Human Molecular Genetics, 2002, Vol. 11, No. 18 2103-2111
© 2002 Oxford University Press
A mouse model of spinal and bulbar muscular atrophy
1Monash Institute of Reproduction and Development, Monash University, 27–31 Wright Street, Clayton, Melbourne, Victoria, 3168, Australia, 2Neurosciences Group, Department of Medicine, Monash University, Monash Medical Centre, 246 Clayton Road, Clayton, Melbourne, Victoria, 3168, Australia and 3Department of Anatomy and Cell Biology, Monash University, Clayton, Melbourne, Victoria, 3168, Australia
Received April 11, 2002; Revised June 20, 2002; Accepted June 24, 2002
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTS AND DISCUSSIONMETHODSREFERENCES |
|---|
Spinal and bulbar muscular atrophy (SBMA) is an adult-onset motor neuron disease, caused by the expansion of a trinucleotide repeat (TNR) in exon 1 of the androgen receptor (AR) gene. This disorder is characterized by degeneration of motor and sensory neurons, proximal muscular atrophy, and endocrine abnormalities, such as gynecomastia and reduced fertility. We describe the development of a transgenic model of SBMA expressing a full-length human AR (hAR) cDNA carrying 65 (AR65) or 120 CAG repeats (AR120), with widespread expression driven by the cytomegalovirus promoter. Mice carrying the AR120 transgene displayed behavioral and motor dysfunction, while mice carrying 65 CAG repeats showed a mild phenotype. Progressive muscle weakness and atrophy was observed in AR120 mice and was associated with the loss of
-motor neurons in the spinal cord. There was no evidence of neurodegeneration in other brain structures. Motor dysfunction was observed in both male and female animals, showing that in SBMA the polyglutamine repeat expansion causes a dominant gain-of-function mutation in the AR. The male mice displayed a progressive reduction in sperm production consistent with testis defects reported in human patients. These mice represent the first model to reproduce the key features of SBMA, making them a useful resource for characterizing disease progression, and for testing therapeutic strategies for both polyglutamine and motor neuron diseases. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTS AND DISCUSSIONMETHODSREFERENCES |
|---|
Spinal and bulbar muscular atrophy (SBMA) is a progressive, adult-onset, motor neuron disease primarily affecting males (1). This disorder is characterized by muscle weakness and wasting of the limbs and face, with associated fasciculations. The primary site of neuropathology appears to be lower motor and sensory neurons, with an apparent sparing of other brain structures (2). Histological studies of autopsy material show a severe loss of anterior horn cells, especially the large
-motor neurons, in all segments, with the remaining neurons being atrophic (3). In addition, affected males may show signs of androgen insensitivity, including gynecomastia, as well as reduced fertility and testicular atrophy (4). Expansion of a trinucleotide repeat (TNR) in exon 1 of the androgen receptor (AR) gene, located on the X chromosome, causes SBMA (5). This CAG repeat tract is highly polymorphic, with repeats ranging from 11 to 33 in the normal population, with a mean length of 21. In SBMA, this repeat tract is expanded to range from 38 to 72 CAG repeats. While this region of the AR is highly polymorphic, it is relatively stable when compared to other TNR regions associated with polyglutamine diseases (6).
Expanded polyglutamine tracts, encoded by a CAG repeat, have been identified as a pathogenic mutation for at least eight neurodegenerative diseases, including Huntington disease (HD), and spinocerebellar (SCA) 1, 2, 3, 6 and 7 and dentatorubropallidoluysian atrophy (DRPLA) [reviewed in 7]. While these mutations all occur in different, widely expressing, genes, only specific neuronal populations are affected; the only conserved feature of these disease genes is the CAG repeat, implying a common disease mechanism. There have been several previous attempts to create a transgenic model of SBMA, although only one has resulted in a pathological phenotype. The earliest studies used cDNA constructs with up to 65 CAG repeats, and while the transgenes expressed, no phenotype was observed (8). A more recent model, using a truncated AR carrying 112 repeats (9), had behavioral abnormalities and neuropathology. These transgenic mice, however, appeared to present with the features of a generic model of polyglutamine disorders, with the phenotype suggesting dysfunction in many neuronal populations. This has also been observed in mice carrying a truncated HD transgene (10). When the expression of the mutated AR transgene was limited through use of the neurofilament light chain promoter, mice developed a phenotype confined to the motor systems. There were, however, upper motor neuron manifestations, in addition to the lower motor neuron disease, which is inconsistent with clinical data for SBMA patients. Furthermore, none of the mice in this study showed motor neuron loss or muscular atrophy.
