Human Molecular Genetics, 2002, Vol. 11, No. 19 2269-2278
© 2002 Oxford University Press
Nucleocytoplasmic transfer of the NF2 tumor suppressor protein merlin is regulated by exon 2 and a CRM1-dependent nuclear export signal in exon 15
1Institute of Anatomy I, Friedrich-Alexander University of Erlangen, 91054 Erlangen, Germany and 2Department of Otorhinolaryngology/Head and Neck Surgery, Friedrich-Alexander University Medical Center, 91054 Erlangen, Germany
Received April 22, 2002; Accepted July 16, 2002
| ABSTRACT |
|---|
|
|
|---|
The neurofibromatosis 2 protein merlin is a classical tumor suppressor protein. Germline mutations predispose to the development of schwannomas, meningiomas and ependymomas. Merlin has been implicated in cellular migration and adhesion. This function is reflected in its subcellular localization at the plasma membrane and known interacting partners. Merlin has been regarded as an exception in not exerting a functional role within the nucleus as other tumor suppressors do. Here, we show that detection of wild-type protein in the nucleus is a rare event. However, splicing out of exon 2 leads to unrestricted entry into the nucleus. Skipping of adjacent exon 3 has no comparable effect ruling out an unspecific effect due to misfolding of the 4.1/JEF domain. Exon 2 functions as a cytoplasmic retention factor as it is able to confer sole cytoplasmic localization to a GFP fusion protein. Nuclear entry of merlin is thus regulated by alternative splicing within the 4.1/JEF domain and analogous to band 4.1 protein. Merlin's ability to enter the nucleus is complemented by a full nuclearcytoplasmic shuttle protein with a functional Rev-type nuclear export sequence (NES) within exon 15 that facilitates export via the CRM1/exportin pathway. Deletion of this NES or treatment with the CRM1-specific inhibitor leptomycin B leads to overall nuclear accumulation of merlin isoforms missing exon 2. A cellular function different to the wild-type protein is implied for naturally occurring splice variants lacking exon 2. A putative effect of merlin as a transcriptional regulator and identification of nuclear binding partners remains to be elucidated.
| INTRODUCTION |
|---|
|
|
|---|
Due to its high sequence conservation during evolution and developmental arrest at an early stage in homozygous mutant embryos, the neurofibromatosis type 2 (NF2) tumor suppressor protein named merlin or schwannomin can be regarded as a key regulatory protein for development of the organism. Insights into its biological function have been gained by experimental studies and in the model organisms mouse and Drosophila. In humans, germline mutations of the NF2 gene lead to development of a tumor condition characterized by schwannomas, meningiomas and ependymomas (1).
The N-terminal half of the NF2 protein comprises a conserved 38 kDa domain, which was originally identified in the red blood cell protein band 4.1 (2). Subsequently this domain was found to be present in several different protein families and thus has been dubbed the 4.1/JEF domain (for band 4.1, Janus kinase family, ERM protein family, Focal adhesion kinase family) (3). Based on amino acid sequence homology of its 4.1/JEF domain the NF2 protein is most closely related to members of the ERM family of proteins consisting of ezrin, radixin and moesin. In addition to the N-terminal 4.1/JEF domain, the NF2 protein shares the same secondary structure with the ERM proteins (4). Furthermore, activity of the NF2 protein is conformationally regulated in the same way as the ERM proteins (5). In its dormant form the molecule undergoes an intramolecular selfassociation between the N-terminal 4.1/JEF domain and the C-terminus (6,7). Binding affinity of the C-terminus to the 4.1/JEF domain fosters the formation of intermolecular interactions leading to both homodimerization between NF2 proteins and heterodimerization between NF2 protein and ERM family members (8). Activation of the small GTPase Rac by growth promoting stimuli has recently been shown to lead to NF2 phosphorylation at serine 518 by the Rac effector kinase PAK2, which is associated with unfolding of the protein and loss of intramolecular self-association (9,10).
The growth suppressive potential of the NF2 tumor suppressor protein has been correlated with the hypophosphorylated wild-type protein undergoing intramolecular head to tail binding (11). This is the predominant form of NF2 found in culture under conditions of growth arrest and contact inhibition, which is localized at the interface between the plasma membrane and the cytoskeleton (12,13,14). In this realm the NF2 protein interacts with several binding partners comprising transmembraneous membrane proteins, cytoskeletal elements and endosomal proteins: CD44, ß1-integrin, ßII-spectrin, actin, syntenin, SCHIP-1, NHE-RF, Rho-GDI and hepatocyte growth factor-regulated tyrosine kinase substrate (HRS) (2,13,1523). Overexpression of merlin is able to inhibit Rac mediated signaling, which is believed to be essential for the metastasis and tumor suppressive potential of NF2 (9). By yeast two-hybrid analysis HRS has been identified as an NF2 binding protein (23). HRS stimulates formation of early endosomes and sorting of activated tyrosine kinase receptors into multivesicular bodies for subsequent degradation in lysosomes. In Drosophila mutant HRS is associated with inability to limit signaling induced by the activated tyrosine kinase receptors, i.e. epidermal growth factor receptor and torso (24). HRS furthermore binds to STAM, a protein implicated in the suppression of cytokineinduced cell growth (25,26). Therefore, in addition to its inhibitory effect on activated Rac NF2 protein binding to HRS provides an alternative pathway explaining its tumor suppressive effect.
The NF2 gene is subject to alternative splicing (2732). The two most commonly occurring isoforms differ in the C-terminus of the protein. Isoform I (wild-type protein) correlates with the longest and predominant splice form and consists of exons 117 with splicing out of exon 16. Isoform II retains exon 16 resulting in a frameshift and premature stop and consequently in a shortened protein with an altered C-terminus. Recently novel full-length NF2 isoforms have been described with splicing out of more exons, which are targeted subcellularly to cytoplasmic granules or the cell nucleus (32). Nuclear localization of NF2 as indicated by the novel isoforms is, however, interesting, as it might implicate an additional functional role in this compartment. Matching the exon composition of the isoforms with their subcellular localization we hypothesized that splicing out of exons 2 and/or 3 is a decisive step for entry into the nuclear compartment. This is reminiscent of the prototypical member of the 4.1 superfamily the erythrocyte band 4.1 protein. For the band 4.1 it has been reported that alternative splicing events regulate nuclear localization (33,34). Nuclear occurring band 4.1 protein is known to be a component of nuclear speckled domains and to associate with pre-mRNA splicing factors (35,36). One of the splicing events contributing to nuclear localization of band 4.1 is skipping of exon 5 (34). Stimulated by potential splicing events in the 4.1/JEF domain leading to nuclear NF2 localization and a similar and already proven mechanism in the related band 4.1 protein we set out to investigate in more detail the mechanisms determining entry of NF2 into the cell nuclear compartment.
