich for their comments and helpful discussions.


    FOOTNOTES
 
* To whom correspondence should be addressed at: National Institute of Environmental Health Sciences (NIEHS), Mail Drop D3-01, 111 Alexander Drive, Research Triangle Park, NC 27709, USA. Tel:+1 919 541 4480; Fax:+1 919 541 7593; Email: Resnick{at}NIEHS.NIH.GOV Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
1 Harding, A.E. (1981) Friedreich's ataxia: a clinical and genetic study of 90 families with an analysis of early diagnostic criteria and intrafamilial clustering of clinical features. Brain, 104, 589–620.[Free Full Text]

2 Finocchiaro, G., Baio, G., Micossi, P., Pozza, G. and di Donato, S. (1988) Glucose metabolism alterations in Friedreich's ataxia. Neurology, 38, 1292–1296.[Abstract/Free Full Text]

3 Geoffroy, G., Barbeau, A., Breton, G., Lemieux, B., Aube, M., Leger, C. and Bouchard, J.P. (1976) Clinical description and roentgenologic evaluation of patients with Friedreich's ataxia. Can. J. Neurol. Sci., 3, 279–286.[Medline]

4 Harding, A.E. and Hewer, R.L. (1983) The heart disease of Friedreich's ataxia: a clinical and electrocardiographic study of 115 patients, with an analysis of serial electrocardiographic changes in 30 cases. Q. J. Med., 52, 489–502.[Abstract/Free Full Text]

5 Pentland, B. and Fox, K.A. (1983) The heart in Friedreich's ataxia. J. Neurol. Neurosurg. Psychiatry, 46, 1138–1142.[Abstract/Free Full Text]

6 Campuzano, V., Montermini, L., Molto, M.D., Pianese, L., Cossee, M., Cavalcanti, F., Monros, E., Rodius, F., Duclos, F., Monticelli, A. et al. (1996) Friedreich's ataxia: autosomal recessive disease caused by an intronic GAA triplet repeat expansion. Science, 271, 1423–1427.[Abstract]

7 Canizares, J., Blanca, J.M., Navarro, J.A., Monros, E., Palau, F. and Molto, M.D. (2000) dfh is a drosophila homolog of the Friedreich's ataxia disease gene. Gene, 256, 35–42.[Web of Science][Medline]

8 Gibson, T.J., Koonin, E.V., Musco, G., Pastore, A. and Bork, P. (1996) Friedreich's ataxia protein: phylogenetic evidence for mitochondrial dysfunction. Trends. Neurosci., 19, 465–468.[Web of Science][Medline]

9 Cossee, M., Puccio, H., Gansmuller, A., Koutnikova, H., Dierich, A., LeMeur, M., Fischbeck, K., Dolle, P. and Koenig, M. (2000) Inactivation of the Friedreich ataxia mouse gene leads to early embryonic lethality without iron accumulation. Hum. Mol. Genet., 9, 1219–1226.[Abstract/Free Full Text]

10 Babcock, M., de Silva, D., Oaks, R., Davis-Kaplan, S., Jiralerspong, S., Montermini, L., Pandolfo, M. and Kaplan, J. (1997) Regulation of mitochondrial iron accumulation by Yfh1p, a putative homolog of frataxin. Science, 276, 1709–1712.[Abstract/Free Full Text]

11 Bidichandani, S.I., Purandare, S.M., Taylor, E.E., Gumin, G., Machkhas, H., Harati, Y., Gibbs, R.A., Ashizawa, T. and Patel, P.I. (1999) Somatic sequence variation at the Friedreich ataxia locus includes complete contraction of the expanded GAA triplet repeat, significant length variation in serially passaged lymphoblasts and enhanced mutagenesis in the flanking sequence. Hum. Mol. Genet., 8, 2425–2436.[Abstract/Free Full Text]

12 Grabczyk, E. and Usdin, K. (2000) The GAA*TTC triplet repeat expanded in Friedreich's ataxia impedes transcription elongation by T7 RNA polymerase in a length and supercoil dependent manner. Nucleic Acids Res., 28, 2815–2822.[Abstract/Free Full Text]