The scope of this study was to generate a transgenic model of SBMA. Mice were generated expressing a full-length human AR cDNA carrying 20 (AR20: controls), 65 (AR65: SBMA) or 120 (AR120: accelerated SBMA) CAG repeats. The AR65 mice developed mild neurological symptoms, while AR120 mice developed accelerated muscle weakness and atrophy associated with the progressive loss of lower motor neurons. The AR120 mice also displayed a progressive decrease in sperm production. Thus these mice represent a clinically relevant model of SBMA for the study of pathogenesis of this disorder, and for testing of potential therapeutics.
|
RESULTS AND DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTS AND DISCUSSIONMETHODSREFERENCES |
|---|
Generation of transgenic constructs and founder lines
A mouse model of SBMA was generated using full-length AR cDNA constructs containing various CAG repeat lengths (Fig. 1A). RT–PCR (not shown) and Western blot analysis (Fig. 1B) were used to show that the transgene was expressed in a wide variety of tissues at levels similar to that of the endogenous mouse AR. Notable exceptions were the spleen and testis, which had higher and lower levels respectively. Mice were monitored after weaning to identify any abnormal phenotypes (11). All animals were initially fertile and lines were established from two of the expanded repeat lines shown to express the mutant protein (AR65-1, AR65-2, AR120-1, AR120-2). Control lines were chosen with similar expression levels, as determined by western blot; note the slower migration of the AR120 transgene relative to the mouse AR, and expression patterns, determined by RT–PCR (AR20-1, AR20-2) (Fig. 1C and D). Actin was used to normalize for protein loading when estimating transgene expression levels. Of note, the expression of the AR120 protein apparently resulted in decreased expression of the endogenous mouse AR. It was assumed that this also occurred for the AR20 transgene, but this could not be determined by this western analysis. This self-regulation of expression has been suggested in other studies of the AR (12,13). As such, when determining expression levels, total AR (i.e. both mouse and human) was measured, and it was determined that the transgene was expressing at
80% of levels determined in wild-type animals in the muscle and the spinal cord. Furthermore, western analysis of testis samples revealed the presence of a second band, of lower molecular weight, which may represent a testis-specific post-translational modification, or possibly a splice variant of the AR (14,15).
|
Phenotype analysis
Mice generated carrying the AR120 and AR65 constructs developed various late-onset, progressive phenotypes. These phenotypes were observed in at least two independent lines, for each construct. Progressive limb clasping developed most rapidly in the AR120 lines, to a lesser extent in the AR65 mice, and was absent in the AR20 and wild-type mice (Fig. 1C and Table 1). This phenotype represents a common sign of neuropathology in mice (11) and was used as an early marker of SBMA pathology. By 6 months of age, AR120 mice developed reduced cage activity, as determined by a locomotor activity test (11) (Fig. 2A) with a concomitant increase in body weight (Fig. 2B). This change in body weight was not observed in female AR120 mice (not shown). None of the lines carrying the AR20 transgene developed any phenotypic abnormalities up to 12 months of age. Detailed analyses of SBMA pathology were only undertaken on the AR120 lines, due to the mild phenotype observed in the AR65 mice.
|
|
6 per group). (C) Muscle weakness: mice were suspended from a stationary narrow bar and the time taken to fall was recorded. By 4 months of age AR120, males became fatigued in significantly less time than wild-type controls. AR120 females became fatigued in significantly less time than controls by 6 months of age (dashed line; statistical significance is indicated in parentheses) (nNeuropathology
Mice were assessed for specific sites of neuronal cell loss (Fig. 3A–G). Immunohistochemical analysis of AR120 mice showed degenerating cells seen as dark, shrunken cells with pyknotic, densely staining nuclei that were absent in the control mice (Fig. 3D and E). TUNEL staining did not detect any apoptosis (not shown) in these mice, raising the possibility of non-apoptotic cell death, as described previously (16). Unbiased stereological analysis of the lumbar enlargement showed loss of the large
-motor neurons, which are the neurons that innervate skeletal muscle fibers. AR120 mice displayed progressive neurodegeneration in the lumbar enlargement, losing 60% of motor neurons by 6 months of age (Fig. 3F). Further, the remaining -motor neurons were atrophic, as described in human patients (3). Motor neuron cross-sectional area was determined and found to be reduced by 19.3%±2.6% in AR120-1 mice, when compared to control animals (Fig. 3G). Reduced neuronal numbers were not a result of developmental defects, as motor neuron numbers were equal in all lines at birth (Fig. 3D). As an independent assessment of neurodegeneration, the cross-sectional area of the lumbar enlargement was determined and found to be reduced by 13.1%±2.4% (Table 1).
|
As neurodegeneration in SBMA has been reported to be limited to the lower motor and sensory neurons (2), the striatum and cerebellum were also analyzed for pathological changes. These regions were chosen, as the neurons from these areas are affected in other TNR disorders, e.g. HD and SCA1. Unbiased volumetric analysis was used to determine if there were any volume changes in either of these regions of the brain. Volumes of the striatum and cerebellum were found to be comparable in all lines of mice studied (Table 1). Further, no obvious neuronal degeneration was observed in either of the regions studied, suggesting that toxicity is specific to the motor neurons.