| RESULTS |
|---|
|
|
|---|
Sequence alignment of exon 5 band 4.1 to NF2 protein
The amino acid sequence of exon 5 of the band 4.1 protein was aligned to the NF2 protein using the ClustalX (37) program in order to identify the homologous region within the NF2 protein (Fig. 1). Band 4.1 exon 5 is one of the exons coding for the 4.1/JEF domain of the protein 4.1 (exons 411) and, therefore, could be expected to be homologous to a segment of the NF2 4.1/JEF domain. The highest degree of homology was found to a region spanning residues 3964 of the NF2 protein. Residues 3980 of the NF2 protein are encoded by exon 2. NF2 exon 2 and band 4.1 exon 5, therefore, encode a homologous section of the 4.1/JEF domain. Although NF2 exon 2 is longer compared to band 4.1 exon 5, the amino acid segment encoded by both exons starts at exactly the same point within the 4.1/JEF domain, which is 18 residues after the beginning of the 4.1/JEF domain in both proteins (Fig. 1) (38,39). The crystal structure of the 4.1/JEF domain of both proteins has recently been resolved (38,39). NF2 exon 2 and band 4.1 exon 5 could, therefore, be compared to each other in their respective 3D conformation. In both proteins it was found to code for a comparable
-helix within the 4.1/JEF domain.
|
Deletion of exon 2 promotes nuclear transfer of NF2
In order to evaluate the effect of the deletion of NF2 exons 2 and 3 on nuclear localization, artificial NF2 deletion constructs identical to known splice variants were generated comprising the full-length wild-type sequence with deletion of either exon 2, or exon 3, or both (Fig. 2). Additionally a deletion construct of exon 2 was created of the NF2 isoform II. All constructs were epitope-tagged at the protein C-terminus for subsequent immunohistochemical localization. For the exon 3 deletion construct NF2Del3 an additional N-terminal HA-epitope-tagged variant was generated and its subcellular localization compared to the C-terminally tagged construct. No difference in subcellular localization could be found between the two constructs, as has already been shown for numerous NF2 constructs in other studies (2,14,4044). An inducible eukaryotic expression system was used for transient transfection into NIH3T3 cells and gene expression. Seven hours after induction of gene expression the cells were fixed and processed for immunohistochemistry. As a control an epitope-tagged wild-type NF2 construct was included in the study.
|
In accordance with previous studies the wild-type NF2 protein was found closely associated with the plasma membrane. Intense immunofluorescence was characteristically found to be homogeneously spread over the entire cell surface including all filopodial protrusions (Fig. 3A). Wild-type NF2 transfected cells clearly displayed an activated phenotype with numerous cell elongations and filopodial extensions. In sharp contrast, deletion of either exon 2, 3 or both exons 2 and 3 had a profound effect on the subcellular localization of the constructs compared to the wild-type NF2 protein. Uniformly, all deletion constructs characteristically exhibited a punctuate or granular staining (Fig. 3BE). The labeled granules tended not to be clustered around a specific cellular structure but were found diffusely spread over the entire cell area. Often the staining was observed close to the cell margin or near ruffling membranes (Fig. 3B and D). In order to identify the subcellular compartment of granular staining, double labeling was performed by phalloidin staining of the actin cytoskeleton. By confocal laser scanning microscopy it was determined that the labeled granules were localized at the actin rich cellular cortex but not in the interior of the cytoplasm (Fig. 3K).
|
For all constructs including the wild-type control a variable subset of transfected cells was observed with positive staining in the cell nucleus. The labeling was seen within the nucleoplasm with the exception of the nucleoli. The immunofluorescence intensity of nuclear versus cytoplasmic staining was variable with cells exhibiting labeling in both compartments and cells expressing besides intense nuclear fluorescence almost no residual cytoplasmic staining (Fig. 3FJ). Nuclear staining in a cell did not depend on the overall intensity of immunofluorescence staining in that particular cell, indicating that the expression level within a cell did not influence the subcellular localization, i.e., cytoplasmic versus nuclear. For each deletion construct the number of transfected cells with positive nuclear fluorescence was determined (Fig. 4). Transfection experiments and subsequent immunofluorescence staining were done in parallel for the different NF2 constructs in order to ensure comparability. For each construct a comparable number of positively transfected cells was found and a few hundred positive cells were counted from independent experiments per deletion construct. It became evident that cells expressing the wild-type or NF2Del3 deletion construct only rarely displayed positive nuclear fluorescence (2% and 3%, respectively). Furthermore all constructs deleted of exon 2 (NF2Del2, NF2Del2II, NF2Del2+3) had consistently in all experiments a slight increase in the number of cells with positive nuclear labeling (68%). Therefore, deletion of exon 2 led to a slightly increased nuclear localization of the NF2 protein. We furthermore investigated whether the counts for positive nuclear localization were low because of concomitantly occurring nuclear export. Many proteins are known to be subject not only to nuclear import but also to nuclear export while the export rate overcomes the import rate. The best known mechanism of nuclear export is mediated by the protein CRM1/exportin. CRM1 transports proteins out of the nucleus by binding to a leucine-rich nuclear export signal (NES) (45). Leptomycin B is a specific inhibitor of CMR1/exportin and blocks CMR1-dependent nuclear export (46). To unmask a potential effect of nuclear export on the NF2 protein, the cultures were incubated with leptomycin B. After 2 h of incubation a small increase in nuclear localization was observed for the NF2 wild-type and NF2Del3 construct (7% and 10%). In marked contrast all constructs deleted of exon 2 showed a dramatically increased percentage of cells with prominent nuclear staining (7795%) (Fig. 4). We concluded, that merlin is subject to CRM1-dependent nuclear export. After inhibition of leptomycin B sensitive nuclear export, NF2 constructs lacking exon 2 accumulated in the cell nucleus, whereas NF2 wild-type and NF2 lacking exon 3 were found in the cell nucleus still at a low but slightly increased percentage. Furthermore it became evident that under normal cell culture conditions the nuclear export rate of merlin beats the import rate.