13 Sakamoto, N., Chastain, P.D., Parniewski, P., Ohshima, K., Pandolfo, M., Griffith, J.D. and Wells, R.D. (1999) Sticky DNA: self-association properties of long GAA.TTC repeats in R.R.Y triplex structures from Friedreich's ataxia. Mol. Cell., 3, 465–475[Web of Science][Medline]

14 Bradley, J.L., Blake, J.C., Chamberlain, S., Thomas, P.K., Cooper, J.M. and Schapira, A.H. (2000) Clinical, biochemical and molecular genetic correlations in Friedreich's ataxia. Hum. Mol. Genet., 9, 275–282.[Abstract/Free Full Text]

15 Rotig, A., de Lonlay, P., Chretien, D., Foury, F., Koenig, M., Sidi, D., Munnich, A. and Rustin, P. (1997) Aconitase and mitochondrial iron–sulphur protein deficiency in Friedreich ataxia. Nat. Genet., 17, 215–217.[Web of Science][Medline]

16 Lodi, R., Cooper, J.M., Bradley, J.L., Manners, D., Styles, P., Taylor, D.J. and Schapira, A.H. (1999) Deficit of in vivo mitochondrial ATP production in patients with Friedreich ataxia. Proc. Natl Acad. Sci. USA, 96, 11492–11495.[Abstract/Free Full Text]

17 Branda, S.S., Yang, Z.Y., Chew, A. and Isaya, G. (1999) Mitochondrial intermediate peptidase and the yeast frataxin homolog together maintain mitochondrial iron homeostasis in Saccharomyces cerevisiae. Hum. Mol. Genet., 8, 1099–1110.[Abstract/Free Full Text]

18 Radisky, D.C., Babcock, M.C. and Kaplan, J. (1999) The yeast frataxin homologue mediates mitochondrial iron efflux. Evidence for a mitochondrial iron cycle. J. Biol. Chem., 274, 4497–4499.[Abstract/Free Full Text]

19 Adamec, J., Rusnak, F., Owen, W.G., Naylor, S., Benson, L.M., Gacy, A.M. and Isaya, G. (2000) Iron-dependent self-assembly of recombinant yeast frataxin: implications for Friedreich ataxia. Am. J. Hum. Genet., 67, 549–562.[Web of Science][Medline]

20 Foury, F. and Cazzalini, O. (1997) Deletion of the yeast homologue of the human gene associated with Friedreich's ataxia elicits iron accumulation in mitochondria. FEBS Lett., 411, 373–377.[Web of Science][Medline]

21 Puccio, H. and Koenig, M. (2000) Recent advances in the molecular pathogenesis of Friedreich ataxia. Hum. Mol. Genet., 9, 887–892.[Abstract/Free Full Text]

22 Wilson, R.B. and Roof, D.M. (1997) Respiratory deficiency due to loss of mitochondrial DNA in yeast lacking the frataxin homologue. Nat. Genet., 16, 352–357.[Web of Science][Medline]

23 Foury, F. and Talibi, D. (2000) Mitochondrial control of iron homeostasis. A genome wide analysis of gene expression in a yeast frataxin deficient mutant. J. Biol. Chem., 276, 7762–7768.[Abstract/Free Full Text]

24 Jelinsky, S.A. and Samson, L.D. (1999) Global response of Saccharomyces cerevisiae to an alkylating agent. Proc. Natl Acad. Sci. USA, 96, 1486–1491.[Abstract/Free Full Text]

25 Ruby, S.W. and Szostak, J.W. (1985) Specific Saccharomyces cerevisiae genes are expressed in response to DNA-damaging agents. Mol. Cell. Biol., 5, 75–84.[Abstract/Free Full Text]

26 Gordenin, D.A., Proscyavichus, Y.Y., Malkova, A.L., Trofimova, M.V. and Peterzen, A. (1991) Yeast mutants with increased bacterial transposon Tn5 excision. Yeast, 7, 37–50.[Web of Science][Medline]

27 Haber, J.E., Weiffenbach, B., Rogers, D.T., McCusker, J. and Rowe, L.B. (1981) Chromosomal rearrangements accompanying yeast mating-type switching: evidence for a gene-conversion model. Cold Spring Harb. Symp. Quant. Biol., 45, 991–1002.