Gliosis is often associated with neuronal degeneration, and has been reported in models of other polyglutamine disorders (17) and mild astrocytosis reported in some SBMA patients (2). Immunofluorescent staining for glial fibrillary acidic protein (GFAP), for astrocytes, and MAC-1, for active microglia, revealed no obvious differences between AR120 and control animals (data not shown). Immunohistochemical analysis of AR expression in the AR120-1 line revealed no evidence of intranuclear inclusions in any area of the brain, or the spinal cord. Furthermore, immunostaining using an antibody directed against ubiquitin could not detect any aggregate formation. This is unlike other reports, which have found aggregates in both a mouse model of SBMA (9) and patient samples (18). SBMA patients, however, have been shown to have a very low level of aggregate formation (18,19), as have other models using full-length mutated proteins (17). We cannot, however, exclude the possibility that microaggregates (20) are present in our model.
Muscle pathology
Male AR120-1 and AR120-2 (not shown) mice began to develop muscle weakness at 4 months of age as assessed by a narrow bar hang assay (11). AR120 mice began to become fatigued in significantly less time than control animals, and this weakness became progressively worse as the animals aged (Fig. 2C). Furthermore, from 4 months of age, AR120 mice were no longer able to lift their body weight onto the narrow bar, indicating a loss of muscular strength in these animals. At 3 months of age, mild fiber-type grouping was obvious in AR120 animals (Fig. 4A–D), consistent with data from SBMA patients (2). Further histological analysis of the muscles of these animals showed groups of atrophic, presumably denervated, fibers (Fig. 4I–C) surrounded by apparently normal areas of muscle. Atrophic fibers were angular and shrunken fibers with multiple internalized and pyknotic nuclei. Areas of active degeneration were observed, as depicted by the areas of fragmentation in Figure 4K (1). All of these observations are consistent with those observed in SBMA patients (2), and were never observed in control animals. At 12 months, muscular atrophy became apparent, with decreases observed in both the wet weight (Fig. 4O) and the total number of muscle fibers (not shown), by 13.9%±4.1% and 15%±5%, respectively. All fiber types were reduced by approximately the same degree (not shown). Compensatory hypertrophy of the remaining fibers was observed, as has been reported to be common in SBMA patients (Fig. 4R) (2). The mean cross-sectional area of all types of muscle fibers was increased by 65%±3% (Fig. 4E–H and R) in AR120 mice; however there was a larger degree of hypertrophy in the type I fibers (not shown). Interestingly, there were no obvious signs of aggressive fiber degeneration in aged AR120 mice, which may be consistent with the apparent plateauing of -motor neuron loss (Fig. 3F). However, there were some condensed, angular fibers observed in 12-month-old AR120 mice (Fig. 6.3P). Unlike in 3-month-old animals, grouping of muscle fibers was not observed in the aged animals. This suggests a continued ‘drop-out’ of the motor neurons that originally contributed to the fiber-type grouping observed in the younger animals, an observation consistent with other studies of diseases of the anterior horn.
|
The onset of the muscle weakness in females was delayed by
2 months, with clear signs of muscle weakness presenting at 6 months of age. These data, together with the suggestion that female body weight is not significantly changed (not shown), suggest an androgen-mediated effect contributing to the disease progression. Alternatively, we cannot exclude the possibility that estrogens are protective against SBMA. However, the observation that the addition of testosterone to cell lines carrying an expanded TNR in the AR increased cell death provides further evidence for androgens accelerating SBMA pathology (21). These data, and the observations from the AR120 mice, suggest that the concentration of testosterone may directly affect the pathogenesis of this disease. There are two factors that may contribute to androgens accelerating TNR disease in this model: ligand binding causes the AR to move into the nucleus, and as nuclear localization has been shown to be necessary for TNR disease progression (22), this may be a limiting factor in the pathogenesis of SBMA; the AR is held in the cytoplasm by heat shock proteins (including Hsp90 and Hsp70) which have been implicated as potential suppressors of TNR disease pathology (23–26).
Testicular pathology
Mice carrying the AR120 transgene showed no obvious infertility, and were able to breed until after 6 months of age. Histological examination of the testis revealed no obvious defects, and testis weights were not significantly different at any age studied (Table 1). Daily sperm production (DSP) of AR120-1 mice and controls were estimated (27,28), and at 3 months of age there was no difference between the DSP of AR120 mice and controls. At 6 and 12 months, however, AR120 DSP was significantly decreased (39.7%±3.5% and 46.8%±4% respectively) (Fig. 2D). No evidence of alterations to the pituitary–testicular axis was observed, as plasma concentrations of luteinizing hormone, testosterone and follicle-stimulating hormone were unchanged (not shown). Although the AR120 DSP was reduced, there was no decline in testis weight, suggesting that the defect occurred late in spermatogenesis; however, further analysis is required to determine if this is the case. The reduced DSP observed in the AR120 mice would appear not to be due to a loss of function of the mutant protein, as the endogenous mouse AR would correct for this. Further study is required to determine the role of the transgene in these changes.