|
Exon 2 encoded residues promote cytoplasmic retention
In order to gain insight into the mechanism of exon 2 domain inhibiting nuclear accumulation of the NF2 protein, a fusion protein GFPex2 was created comprising NF2 exon 2 fused to the N-terminus of green fluorescent protein (GFP). As a control, an exon 3 GFP fusion protein GFPex3 was used. Both constructs were expressed in NIH3T3 cells and their subcellular localization studied. GFPex2 was found to be located in a tubular cytoplasmic compartment, which characteristically encircled the cell nucleus. Only a faint staining of the cell nucleus was identified in cells with a high transfection rate (Fig. 5A). In contrast the GFPex3 construct was always found to occur inside the cell nucleus in conjunction with a diffuse homogeneous cytoplasmic fluorescence. Incubation with leptomycin B did not influence the subcellular localization of any of the two constructs. Because of its small size GFP alone is able to passively diffuse through the nuclear pore complex. Fusion of exon 3 to GFP was not found to impede this nuclear transfer. Since the length of exon 2 and 3 differs by a single amino acid, restriction of nuclear entry by inhibition of passive diffusion of GFPex2 could be ruled out as a reason for the cytoplasmic retention. Moreover exon 2 encoded residues redirected the GFP from its normal diffuse cytoplasmic distribution to a specific membrane bound intracellular compartment.
|
Nuclear export signal of the NF2 protein maps to exon 15
The CRM1-dependent NES has been well characterized in a number of different proteins. The NES is known to contain a core of hydrophobic residues put into proper sequence context by the surrounding residues (45). A search for potential NESs within the NF2 protein using known NES consensus sequences (LX13LX23LXL) identified potential sites in exons 2 (aa 4656), exon 3 (aa 109120), exon 8 (aa 223241), exon 9/10 (aa 290299), exon 10 (aa 296301) and 15 (aa 535551). Existence of a leptomycin B-sensitive NES in exon 2 or 3 was ruled out because leptomycin B had no effect on the subcellular localization of GFPex2 and GFPex3. The potential site within exon 15 best matched the published consensus sequence for a leptomycin B-sensitive NES. To demonstrate a functional NES in the NF2 C-terminus, the C-terminal ends of NF2 fused to GFP have been stepwise shortened (see Fig. 2). All three constructs were expressed in NIH3T3 cells and their subcellular localization determined in the absence and presence of leptomycin B (Figs 6 and 7). The GFPex917 and GFPex915l constructs were found to be homogeneously spread in the cytoplasm without leptomycin B incubation. Both constructs were found in the cell nucleus only in a small subset of cells (<13%). After 2 h incubation with leptomycin B, however, the number of cells with nuclear staining reached 99%. This proved the functional significance of the CRM1-dependent NES consensus sequence within NF2 amino acids 535551 (Fig. 8). In contrast the GFPex915s construct was found to be diffusely distributed in the cytoplasm and nucleus of all cells. Incubation with leptomycin B apparently had no effect on the subcellular localization of the GFPex915s construct. This excluded the presence of a CRM1-dependent NES in this construct of sufficient strength to exclude the protein from the nucleus. Therefore, it became evident, that only the critical domain between amino acids 535551 is responsible for the exclusion of NF2 wild-type and all constructs deleted of exon 2 from the nucleus under normal cell culture conditions. As re-import back into the nucleus was not inhibited during leptomycin B incubation by the experimental setup the NES within exon15 was considered to be a strong one. To prove the functionality of the NES within the context of the entire protein and to exclude a potential unspecific effect due to leptomycin B treatment itself two more NF2 deletion constructs were created: NF2Del15 comprising the NF2 wild-type sequence with a deletion spanning the NES within exon 15 and NF2Del2+15 with an additional deletion of exon 2 encoded residues. Subcellular localization of NF2Del15 was found to be indistinguishable from the wild-type protein, i.e., the protein was found at the plasma membrane and in filopodial extensions (Figs 6G and 7). Nuclear localization was seen in a small percentage of cells (5%) comparable to wild-type protein after treatment with leptomycin B. The NF2Del2+15 construct, however, was observed in the cell nucleus in almost all cells (95%) (Figs 6H and 7). Therefore, it was comparable to all constructs deleted of exon 2 (NF2Del2, NF2Del2II, NFDel2+3) in the presence of leptomycin B.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
Many classical tumor suppressor proteins are known transcriptional regulators and germline mutations of their genes predisposes to cancer syndromes (47). A subset of these tumor suppressor proteins like the adenomatous polyposis coli (APC) protein or E-cadherin are constituents of larger multimeric protein complexes for cellcell or cellmatrix adhesion (48,49). Despite their localization at the plasma membrane, these tumor suppressor proteins have an additional function in linking changes in cell adhesion to alterations in nuclear gene transcription. APC is able to enter the cell nucleus and this ability is critical for its tumor suppressor function (50). The NF2 tumor suppressor protein has not been regarded as a protein entering the cell nucleus and, therefore, a direct impingement on gene transcription has been ruled out. However, this prevailing opinion is largely based on wild-type or isoform II constructs expressed transiently in cell lines (2,14,32,43,44). In contrast, the subcellular localization of endogenous NF2 is more complex, as it has been described not only at plasma membrane specializations but additionally in cytoplasmic compartments (23,51,52). A hint about nuclear localization of endogenous NF2 has been provided in a single report by Scoles et al. (16) using an antibody raised against the C-terminus of the protein. In the present study the NF2 wild-type protein was found at the plasma membrane as reported in previous studies. Close examination, however, revealed the NF2 wild-type protein within the cell nucleus in a small percentage of transfected cells. A slightly increased percentage was observed after incubation with leptomycin B. This seemed not to be an unspecific effect of leptomycin B treatment, since a similar percentage of cells with nuclear staining was found for the wild-type protein treated with leptomycin B (7%) and for the NF2Del15 construct (5%). NF2Del15 corresponds to the wild-type protein lacking the CRM1 recognition sequence and thus, leptomycin B is not required to study its localization unchanged by concomitant nuclear export. This indicated that the NF2 wild-type protein is subject to CRM1-dependent nuclear export. Interpretation of nuclear export of wild-type protein was difficult due to its low prevalence in this compartment. It became evident, however, that under normal cell culture conditions nuclear localization is determined by its import, but not export rate. Due to merlin's high molecular weight of about 70 kD a passive diffusion of merlin into the nucleus is impossible and, thus, an active transport mechanism across the nuclear membrane is required. Many transcription factors need an activation step i.e., phosphorylation for transport into the nucleus, which might have been missing for the NF2 protein under the cell culture conditions prevailing during the experiments (53). A likely activation mechanism for merlin's nuclear import could be unfolding of the protein and loss of head to tail binding in response to phosphorylation of the protein (9,10).