28 Strathern, J., Hicks, J. and Herskowitz, I. (1981) Control of cell type in yeast by the mating type locus. The alpha 1–alpha 2 hypothesis. J. Mol. Biol., 147, 357–372.[Web of Science][Medline]

29 Fasullo, M., Bennett, T., AhChing, P. and Koudelik, J. (1998) The Saccharomyces cerevisiae RAD9 checkpoint reduces the DNA damage-associated stimulation of directed translocations. Mol. Cell. Biol., 18, 1190–1200.[Abstract/Free Full Text]

30 Tran, H.T., Degtyareva, N.P., Koloteva, N.N., Sugino, A., Masumoto, H., Gordenin, D.A. and Resnick, M.A. (1995) Replication slippage between distant short repeats in Saccharomyces cerevisiae depends on the direction of replication and the RAD50 and RAD52 genes. Mol. Cell. Biol., 15, 5607–5617.[Abstract]

31 Hall, T.J., Schaeublin, M., Jeker, H., Fuller, K. and Chambers, T.J. (1995) The role of reactive oxygen intermediates in osteoclastic bone resorption. Biochem. Biophys. Res. Commun., 207, 280–287.[Web of Science][Medline]

32 Vulcano, M., Rosa, M.F., Breyer, I. and Isturiz, M.A. (1998) Hydroxyl radical scavengers inhibit TNF-alpha production in mononuclear cells but not in polymorphonuclear leukocytes. Int. J. Immunopharmacol., 20, 709–722.[Web of Science][Medline]

33 Brennan, R.J. and Schiestl, R.H. (1996) Cadmium is an inducer of oxidative stress in yeast. Mutat. Res., 356, 171–178.[Web of Science][Medline]

34 Chen, C. and Kolodner, R.D. (1999) Gross chromosomal rearrangements in Saccharomyces cerevisiae replication and recombination defective mutants Nat. Genet., 23, 81–85.[Web of Science][Medline]

35 Cavadini, P., Gellera, C., Patel, P.I. and Isaya, G. (2000) Human frataxin maintains mitochondrial iron homeostasis in Saccharomyces cerevisiae. Hum. Mol. Genet., 9, 2523–2530.[Abstract/Free Full Text]

36 Paulovich, A.G. and Hartwell, L.H. (1995) A checkpoint regulates the rate of progression through S phase in S. cerevisiae in response to DNA damage. Cell, 82, 841–847.[Web of Science][Medline]

37 Siede, W. (1995) Cell cycle arrest in response to DNA damage: lessons from yeast. Mutat. Res., 337, 73–84.[Web of Science][Medline]

38 Ide, H., Yamaoka, T. and Kimura, Y. (1994) Replication of DNA templates containing the alpha-anomer of deoxyadenosine, a major adenine lesion produced by hydroxyl radicals. Biochemistry, 33, 7127–7133.[Medline]

39 Lewis, L.K., Kirchner, J.M. and Resnick, M.A. (1998) Requirement for end-joining and checkpoint functions, but not RAD52-mediated recombination, after EcoRI endonuclease cleavage of Saccharomyces cerevisiae DNA. Mol. Cell. Biol., 18, 1891–1902[Abstract/Free Full Text]

40 Inga, A. and Resnick, M.A. (2001) p53 mutants exhibiting enhanced transcriptional activation and altered promoter selectivity are revealed using a sensitive, yeast based functional assay. Oncogene, 20, 501–513[Web of Science][Medline]

41 Henle, E.S. and Linn, S. (1997) Formation, prevention, and repair of DNA damage by iron/hydrogen peroxide. J. Biol. Chem., 272, 19095–19098.[Free Full Text]

42 Chantrel-Groussard, K., Geromel, V., Puccio, H., Koenig, M., Munnich, A., Rotig, A. and Rustin, P. (2001) Disabled early recruitment of antioxidant defenses in Friedreich's ataxia Hum. Mol. Genet., 10, 2061–2067.[Abstract/Free Full Text]

43 Earley, M.C. and Crouse, G.F. (1998) The role of mismatch repair in the prevention of base pair mutations in Saccharomyces cerevisiae. Proc. Natl Acad. Sci. USA, 95, 15487–15491.[Abstract/Free Full Text]