Genetics
Although several attempts have been made to model SBMA (8,9,29), this is the first to accurately reproduce the key features of the disease: loss of -motor neurons, muscular atrophy, and testicular pathology, all of which developed progressively with age. This work has focused on the AR120 transgenic lines, as the phenotype presented by the AR65 lines was very slow to develop, supporting the observation, in human patients, that larger CAG repeats result in more severe disease.
In contrast to the human disease, this model of SBMA presents in both male and female mice. The onset of muscle weakness was delayed in females (Fig. 2C), supporting the suggestion that androgens may modulate the progression of SBMA (21). Skewed X-inactivation also appears to play an important role which results in up to 90% cells in the body being protected from the toxic effects associated with an expanded polyglutamine repeat in the AR (30). Potentially, silencing of the toxic allele in most of the cells expressing the AR would confer enough protection to result in the subclinical phenotype described in carrier females (31). Our data raise the possibility that low levels of androgens also contribute to the reduced pathology seen in female AR120 mice.
These mice represent the first model of SBMA to accurately reproduce key features of this disease, with this study presenting the first use of unbiased stereological techniques to show neuronal loss specific to the spinal cord. Furthermore, this model shows that an expanded polyglutamine repeat in the context of the complete AR protein is enough to cause a neuromuscular disease, limited to the lower motor neurons. The findings presented in this paper show that these mice represent a clinically relevant model for the study of factors involved in the initiation and progression of SBMA, and in testing potential therapeutics.
|
METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTS AND DISCUSSIONMETHODSREFERENCES |
|---|
Transgene production and analysis
Construction of AR full-length clones.
All constructs were based on a full-length hAR cDNA, containing 20 CAG repeats, cloned into a mammalian expression vector (kindly provided by Dr D Lubahn) (32). A fragment of exon 1 was amplified from the gDNA of a SBMA patient (kindly provided by Dr J. Zajac). This fragment contained 65 CAG repeats and was cloned into the hAR expression vector using the unique EagI and Af lII restriction sites. The region from EagI to Af lII of exon 1 of the hAR was cloned into the vector pSL1180 Invitrogen (Carlsbad, CA, USA). This vector was amplified, excluding the trinucleotide repeat, with Pfu polymerase Stratagene (La Jolla, CA, USA, using the primers AR-1 CAAGAGACTAGC CCCAGGCA and AR-2 CAGCAGCAG-CAAACTGGC. A stretch of 120 CAG repeats was also generated using a primer extension protocol described previously (33). This stretch of 120 CAG repeats was blunt-end cloned into the new vector, and the EagI and Af lII restriction sites were again used to clone into pCMV-AR expression vector.
Transgenesis.
Plasmids were digested with SspI to isolate the constructs with minimal vector sequences. Constructs were microinjected into sperm pronuclei of fertilized ova derived from mouse strain FVB/N. Genomic DNA from post-weaned animals was isolated from ear clips and genotyped for the transgene by PCR using the primers AR-3 GCCTTGC-TCTCTAGCCTCAA and AR-4 TTGGAGCCATCCAAAC-TCTT. In total, 37 lines were generated, 16 AR20, 25 AR65 and 6 AR120. Two lines representing each construct were chosen based on their transgene expression profile. The production, care and analysis of animals in this study were in accordance with the guidelines set out in animal ethics applications MMCA 1999/17 and MMCA 2000/34.
RT–PCR.
RNA was extracted from various tissues using the Absolutely RNATM RT–PCR Miniprep Kit (Stratagene), and reverse transcribed using Superscript II (Invitrogen). The hAR transgenic mRNA was then amplified using the primers 3'hAR.f (ggatgggctgaaaaatcaa) and 3'hAR.r (gggaaatagggtttccaatgc), to generate a product of 329 bp. The housekeeping gene, mouse porphobilinogen deaminase (PBGD), was detected as a positive control, with the primers mPBGD.f (gtgagtgtgttgcacgatcc) and mPBGD.r (tgggtcatcttctggaccat), which generates a product of 237 bp.
Western blot.