In sharp contrast, deletion of exon 2 of the wild-type protein led to nuclear localization in almost all cells. This effect, however, had to be unmasked by inhibition of CRM1-dependent nuclear export either by leptomycin B treatment or by deleting the NES sequence in exon 15. The cellular localization and leptomycin B sensitivity of NF2Del2II was identical to that of NF2Del2 indicating that the shortened and more hydrophilic C-terminus of isoform II did not influence entry into the cell nucleus or the biological activity of the NES. Thus, the data reveal a specific effect of exon 2 in preventing NF2 protein from gaining access to the cell nucleus. Misfolding of the protein as a consequence of deletion of a part of the 4.1/JEF domain seems an unlikely explanation for the nuclear uptake, as deletion of exon 3, which is likely to lead to a change in conformation of the 4.1/JEF domain as well (comparable in size to exon 2), did not promote nuclear uptake. The role of exon 2 in promoting nuclear localization might rather be explained by its effect of functioning as a cytoplasmic anchor. Exon 2 encoded residues were sufficient to shift GFP from its regular diffuse nuclear and cytoplasmic localization to a single membrane bound cytoplasmic compartment closely resembling the endoplasmic reticulum. Localization of endogenous NF2 protein in a similar compartment has been described in NIH3T3 cells (52). Therefore, the regulation of nuclear localization by splicing out of a specific section of the 4.1/JEF domain, which per se is able to confer sole cytoplasmic localization to a nuclear reporter protein, appears to be conserved between NF2 protein and band 4.1 and might apply to more of the 129 proteins containing a 4.1/JEF domain. Similar to NF2 exon 2, band 4.1 exon 5 has an inhibitory effect on nuclear targeting and is able to re-direct a fusion protein destined for nuclear entry to the cytoplasm (34). The underlying mechanism remains to be elucidated.
In Drosophila the protein scribbler has been identified as a novel NF2 interacting protein. Scribbler is a nuclear protein with a zinc finger domain and potential transcriptional regulator. The authors could not explain how scribbler interacts with the Drosophila NF2 homologue, since Dmerlin is localized at the plasma membrane in Drosophila as well (54). Our results show nuclear accumulation of NF2 isoforms lacking exon 2 provided that the NES is inhibited or deleted. Potential interacting partners of merlin in the cell nucleus might, therefore, be suggested as well as a functional role of merlin in the regulation of transcription.
The results of a transgenic mouse model might lead the way to a functional interpretation of NF2 isoforms lacking exon 2. Transgenic mice expressing an exon 2+3 deletion construct identical to NF2Del2+3 of the present study developed schwannomas typical to human disease despite unhindered expression of endogenous intact NF2 protein (55). This can only be explained by a dominant-negative or oncogenic potential of NF2 protein lacking exons 2+3. By our current knowledge few data would support the notion of a dominant-negative effect. NF2 lacking exons 2+3 does not homodimerize and with the exception of SCHIP-1 does not interact with known NF2 binding partners (56). Rather it is more likely, that the effect of NF2 lacking exon 2 in promoting Schwann cell proliferation is correlated to its function as a nuclear or nuclearcytoplasmic shuttle protein.
The biological significance of exon 2 and 15 encoded amino acids is reflected by the distribution and frequency of NF2 missense mutations. Analyzing disease-causing mutations in the NF2 gene, it became evident that missense mutations occur at an extremely low frequency. Strikingly, in a total number of 457 NF2 mutations, there are only 21 unique missense mutations, which corresponds to an incidence of 4.6% (5767). This is in contrast to most other genes, e.g., the CFTR gene with a proportion of 47.5% missense mutations. Of a total number of 27 927 mutations in 1163 genes submitted to the Human Gene Mutation Database Cardiff (http://archive.uwcm.ac.uk/uwcm/mg/docs/hahaha.html) 12 528 represent missense mutations (44.9%). Plotting the codon position of germline and somatic NF2 missense mutations and correlating to NF2 exons a nonrandom distribution became evident. Of all reported missense mutations, 52.4% were found to belong to exons 2 and 15 (23.8% and 28.6% respectively), whereas the percentage of the remaining exons varied from 0 to 14.3%. So far two of the reported missense mutations (L539H, L542H) (61,67) alter the hitherto identified NES sequence involving the first/second leucine of the NES consensus sequence LX13LX23LXL. The biological significance of an amino acid substitution at the first/second hydrophobic key residue of the NES has been shown for the c-ABL protein to result in dramatic reduction to one third or a total loss of nuclear export activity, respectively (45). The vast majority of NF2 mutations, however, represent truncating mutations. A plot of NF2 truncating mutations revealed their codon positions upstream of the NES sequence in exon 15. The most 3' truncating mutation reported maps to codon 538 immediately at the 5' border of the NES signal. A similar frequency distribution of truncating mutations with an abrupt 3' border immediately upstream of a functional NES has been reported for the APC tumor suppressor protein. Almost all APC mutations are truncations and with rare exceptions occur 5' to a functional NES in the C-terminus of the protein. For the APC gene product it has been shown that this strong selective pressure against the presence of the NES in colon cancer cells is linked to the ability of the normal protein to regulate cell proliferation (50).
The NF2 constructs used in our study correspond to physiologically expressed NF2 protein isoforms. A study concentrating on full-length NF2 isoforms identified alternative in-frame splicing of exon 2 and exon 2+3 in 6% and 4%, respectively (31). Skipping of exon 2, 3, 2+3, are common splicing events and have been found in normal leptomeningeal tissue, human brain and in a human tissue panel (2831). However, transcripts lacking exon 2+3 have often been regarded as mutant proteins (2,55). This view may result from the fact that the transcript lacking exon 2 was first identified in vestibular schwannomas and subsequently was found in many tumor tissues including brain tumors of different histological origin, breast cancer, colon cancer and Ewing sarcoma cell lines (2730). Furthermore, experimental studies showed that NF2 lacking exons 2 and 3 behaved abnormally compared to the wild-type protein. Deletion of exons 2+3 leads to a conformational change of the molecule as determined by altered chymotrypsin resistance, loss of normal head to tail binding and inability to confer an anti-proliferative effect in cell cultures (2,11,56). In analogy to the band 4.1 protein it is likely that splice variants lacking exon 2 indicate a novel nuclear function of the protein.