44 Ni, T.T., Marsischky, G.T. and Kolodner, R.D. (1999) MSH2 and MSH6 are required for removal of adenine misincorporated opposite 8-oxo-guanine in S. cerevisiae. Mol. Cell., 4, 439–444.[Web of Science][Medline]

45 Swanson, R.L., Morey, N.J., Doetsch, P.W. and Jinks-Robertson, S. (1999) Overlapping specificities of base excision repair, nucleotide excision repair, recombination, and translesion synthesis pathways for DNA base damage in Saccharomyces cerevisiae. Mol. Cell. Biol., 19, 2929–2935.[Abstract/Free Full Text]

46 Marnett, L.J. (2000) Oxyradicals and DNA damage. Carcinogenesis, 21, 361–370.[Abstract/Free Full Text]

47 Schulz, J.B., Dehmer, T., Schols, L., Mende, H., Hardt, C., Vorgerd, M., Burk, K., Matson, W., Dichgans, J., Beal, M.F. and Bogdanov, M.B. (2000) Oxidative stress in patients with friedreich ataxia. Neurology, 55, 1719–1721.[Abstract/Free Full Text]

48 Rustin, P., von Kleist-Retzow, J.C., Chantrel-Groussard, K., Sidi, D., Munnich, A. and Rotig, A. (1999) Effect of idebenone on cardiomyopathy in Friedreich's ataxia: a preliminary study. Lancet, 354, 477–479.[Web of Science][Medline]

49 Evans, H.J., Vijayalaxmi, Pentland, B. and Newton, M.S. (1983) Mutagen hypersensitivity in Friedreich's ataxia. Ann. Hum. Genet., 47, 193–204[Web of Science][Medline]

50 Espinas, M.L., Jimenez-Garcia, E., Martinez-Balbas, A. and Azorin, F. (1996) Formation of triple-stranded DNA at d(GA.TC)n sequences prevents nucleosome assembly and is hindered by nucleosomes J. Biol. Chem., 271, 31807–31812.[Abstract/Free Full Text]

51 Westin, L., Blomquist, P., Milligan, J.F. and Wrange, O. (1995) Triple helix DNA alters nucleosomal histone–DNA interactions and acts as a nucleosome barrier. Nucleic Acids Res., 23, 2184–2191.[Abstract/Free Full Text]

52 Kidd, A., Coleman, R., Whiteford, M., Barron, L.H., Simpson, S.A. and Haites, N.E. (2001) Breast cancer in two sisters with Friedreich's ataxia. Eur. J. Surg. Oncol., 27, 512–514.[Web of Science][Medline]

53 Flury, F., von Borstel, R.C. and Williamson, D.H. (1976) Mutator activity of petite strains of Saccharomyces cerevisiae. Genetics, 83, 645–653.[Abstract/Free Full Text]

54 Sherman, F., Fink, G.F. and Hicks, J.B. (1986) Methods in Yeast Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

55 Gietz, R.D. and Schiestl, R.H. (1991) Applications of high efficiency lithium acetate transformation of intact yeast cells using single-stranded nucleic acids as carrier. Yeast, 7, 253–263.[Web of Science][Medline]

56 Gary, R., Park, M.S., Nolan, J.P., Cornelius, H.L., Kozyreva, O.G., Tran, H.T., Lobachev, K.S., Resnick, M.A. and Gordenin, D.A. (1999) A novel role in DNA metabolism for the binding of Fen1/Rad27 to PCNA and implications for genetic risk. Mol. Cell. Biol., 19, 5373–5382.[Abstract/Free Full Text]

57 Brachmann, C.B., Davies, A., Cost, G.J., Caputo, E., Li, J., Hieter, P. and Boeke, J.D. (1998) Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast, 14, 115–132.[Web of Science][Medline]

58 Fox, T.D., Folley, L.S., Mulero, J.J., McMullin, T.W., Thorsness, P.E., Hedin, L.O. and Costanzo, M.C. (1991) Analysis and manipulation of yeast mitochondrial genes. Meth. Enzymol., 194, 149–165.[Web of Science][Medline]