Tissue homogenates were prepared by homogenization in a modified RIPA buffer [0.1 M phosphate-buffered saline (PBS)/1% NP-40/0.5% Tween-20/0.1% sodium dodecyl sulfate (SDS), and Complete cocktail inhibitor Roche (Mannheim, Germany)], and extracted on ice for 30 min. Particulate matter was removed by centrifugation. Approximately 100 µg of supernatants from transgenic and wild-type animals, as determined by the DC protein assay BioRad (Hercules, CA, USA), were size fractionated on 7.5% SDS–PAGE gels, and the protein transferred to Immobilon P Millipore (Bedford, MA, USA). A transgene expression profile was determined using an anti-AR polyclonal antibody directed against the N-terminus of the receptor protein [AR (N-20) Santa Cruz (Santa Cruz, CA, USA)]. AR (N-20) is able to bind to both human and mouse AR and was used to determine transgene expression relative to mouse endogenous AR. This antibody was diluted 1 : 200 in 1% skim milk powder in Tris-buffered saline (TBS). Membranes were incubated overnight, and the following day washed in 1% skim milk powder, and 0.1% Tween-20 in TBS. Membranes were then incubated for 1 h with a biotinylated goat anti-rabbit secondary antibody Dako (Carpintera, CA, USA), diluted 1 : 20 000 as previously, before being washed again and incubated for 30 min with horseradish peroxidase (HRP)-conjugated streptavidin diluted 1 : 10 000 AMRAD (Melbourne, Australia). Following a final wash, bound AR (N-20) was visualized using ECL Plus Amersham (Piscataway, NJ, USA). Protein loading was determined using an actin polyclonal antibody Sigma Aldrich (St Louis, MO, USA) diluted 1 : 200, and membranes were incubated for 1 h. Following washing as described previously, membranes were incubated for 1 h with an HRP-conjugated goat anti-rabbit antibody (Dako) diluted 1 : 10 000. Again, detection was by ECL Plus (Amersham). All incubations were undertaken at room temperature.
Phenotype analysis
Behavioral analysis.
In total, 60 mice were analyzed for behavioral changes. Of these, 20 were AR120 heterozygotes, 20 AR20 heterozygotes and 20 wild-type animals.
Clasping reflex was tested for by suspending mice by their tails for 1 min (11). Mice were then scored for four levels of clasping: (0) no clasping; (1) single hind limb held to body with toes clasped; (2) both hind limbs held to body with toes clasped; and (3) all four limbs held to body with toes clasped.
Grip strength was assessed using a modified narrow bar assay as described (11). Mice were placed with their forelimbs on a 0.5 mm-wide wooden bar and the amount of time taken for the mouse to fall was assessed. If 60 s was reached, the mouse was removed from the bar and a score of 60 given. Mice were tested three times with 5 min between each test.
Cage activity was assessed using a modified locomotor activity test as described (11). Mice were placed onto a grid of squares 3x3 cm. Mice were allowed 2 min to settle before testing began, after which the number of squares crossed by the nose of the mouse in 60 s was recorded. This test was then repeated after 30 min.
Histology and stereology
Total sperm counts.
Mice at 3 and 6 months of age were sacrificed and the testes removed and snap frozen. Daily sperm production was estimated using the methods described previously (27,28).
Histology.
Mice of various ages were sacrificed and perfused with Bouin's fixative. Brains, brain stems and cervical and lumbar enlargements were removed, and placed in fixative for another 8 h. Lumbar enlargements and brains were then embedded in methacrylate and sectioned at 20 µm for stereological analysis as described (34), using a BX-51 microscope Olympus Corp. (Albertslund, Denmark); images were captured by a JVC TK-C1380 video camera coupled to an IBM computer and projected using a Screen Machine II fast multimedia adaptor FAST electronic (Hamburg, Germany). The computer program CAST-GRID V2.00.03 (Olympus Corp.) was used for analysis. -Motor neurons were identified by morphological criteria, including cell and nuclear size and shape. Cross-sectional area of spinal cords was determined by cutting 50 µm serial sections of the lumbar enlargement, staining with neutral red, and estimating using the CAST-GRID 3 system. Cross-sectional area of the -motor neurons was determined using these same sections. The area of the cell body was estimated using the CAST-GRID 3 system, 300 cells/animals, n=4/group.
Brain volumes.
The volume of the striatum and cerebellum was estimated using the Cavalieri estimator applied to 20 µm serial methacrylate sections as previously reported (35,36), using the CAST-GRID 3 system.
Immunofluorescence.
Mice of various ages were sacrificed and several tissues removed, e.g. brain, spinal cord and testis. Tissues were snap frozen in isopentane chilled in liquid nitrogen, before being sectioned at 8 µm. Sections were then post-fixed in 4% paraformaldehyde for 10 min, washed with PBS and, blocked with CAS block Zymed Laboratories Inc. (San Francisco, CA, USA) for 10 min. Following washing with PBS, sections were incubated overnight, with the AR (N-20) antibody diluted 1 : 50 in PBS, at 4°C Sections were then washed and incubated for 1 h, at room temperature, with a biotinylated goat anti-rabbit antibody (Dako) diluted 1 : 500. Samples were again washed in PBS and then incubated for 1 h at room temperature (in a dark box) with Texas Red conjugated streptavidin Vector Laboratories, Inc. (Burlinghame, CA, USA) before being washed and mounted in fluorescent mounting medium containing DAPI (Vector Laboratories, Inc.). Fluorescent staining was observed using an Olympus fluorescent microscope.