There are well known examples of proteins, i.e. BRCA1, showing completely different localization in the cytoplasm versus nucleus between tumors and normal tissue. Thus distinct localization in tumor cells has at first been regarded as aberrant and disease-causing (68). In the case of BRCA1, subsequent research discovered the aberrant localization to be present in a subset of healthy cells as well. The controversy was later resolved by identification of splice variants resulting in different subcellular localization. It was found that the disease mechanism is not due to aberrant localization but different relative expression levels of isoforms between tumor and healthy tissues (69). Tissue integrity, therefore, is dependent on the balanced expression level of different isoforms in a tissue- and development specific pattern.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Clones and Plasmids
The NF2 deletion constructs were created using the PCR megaprimer method (70). NF2 full-length cDNA isolated as described previously (32) was used as template. The chimeric primer sequences for the NF2Del2, NF2Del3, and NF2Del2+3 constructs were CTTTGAAACATC ATGATCCAGTACCTCGCAATTGAACTCCATCTC, CATCTAAAATCTGCTTCTTTACCTTCTTGTCCATTTT GAGCCAG, and CATCTAAAATCTGCTTCTTTACCTCGC AATTGAACTCCATCT, respectively. The chimeric primer for NES deletion was CAGAATATCCAGAGCTGTC TCCTCCACAATGAGAACTCCGACAGGGGT. NF2Del2II was created by using a human adult liver cDNA (Clontech, Heidelberg, Germany, MTC panel, K1420-1) as template. The PCR yielded a product corresponding to the NF2 isoform II sequence with a 45 bp insertion between exon 16 and 17, which proved identical to a segment of the intron 16 sequence. The 6xHis-epitope is included in all reverse primers with the exception of the NF2Del2II construct, which is tagged by the HA-epitope (YPYDVPDYA). All PCR products were cloned into the pcDNA3.1D directional Topo cloning vector (Invitrogen, Groningen, The Netherlands) and then subcloned into the pGene/V5-His A vector of the GeneSwitch (Invitrogen) mifepristone-inducible eukaryotic expression system as KpnI/AgeI restriction fragments. The NF2 wild-type sequence was transferred to the pGene/V5-His A vector as HA-epitope-tagged construct as well. Fusion proteins GFPex2 and GFPex3 were created by PCR amplification of exon 2 and 3 using primer pairs ACGATGGAGATGAAGTGGAAAGGGAAGGAC/CCTTCTTGTCCATTTTGAGCC and ACGATGGAGGTACTGGATCATGATGTTTCA/CCTGTAAGAAGAATAAATGTTG and ligation into the pcDNA3.1/CT-GFP-TOPO vector (Invitrogen). For the N-terminal GFP fusion proteins TTTACTATTAAACC ACTGGATAAGAAAATT was used as 5' primer in combination with 3' primers CTAATGCTTGCTCTTTTCCATGTATTC, CTACAGAATATCCAGAGCTGTCTC and CTAGAGCTCTTCAAAGAAGGCCAC for the GFPex115 s, GFPex115l and GFP117 construct, respectively. PCR products were ligated into the pcDNA3.1/NT-GFP-TOPO vector (Invitrogen).
Cell Culture and Transfection
NIH3T3 cells (DSMZ ACC 59) obtained from the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany) were maintained in Dulbecco's modified Eagle's medium supplemented with 10% heat-inactivated fetal bovine serum (PAA-Biologics, GmbH, Marburg, Germany), 100 U/ml penicillin and 100 µg/ml streptomycin. Cells were incubated at 37°C in an atmosphere of 5% CO2 in Corning tissue culture flasks. Cells were routinely subcultured before reaching confluency. For transfection experiments cells were seeded onto Nunc chamber slides (Nunc, Naperville, IL USA) and allowed to attach for 4 h. As transfecting agent the FuGene reagent (Roche, Mannheim, Germany) was used according to the manufacturer's instructions. Purified plasmids for expression of the GFP fusion proteins were added at 1 µg per well. After 24 h cells were fixed and processed for immunofluorescence. Constructs cloned into the pGene/V5-His A inducible vector were co-transfected at a ratio of 3:1 together with the pSwitch vector (Invitrogen) coding for the GeneSwitch GAL4-DBD/hPR-LBD/p65-AD regulatory protein. After 1620 h gene expression was induced by adding fresh medium containing 1x10-8 M mifepristone. Cells were incubated for an additional period of 7 h and subsequently fixed and processed for immunofluorescence. For experiments requiring inhibition of CRM1-dependent nuclear export leptomycin B (Sigma-Aldrich, Deisenhofen, Germany) was added at a concentration of 10 ng/ml 2 h prior to fixation.
Immunofluorescence and confocal laser scanning microscopy
NIH3T3 fibroblast cultures were fixed by adding an equal amount of freshly prepared 3% paraformaldehyde in 80 mM KPIPES (pH 6.9) (Sigma-Aldrich) supplemented with 5 mM EGTA and 2 mM MgCl2 to the culture medium for 30 min. Cells were quenched for 15 min in freshly prepared NaBH4 (0.5 mg/ml) (Fluka, Buchs, Switzerland) in PBS, pH 7.4, and after washing with PBS, they were permeabilized for 5 min in 0.1% Triton X-100 in PBS. After incubation in PBS plus 5% normal donkey serum, the slides were washed and incubated with the primary antibody in PBS including 0.2% bovine serum albumin (PBS-BSA). For the detection of the 6xHis or HA epitope mouse monoclonal antibodies (Roche) were used in a 1:200 dilution. After a washing step in PBS the slides were incubated with biotinylated donkey anti mouse antiserum in a 1:200 dilution in PBS-BSA (Jackson Laboratories, Dianova, Hamburg, Germany). The biotin was subsequently visualized by streptavidin-Alexa 488 conjugate (Molecular Probes, Leiden, The Netherlands) diluted 1:500 in PBS-BSA in a third step. For the visualization of the actin cytoskeleton Alexa-568 phalloidin was included in the last incubation step in a 1 : 50 dilution. The GFP fusion proteins were detected by a rabbit antiserum (Molecular Probes) followed by a donkey anti rabbit Cy3 secondary antibody. Slides were mounted in Pro-long antifade reagent (Molecular Probes) or Vectashield (Vector Laboratories, Linaris, Wertheim-Bettingen, Germany) and examined by confocal laser scanning microscopy.
| ACKNOWLEDGEMENT |
|---|
This study was supported by Deutsche Forschungsgemeinschaft (Grant number: KR1665/3-1). The authors would also like to thank Prof. Dr med. W.L. Neuhuber, the head of the Institute of Anatomy, for his support for this study.
| FOOTNOTES |
|---|
* To whom correspondence should be addressed at: Institute of Anatomy I, University of Erlangen, Krankenhausstr. 9, D-91054 Erlangen, Germany. Email: michael.kressel{at}rzmail.uni-erlangen.de
| REFERENCES |
|---|
|
|
|---|
1 Gutmann, D.H. (2001) The neurofibromatoses: when less is more. Hum. Mol. Genet., 10, 747755.
2 Brault, E., Gautreau, A., Lamarine, M., Callebaut, I., Thomas, G. and Goutebroze, L. (2001) Normal membrane localization and actin association of the NF2 tumor suppressor protein are dependent on folding of its N-terminal domain. J. Cell Sci., 114, 19011912.[Abstract]
3 Girault, J.A., Labesse, G., Mornon, J.P. and Callebaut, I. (1999) Janus kinases and focal adhesion kinases play in the 4.1 band: a superfamily of band 4.1 domains important for cell structure and signal transduction. Mol. Med., 4, 751769.