59 Slonimski, P.P., Perrodin, G. and Croft, J.H. (1968) Ethidium bromide induced mutation of yeast mitochondria: complete transformation of cells into respiratory deficient non-chromosomal ‘petites’. Biochem. Biophys. Res. Commun., 30, 232–239.[Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
H. Ding, J. Yang, L. C. Coleman, and S. Yeung
Distinct Iron Binding Property of Two Putative Iron Donors for the Iron-Sulfur Cluster Assembly: IscA AND THE BACTERIAL FRATAXIN ORTHOLOG CyaY UNDER PHYSIOLOGICAL AND OXIDATIVE STRESS CONDITIONS
J. Biol. Chem., March 16, 2007; 282(11): 7997 - 8004.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
G. R. Stuart, J. H. Santos, M. K. Strand, B. Van Houten, and W. C. Copeland
Mitochondrial and nuclear DNA defects in Saccharomyces cerevisiae with mutations in DNA polymerase {gamma} associated with progressive external ophthalmoplegia
Hum. Mol. Genet., January 15, 2006; 15(2): 363 - 374.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. J. Schulz, R. Thierbach, A. Voigt, G. Drewes, B. Mietzner, P. Steinberg, A. F. H. Pfeiffer, and M. Ristow
Induction of Oxidative Metabolism by Mitochondrial Frataxin Inhibits Cancer Growth: OTTO WARBURG REVISITED
J. Biol. Chem., January 13, 2006; 281(2): 977 - 981.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
R. Thierbach, T. J. Schulz, F. Isken, A. Voigt, B. Mietzner, G. Drewes, J.-C. von Kleist-Retzow, R. J. Wiesner, M. A. Magnuson, H. Puccio, et al.
Targeted disruption of hepatic frataxin expression causes impaired mitochondrial function, decreased life span and tumor growth in mice
Hum. Mol. Genet., December 15, 2005; 14(24): 3857 - 3864.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
E. Lesuisse, S. A. B. Knight, M. Courel, R. Santos, J.-M. Camadro, and A. Dancis
Genome-Wide Screen for Genes With Effects on Distinct Iron Uptake Activities in Saccharomyces cerevisiae
Genetics, January 1, 2005; 169(1): 107 - 122.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Belli, M. M. Molina, J. Garcia-Martinez, J. E. Perez-Ortin, and E. Herrero
Saccharomyces cerevisiae Glutaredoxin 5-deficient Cells Subjected to Continuous Oxidizing Conditions Are Affected in the Expression of Specific Sets of Genes
J. Biol. Chem., March 26, 2004; 279(13): 12386 - 12395.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
G. Karthikeyan, J. H. Santos, M. A. Graziewicz, W. C. Copeland, G. Isaya, B. V. Houten, and M. A. Resnick
Reduction in frataxin causes progressive accumulation of mitochondrial damage
Hum. Mol. Genet., December 15, 2003; 12(24): 3331 - 3342.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Park, O. Gakh, H. A. O'Neill, A. Mangravita, H. Nichol, G. C. Ferreira, and G. Isaya
Yeast Frataxin Sequentially Chaperones and Stores Iron by Coupling Protein Assembly with Iron Oxidation
J. Biol. Chem., August 15, 2003; 278(33): 31340 - 31351.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
A. K. Rasmussen, A. Chatterjee, L. J. Rasmussen, and K. K. Singh
Mitochondria-mediated nuclear mutator phenotype in Saccharomyces cerevisiae
Nucleic Acids Res., July 15, 2003; 31(14): 3909 - 3917.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
E. Lesuisse, R. Santos, B. F. Matzanke, S. A. B. Knight, J.-M. Camadro, and A. Dancis
Iron use for haeme synthesis is under control of the yeast frataxin homologue (Yfh1)
Hum. Mol. Genet., April 15, 2003; 12(8): 879 - 889.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
M. L. Jauslin, T. Wirth, T. Meier, and F. Schoumacher
A cellular model for Friedreich Ataxia reveals small-molecule glutathione peroxidase mimetics as novel treatment strategy
Hum. Mol. Genet., November 15, 2002; 11(24): 3055 - 3063.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Park, O. Gakh, S. M. Mooney, and G. Isaya
The Ferroxidase Activity of Yeast Frataxin
J. Biol. Chem., October 4, 2002; 277(41): 38589 - 38595.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (31)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Karthikeyan, G.
Right arrow Articles by Resnick, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Karthikeyan, G.
Right arrow Articles by Resnick, M. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?