Muscle analysis.
Medial gastrocnemius was removed from animals of various ages and prepared as described (37). Sections used in the determination of fiber cross-sectional area were cut through the body of the medial gastrocnemius, 50% along the length of the muscle. Ten-micrometer sections were then stained with H&E and cross-sectional area was estimated using the CAST-GRID 3 system.
Statistics
All results are presented±SEM. All data were analyzed using one-way ANOVA.
|
ACKNOWLEDGEMENTS |
|---|
We thank A. Michalska, A. O'Connor, S. Hayward, O. Gerdprasert, and E. Lopes for technical assistance. We are grateful to D. Lubahn for the pCMV-AR vector and J. Zajac for sharing patient samples that enabled the success of this work. These studies were funded by Monash IVF and the NH&MRC (#973218) to J.R.M.
|
FOOTNOTES |
|---|
* To whom correspondence should be addressed Tel: +61 395947128; Fax: +61 395947111; E-mail: john.morrison@med.monash.edu.au
Present address: Pharmacia Corporation, 4901 Searle Parkway, Skokje, Illinois 60077, USA.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTS AND DISCUSSIONMETHODSREFERENCES |
|---|
1 Kennedy, W.R., Alter, M. and Sung, J.H. (1968) Progressive proximal spinal and bulbar muscular atrophy of late onset. A sex-linked recessive trait. Neurology, 18, 671–680.
2 Zajac, J.D.M.H. (1998) Kennedy's disease: clinical aspects. Genetic Instabil. Hered. Neurol. Dis., 87–101.
3 Terao, S., Sobue, G., Li, M., Hashizume, Y., Tanaka, F. and Mitsuma, T. (1997) The lateral corticospinal tract and spinal ventral horn in X-linked recessive spinal and bulbar muscular atrophy: a quantitative study. Acta Neuropathol. (Berl.), 93, 1–6.[Medline]
4 Arbizu, T., Santamaria, J., Gomez, J.M., Quilez, A. and Serra, J.P. (1983) A family with adult spinal and bulbar muscular atrophy, X-linked inheritance and associated testicular failure. J. Neurol. Sci., 59, 371–382.[Web of Science][Medline]
5 La Spada, A.R., Wilson, E.M., Lubahn, D.B., Harding, A.E. and Fischbeck, K.H. (1991) Androgen receptor gene mutations in X-linked spinal and bulbar muscular atrophy. Nature, 352, 77–79.[Medline]
6 Gusella, J.F. and MacDonald, M.E. (2000) Molecular genetics: unmasking polyglutamine triggers in neurodegenerative disease. Nat. Rev. Neurosci., 1, 109–115.[Web of Science][Medline]
7 Zoghbi, H.Y. and Orr, H.T. (2000) Glutamine repeats and neurodegeneration. Annu. Rev. Neurosci., 23, 217–247.[Web of Science][Medline]
8 Bingham, P.M., Scott, M.O., Wang, S., McPhaul, M.J., Wilson, E.M., Garbern, J.Y., Merry, D.E. and Fischbeck, K.H. (1995) Stability of an expanded trinucleotide repeat in the androgen receptor gene in transgenic mice. Nat. Genet., 9, 191–196.[Web of Science][Medline]
9
Abel, A., Walcott, J., Woods, J., Duda, J. and Merry, D.E. (2001) Expression of expanded repeat androgen receptor produces neurologic disease in transgenic mice. Hum. Mol. Genet., 10, 107–116.
10 Mangiarini, L., Sathasivam, K., Seller, M., Cozens, B., Harper, A., Hetherington, C., Lawton, M., Trottier, Y., Lehrach, H., Davies, S.W. et al. (1996) Exon 1 of the HD gene with an expanded CAG repeat is sufficient to cause a progressive neurological phenotype in transgenic mice. Cell, 87, 493–506.[Web of Science][Medline]
11 Rogers, D.C., Fisher, E.M., Brown S.D., Peters I., Hunter, A.J. and Martin, J.E. (1997) Behavioral and functional analysis of mouse phenotype: SHIRPA, a proposed protocol for comprehensive phenotype assessment. Mamm. Genome, 8, 711–713.[Web of Science][Medline]
12 Larkowski, T.D., Drengler, S.M., Tanzer, L. and Jones, K.J. (2000) Androgen receptor mRNA regulation in adult male and female hamster facial motoneurons: effects of axotomy and exogenous androgens. J. Neurobiol., 45, 207–214.[Web of Science][Medline]
13 Burnstein, K.L., Maiorino, C.A., Dai, J.L. and Cameron, D.J. (1995) Androgen and glucocorticoid regulation of androgen receptor cDNA expression. Mol. Cell. Endocrinol., 115, 177–186.[Web of Science][Medline]
14 Kuiper, G.G., de Ruiter, P.E. and Brinkmann, A.O. (1992) Androgen receptor heterogeneity in LNCaP cells is caused by a hormone independent phosphorylation step. J. Steroid Biochem. Mol. Biol., 41, 697–700.[Web of Science][Medline]
15 Xia, S.J., Tang, X.D. and Ma, Q.Z. (2001) Androgen receptor isoforms in human prostatic cancer tissue and LNCaP cell line. Asian. J. Androl., 3, 223–225.[Web of Science][Medline]
16
Turmaine, M., Raza, A., Mahal, A., Mangiarini, L., Bates, G.P. and Davies, S.W. (2000) Nonapoptotic neurodegeneration in a transgenic mouse model of Huntington's disease. Proc. Natl Acad. Sci. USA, 97, 8093–8097.