4 Bretscher, A., Chambers, D., Nguyen, R. and Reczek, D. (2000) ERM-Merlin and EBP50 protein families in plasma membrane organization and function. Ann. Rev. Cell Dev. Biol., 16, 113143.[Web of Science][Medline]
5 Pearson, M.A., Reczek, D., Bretscher, A. and Karplus P.A. (2000) Structure of the ERM protein moesin reveals the FERM domain fold masked by an extended acting binding tail domain. Cell, 101, 259270.[Web of Science][Medline]
6 Huang, L., Ichimaru, E., Pestonjamasp, K., Cui, X., Nakamura, H., Lo, G.Y.H., Lin, F.I.K., Luna, E.J. and Furthmayr, H. (1998) Merlin differs from moesin in binding to Factin and in its intra- and intermolecular interactions. Biochem. Biophys. Res. Commun., 248, 548553.[Web of Science][Medline]
7
Gonzalez-Agosti, C., Wiederhold, T., Herndon, M.E., Gusella, J. and Ramesh, V. (1999) Interdomain interaction of merlin isoforms and its influence on intermolecular binding to NHE-RF. J. Biol. Chem., 274, 3443834442.
8
Nguyen, R., Reczek, D. and Bretscher, A. (2001) Hierarchy of merlin and ezrin N- and C-terminal domain interactions in homo- and heterotypic associations and their relationship to binding of scaffolding proteins EBP50 and E3KARP. J. Biol. Chem., 276, 76217629.
9 Shaw, R.J., Paez, J.G., Curto, M., Yaktine, A., Pruitt, W.M., Saotome, I., O'Bryan, J.P., Gupta, V., Ratner, N., Der, J. et al. (2001) The NF2 tumor suppressor, merlin, functions in Rac-dependent signaling. Dev. Cell, 1, 6372.[Web of Science][Medline]
10
Kissil, J.L., Johnson, K.C., Eckman, M.S. and Jacks, T. (2002) Merlin phosphorylation by p21-activated kinase 2 and effects of phosphorylation on merlin localization. J. Biol. Chem., 277, 1039410399.
11 Sherman, L., Xu, H.M., Geist, R.T., Saporito-Irwin, S., Howells, N., Ponta, H., Herrlich, P. and Gutmann, D.H. (1997) Interdomain binding mediates tumor growth suppression by the NF2 gene product. Oncogene, 15, 25052509.[Web of Science][Medline]
12
Shaw, R.J., McClatchey A.I. and Jacks T. (1998) Regulation of the neurofibromatosis type 2 tumor suppressor protein, merlin, by adhesion and growth arrest stimuli. J. Biol. Chem., 273, 77577764.
13
Morrison, H., Sherman, L.S., Legg, J., Banine, F., Isacke, C., Haipek, C.A., Gutmann, D.H., Ponta, H. and Herrlich P. (2001) The NF2 tumor suppressor gene product, merlin, mediates contact inhibition of growth through interactions with CD44. Genes Dev., 15, 968980.
14
Schulze, K.M.M., Hanemann, C.O., Müller, H.W. and Hanenberg, H. (2002) Transduction of wild-type merlin into human schwannoma cells decreases schwannoma cell growth and induces apoptosis. Hum. Mol. Genet., 11, 6976.
15 Obremski, V.J., Hall, A.M. and Fernandez-Valle, C. (1998) Merlin, the neurofibromatosis type 2 gene product, beta 1 integrin associate in isolated and differentiating Schwann cells. J. Neurobiol., 37, 487501.[Web of Science][Medline]
16 Scoles, D.R., Huynh, D.P., Morcos, P.A., Coulsell, E.R., Robinson, N.G.G., Tamanoi, F. and Pulst, S. (1998) Neurofibromatosis 2 tumour suppressor schwannomin interacts with ßII-spectrin. Nat. Genet., 18, 354359.[Web of Science][Medline]
17 Neill, G.W. and Crompton, M.R. (2001) Binding of the merlin-I product of the neurofibromatosis type 2 tumour suppressor gene to a novel site in ß-fodrin is regulated by association between merlin domains. Biochem. J., 358, 727735.[Web of Science][Medline]
18 James, M.F., Manchanda, N., Gonzalez-Agosti, C., Hartwig, J.H. and Ramesh, V. (2001) The neurofibromatosis 2 protein merlin selectively binds F-actin but not G-actin and stabilizes the filaments through a lateral association. Biochem. J., 356, 377386.[Web of Science][Medline]
19
Jannatipour, M., Dion, P., Khan, S., Jindal, H., Fan, X., Laganiere, J., Chishti, A.H. and Rouleau, G.A. (2001) Schwannomin isoform-1 interacts with syntenin via PDZ domains. J. Biol. Chem., 276, 3309333100.
20
Goutebroze, L., Brault, E., Muchardt, C., Camonis, J. and Thomas, G. (2000) Cloning and characterization of SCHP-1, a novel protein interacting specifically with spliced isoforms and naturally occurring mutant NF2 proteins. Mol. Cell. Biol., 20, 16991712.
21
Murthy, A., Gonzalez-Agosti, C., Cordero, E., Pinney, D., Candia, C., Solomon, F., Gusella, J. and Ramesh, V. (1998) NHE-RF, a regulatory cofactor for Na+H+ exchange, is a common interactor for merlin and ERM (MERM) proteins. J. Biol. Chem., 273, 12731276.
22 Maeda, M., Matsui, T., Imamura, M., Tsukita, S. and Tsukita, S. (1999) Expression level, subcellular distribution and Rho-GDI binding affinity of merlin in comparison with ezrin/radixin/moesin proteins. Oncogene, 18, 47884797.[Web of Science][Medline]
23 Scoles, D.R., Huynh, D.P., Chen, M.S., Burke, S.P., Gutmann, D.H. and Pulst, S.M. (2000) The neurofibromatosis 2 tumor suppressor protein interacts with hepatocyte growth factor-regulated tyrosine kinase substrate. Hum. Mol. Genet., 9, 11671574.
24 Lloyd, T.E., Atkinson, R., Wu, M.N., Zhou, Y., Pennetta, G. and Bellen, H.J. (2002) Hrs regulates endosome membrane invagination and tyrosine kinase receptor signaling in Drosophila. Cell, 108, 261269.[Web of Science][Medline]
25
Asao, H., Sasaki, Y., Arita, T., Tanaka, N., Endo, K., Kasai, H., Takeshita, T., Endo, Y., Fujita, T. and Sugamura, K. (1997) Hrs is associated with STAM, a signal-transducing adaptor molecule. Its suppressive effect on cytokineinduced cell growth. J. Biol. Chem., 272, 3278532791.
26
Gutmann, D.H., Haipek, C.A., Burke, S.P., Sun, C.X., Scoles, D.R. and Pulst, S.M. (2001) The NF2 interactor, hepatocyte growth factor-regulated tyrosine kinase substrate (HRS), associates with merlin in the open conformation and suppresses cell growth and motility. Hum. Mol. Genet., 10, 825834.
27 Bianchi, A.B., Hara, T., Ramesh, V., Gao, J., Klein-Szanto, A.J.P., Morin, F., Menon, A.G., Trofatter, J.A., Gusella, J.F., Seizinger, B.R. and Kley, N. (1994) Mutations in transcript isoforms of the neurofibromatosis 2 gene in multiple human tumor types. Nature Genet., 6, 185192.[Web of Science][Medline]
28
Pykett, M.J., Murphy, M., Harnish, P.R. and George, D.L. (1994) The neurofibromatosis type 2 tumor suppressor gene encodes multiple alternatively spliced transcripts. Hum. Mol. Genet., 3, 559564.
29
Arakawa, H., Hayashi, N., Nagase, H., Ogawa, M. and Nakamura, Y. (1994) Alternative splicing of the NF2 gene and its mutation analysis of breast and colorectal cancers. Hum. Mol. Genet., 3, 565568.
30 Nishi, T., Takeshima, H., Hamada, K., Yoshizato, K., Koga, H., Sato, K., Yamamoto, K., Kitamura, I., Kochi, M., Kuratsu, J. et al. (1997) Neurofibromatosis 2 gene has novel alternative splicings which controls intracellular protein binding. Int. J. Oncol., 10, 10251029.
31 Chang, L.S., Akhmametyeva, E.M., Wu, Y., Zhu, L. and Welling, B. (2002) Multiple transcription initiation sites, alternative splicing, and differential polyadenylation contributes to the complexity of human neurofibromatosis 2 transcripts. Genomics, 79, 6376.[Web of Science][Medline]
32
Schmucker, B., Tang, Y. and Kressel, M. (1999) Novel alternatively spliced isoforms of the neurofibromatosis type 2 tumor suppressor are targeted to the nucleus and cytoplasmic granules. Hum. Mol. Genet., 8, 15611570.
33
Luque, C.M., Lallena, M.J., Alonso, M.A. and Correas, I. (1998) An alternative domain determines nuclear localization in multifunctional protein 4.1. J. Biol. Chem., 273, 1164311649.
34 Luque, C.M. and Correas, I. (2000) A constitutive region is responsible for nuclear targeting of 4.1R: modulation by alternative sequences results in differential intracellular localization. J. Cell Sci., 113, 24852495.[Abstract]
35 Lallena, M.J. and Correas, I. (1997) Transcription-dependent redistribution of nuclear protein 4.1 to SC35-enriched nuclear domains. J. Cell Sci., 110, 239247.[Abstract]
36 Lallena, M.J., Martinez, C., Valcarcel, J. and Correas, I. (1998) Functional association of nuclear protein 4.1 with pre-mRNA splicing factors. J. Cell Sci., 111, 19631971.[Abstract]
37 Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F. and Higgins, D.G. (1997) The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res., 24, 48764882.
38 Han, B.G., Nunomura, W., Takakuwa, Y., Mohandas, N. and Jap, B.K. (2000) Protein 4.1 R core domain structure and insights into regulation of cytoskeletal organization. Nat. Struct. Biol., 7, 871875.[Web of Science][Medline]
39
Shimizu, T., Seto, A., Maita, N., Hamada, K., Shoichiro, T., Tsukita, S. and Hakoshima, T. (2001) Structural basis for neurofibromatosis type 2: crystal structure of the merlin FERM domain. J. Biol. Chem., 277, 1033210336.
40 Xu, L., Gonzalez-Agosti, C., Beauchamp, R., Pinney, D., Sterner, C. and Ramesh, V. (1998) Analysis of molecular domains of epitope-tagged merlin isoforms in Cos-7 cells and primary rat schwann cells. Exp. Cell Res., 238, 231240.[Web of Science][Medline]
41 Koga, H., Araki, N., Takeshima, H., Nishi, T., Hirota, T., Kimura, Y., Nakao, M. and Saya, H. (1998) Impairment of cell adhesion by expression of the mutant neurofibromatosis type 2 (NF2) genes which lack exons in the ERM-homology domain. Oncogene, 17, 801810.[Web of Science][Medline]
42 Stokowski, R.P. and Cox D.R. (2000) Functional analysis of the neurofibromatosis type 2 protein by means of disease-causing point mutations. Am. J. Hum. Genet., 66, 873891.[Web of Science][Medline]
43 Shaw, R.J., McClatchey, A.I. and Jacks, T. (1998) Localization and functional domains of the neurofibromatosis type II tumor suppressor, merlin. Cell Growth Differ., 9, 287296.[Abstract]
44
Deguen, B., Merel, P., Goutebroze, L., Giovannini, M., Reggio, H., Arpin, M. and Thomas, G. (1998) Impaired interaction of naturally occuring mutant NF2 protein with actin-based cytoskeleton and membrane. Hum. Mol. Genet., 7, 217226.
45 Henderson, B. and Eleftheriou, A. (2000) A comparison of the activity, sequence specificity, and CRM1-dependence of different nuclear export signals. Exp. Cell Res., 256, 213224.[Web of Science][Medline]
46
Kudo, N., Matsumori, N., Taoka, H., Fujiwara, D., Schreiner, E.P., Wolff, B., Yoshida, M. and Horinouchi, S. (1999) Leptomycin B inactivates CRM1/exportin 1 by covalent modification at a cysteine residue in the central conserved region. Proc. Natl. Acad. Sci., 96, 91129117.