17 Reddy P.H., Williams, M., Charles, V., Garrett, L., Pike-Buchanan, L., Whetsell, W.O., Jr, Miller, G. and Tagle, D.A. (1998) Behavioural abnormalities and selective neuronal loss in HD transgenic mice expressing mutated full-length HD cDNA. Nat. Genet., 20, 198–202.[Web of Science][Medline]
18 Li, M., Miwa, S., Kobayashi, Y., Merry, D.E., Yamamoto, M., Tanaka, F., Doyu, M., Hashizume, Y., Fischbeck, K.H. and Sobue, G. (1998) Nuclear inclusions of the androgen receptor protein in spinal and bulbar muscular atrophy. Ann. Neurol., 44, 249–254.[Web of Science][Medline]
19
Li, M., Nakagomi, Y., Kobayashi, Y., Merry, D.E., Tanaka, F., Doyu, M., Mitsuma, T., Hashizume, Y., Fischbeck, K.H. and Sobue, G. (1998) Nonneural nuclear inclusions of androgen receptor protein in spinal and bulbar muscular atrophy. Am. J. Pathol., 153, 695–701.
20
Chai, Y., Wu, L., Griffin, J.D. and Paulson, H.L. (2001) The role of protein composition in specifying nuclear inclusion formation in polyglutamine disease. J. Biol. Chem., 276, 44889–44897.
21 Grierson, A.J., Shaw, C.E. and Miller, C.C. (2001) Androgen induced cell death in SHSY5Y neuroblastoma cells expressing wild-type and spinal bulbar muscular atrophy mutant androgen receptors. Biochim. Biophys. Acta., 1536, 13–20.[Medline]
22 Klement, I.A., Skinner, P.J., Kaytor, M.D., Yi, H., Hersch, S.M., Clark, H.B., Zoghbi, H.Y. and Orr, H.T. (1998) Ataxin-1 nuclear localization and aggregation: role in polyglutamine-induced disease in SCA1 transgenic mice. Cell, 95, 41–53.[Web of Science][Medline]
23
Cummings, C.J., Sun, Y., Opal, P., Antalffy, B., Mestril, R., Orr, H.T., Dillmann, W.H. and Zoghbi, H.Y. (2001) Over-expression of inducible HSP70 chaperone suppresses neuropathology and improves motor function in SCA1 mice. Hum. Mol. Genet., 10, 1511–1518.
24
Kazemi-Esfarjani, P. and Benzer, S. (2000) Genetic suppression of polyglutamine toxicity in Drosophila. Science, 287, 1837–1840.
25
Kobayashi, Y., Kume, A., Li, M., Doyu, M., Hata, M., Ohtsuka, K. and Sobue, G. (2000) Chaperones Hsp70 and Hsp40 suppress aggregate formation and apoptosis in cultured neuronal cells expressing truncated androgen receptor protein with expanded polyglutamine tract. J. Biol. Chem., 275, 8772–8778.
26
Zhou, H., Li, S.H. and Li, X.J. (2001) Chaperone suppression of cellular toxicity of huntingtin is independent of polyglutamine aggregation. J. Biol. Chem., 276, 48417–48424.
27
Thayer, K.A., Ruhlen, R.L., Howdeshell, K.L., Buchanan, D.L., Cooke, P.S., Preziosi, D., Welshons, W.V., Haseman, J. and vom Saal, F.S. (2001) Altered prostate growth and daily sperm production in male mice exposed prenatally to subclinical doses of 17alpha-ethinyl oestradiol. Hum. Reprod., 16, 988–996.
28 Amann, R.P. and Lambiase, J.T., Jr (1969) The male rabbit. 3. Determination of daily sperm production by means of testicular homogenates. J. Anim. Sci., 28, 369–374.[Web of Science][Medline]
29
La Spada, A.R., Peterson, K.R., Meadows, S.A., McClain, M.E., Jeng, G., Chmelar, R.S., Haugen, H.A., Chen, K., Singer, M.J., Moore, D. et al. (1998) Androgen receptor YAC transgenic mice carrying CAG 45 alleles show trinucleotide repeat instability, Hum. Mol. Genet., 7, 959–967.
30 Ishihara H., Kanda, F., Nishio, H., Sumino, K. and Chihara, K. (2001) Clinical features and skewed X-chromosome inactivation in female carriers of X-linked recessive spinal and bulbar muscular atrophy. J. Neurol., 248, 856–860.
31 Ferlini, A., Patrosso, M.C., Guidetti, D., Merlini, L., Uncini, A., Ragno, M., Plasmati, R., Fini, S., Repetto, M., Vezzoni, P. et al. (1995) Androgen receptor gene (CAG)n repeat analysis in the differential diagnosis between Kennedy disease and other motoneuron disorders. Am. J. Med. Genet., 55, 105–111.[Web of Science][Medline]
32
Lubahn, D.B., Joseph, D.R., Sar, M., Tan, J., Higgs, H.N., Larson, R.E., French, F.S. and Wilson, E.M. (1988) The human androgen receptor: complementary deoxyribonucleic acid cloning, sequence analysis and gene expression in prostate. Mol. Endocrinol., 2, 1265–1275.
33 Ordway, J.M. and Detloff, P.J. (1996). In Vitro synthesis and cloning of long CAG repeats. Biotechniques, 21, 609–610, 612.[Web of Science][Medline]
34 Lowry, K.S., Murray, S.S., McLean, C.A., Talman, P., Mathers, S., Lopes, E.C. and Cheema, S.S. (2001) A potential role for the p75 low-affinity neurotrophin receptor in spinal motor neuron degeneration in murine and human amyotrophic lateral sclerosis. Amyotroph. Lateral Scler. Other Motor Neuron Disord., 2, 127–134.[Web of Science][Medline]
35 Michel R.P. and Cruz-Orive, L.M. (1988) Application of the Cavalieri principle and vertical sections method to lung: estimation of volume and pleural surface area. J. Microsc., 150, 117–136.[Web of Science][Medline]
36 Gundersen, H.J., Bendtsen, T.F., Korbo, L., Marcussen, N., Moller, A., Nielsen, K., Nyengaard, J.R., Pakkenberg, B., Sorensen, F.B., Vesterby, A. et al. (1988) Some new, simple and efficient stereological methods and their use in pathological research and diagnosis. Apmis, 96, 379–394.[Web of Science][Medline]
37 Finkelstein, D.H., Horne, M.K. and Marshall, J.A. (1992) The effect of a six day sucrose diet on isometric contractile characteristics and histochemistry of rat muscles. J. Anim. Physiol. Anim. Nutr., 68, 10–19.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  D. R. Goldman-Johnson, D. M. de Kretser, and J. R. Morrison Evidence that Androgens Regulate Early Developmental Events, Prior to Sexual Differentiation Endocrinology, January 1, 2008; 149(1): 5 - 14. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. A. Monks, J. A. Johansen, K. Mo, P. Rao, B. Eagleson, Z. Yu, A. P. Lieberman, S. M. Breedlove, and C. L. Jordan Overexpression of wild-type androgen receptor in muscle recapitulates polyglutamine disease PNAS, November 13, 2007; 104(46): 18259 - 18264. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Siwach, S. D. Pophaly, and S. Ganesh Genomic and Evolutionary Insights into Genes Encoding Proteins with Single Amino Acid Repeats Mol. Biol. Evol., July 1, 2006; 23(7): 1357 - 1369. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Yu, N. Dadgar, M. Albertelli, A. Scheller, R. L. Albin, D. M. Robins, and A. P. Lieberman Abnormalities of Germ Cell Maturation and Sertoli Cell Cytoskeleton in Androgen Receptor 113 CAG Knock-In Mice Reveal Toxic Effects of the Mutant Protein Am. J. Pathol., January 1, 2006; 168(1): 195 - 204. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Thomas, Z. Yu, N. Dadgar, S. Varambally, J. Yu, A. M. Chinnaiyan, and A. P. Lieberman The Unfolded Protein Response Modulates Toxicity of the Expanded Glutamine Androgen Receptor J. Biol. Chem., June 3, 2005; 280(22): 21264 - 21271. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. M. Everett and N. W. Wood Trinucleotide repeats and neurodegenerative disease Brain, November 1, 2004; 127(11): 2385 - 2405. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. S. Chevalier-Larsen, C. J. O'Brien, H. Wang, S. C. Jenkins, L. Holder, A. P. Lieberman, and D. E. Merry Castration Restores Function and Neurofilament Alterations of Aged Symptomatic Males in a Transgenic Mouse Model of Spinal and Bulbar Muscular Atrophy J. Neurosci., May 19, 2004; 24(20): 4778 - 4786. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Michalik and C. Van Broeckhoven Pathogenesis of polyglutamine disorders: aggregation revisited Hum. Mol. Genet., October 15, 2003; 12(90002): R173 - 186. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||