47 Macleod, K. (2000) Tumor suppressor genes. Curr. Opin. Genet. Dev., 10, 8193.[Web of Science][Medline]
48
Mimori-Kiyosue, Y. and Tsukita, S. (2001) Where is APC going? J. Cell Biol., 154, 11051109.
49 Bremnes, R.M., Veve, R., Hirsch, F.R. and Franklin, W.A. (2002) The E-cadherin cell-cell adhesion complex and lung cancer invasion, metastasis, and prognosis. Lung Cancer, 36, 115124.[Web of Science][Medline]
50 Rosin-Arbesfeld, R., Townsley, F. and Bienz, M. (2000) The APC tumour suppressor has a nuclear export function. Nature, 406, 10091012.[Medline]
51 Stemmer-Rachamimov, A.O., Gonzalez-Agosti, C., Xu, L., Burwick, J.A., Beauchamp, R., Pinney, D., Louis, D.N. and Ramesh, V. (1997) Expression of NF2-encoded merlin and related ERM family proteins in the human central nervous system. J. Neuropathol. Exp. Neurol., 56, 735742.[Web of Science][Medline]
52 Schmucker, B., Ballhausen, W.G. and Kressel, M. (1997) Subcellular localization and expression pattern of the neurofibromatosis type 2 protein merlin/schwannomin. Eur. J. Cell Biol., 72, 4653.[Web of Science][Medline]
53
Cyert, M.S. (2001) Regulation of nuclear localization during signaling. J. Biol. Chem., 276, 2080520808.
54
Lajeunesse, D.R., McCartney, B.M. and Fehon, R.G. (2001) A systematic screen for dominant second-site modifiers of merlin/NF2 phenotypes reveals an interaction with blistered/DSRF and scribbler. Genetics, 158, 667679.
55
Giovannini, M., Robanus-Maandag, E., Niwa-Kawakita, M., van der Valk, M., Woodruff, J.M., Goutebroze, L., Merel, P., Berns, A. and Thomas, G. (1999) Schwann cell hyperplasia and tumors in transgenic mice expressing a naturally occurring mutant NF2 protein. Genes Dev., 13, 978986.
56 Gutmann, D.H., Haipek, C.A. and Lu, K.H. (1999) Neurofibromatosis 2 tumor suppressor protein, merlin, forms two functionally important intramolecular associations. J. Neurosci. Res., 58, 706716.[Web of Science][Medline]
57 MacCollin, M., Ramesh, V., Jacoby, L.B., Louis, D.N., Rubio, M.P., Pulaski, K., Trofatter, J.A., Short, M.P., Bove, C., Eldridge, R. and Parry, D.M. (1994) Mutational analysis of patients with neurofibromatosis 2. Am. J. Hum. Genet., 55, 314320.[Web of Science][Medline]
58
Sainz, J., Huynh, D.P., Figueroa, K., Ragge, N.K., Baser, M.E. and Pulst S. (1994) Mutations of the neurofibromatosis type 2 gene and lack of the gene product in vestibular schwannomas. Hum. Mol. Genet., 3, 885891.
59 Merel, P., Hoang-Xuan, K., Sanson, M., BijIsma, E., Rouleau, G., Laurent-Puig, P., Pulst, S., Baser, M., Lenoir, G., Sterkers, J.M. et al. (1995) Screening for germ-line mutations in the NF2 gene. Genes Chromosomes Cancer, 13, 211216.[Web of Science][Medline]
60 Kluwe, L., Bayer, S., Baser, M.E., Hazim, W., Haase, W., Fünsterer, C. and Mautner V. (1996) Identification of NF2 germ-line mutations and comparison with neurofibromatosis 2 phenotypes. Hum. Genet., 98, 534538.[Web of Science][Medline]
61 Welling, D.B., Guida, M., Goll, F., Pearl, D.K., Glasscock, M.E., Pappas, D.G., Linthicum, F.H., Rogers, D. and Prior T.W. (1996) Mutational spectrum in the neurofibromatosis type 2 gene in sporadic and familial schwannomas. Hum. Genet., 98, 189193.[Web of Science][Medline]
62 Jacoby, L.B., MacCollin, M., Barone, R., Ramesh, V. and Gusella, J.F. (1996) Frequency and distribution of NF2 mutations in schwannomas. Genes Chromosomes Cancer, 17, 4555.[Web of Science][Medline]
63 Ruttledge, M.H., Andermann, A.A., Phelan, C.M., Claudio, J.O., Han, F., Chretien, N., Rangaratnam, S., MacCollin, M.M., Short, P., Parry, D. et al. (1996) Type of mutation in the neurofibromatosis type 2 gene (NF2) frequently determines severity of disease. Am. J. Hum. Genet., 59, 331342.[Web of Science][Medline]
64
Evans, D.G.R., Trueman, L., Wallace, A., Collins, S. and Strachan, T. (1998) Genotype/phenotype correlations in type 2 neurofibromatosis (NF2): evidence for more severe disease associated with truncating mutations. J. Med. Genet., 35, 450455.
65 Faudoa, R., Xue, Z., Lee, F., Baser, M.E. and Hung, G. (2000) Detection of novel NF2 mutations by an RNA mismatch cleavage method. Hum. Mutat., 15, 474478.[Web of Science][Medline]
66
Mohyuddin, A., Neary, W.J., Wallace, A., Wu, C.L., Purcell, S., Reid, H., Ramsden, R.T., Read, A., Black, G. and Evans D.G.R. (2002) Molecular genetic analysis of the NF2 gene in young patients with unilateral vestibular schwannomas. J. Med. Genet., 39, 315322.
67 Scoles, D., Chen, M. and Pulst, S. (2002) Effects of NF2 missense mutations on schwannomin interactions. Biochem. Biophys. Res. Comm., 290, 366374.[Web of Science][Medline]
68
Chen, Y., Chen, C.F., Riley, D.J., Allred, D.C., Chen, P.L., vonHoff, D. Osborne, C.K. and Lee, W.H. (1995) Aberrant subcellular localization of BRCA1 in breast cancer. Science, 270, 789791.
69 Wilson, C.A., Payton, M.N., Elliott, G.S., Buaas, F.W., Cajulis, E.E., Grosshans, D., Ramos,L., Reese, D.M., Slamon, D.J. and Calzone, F.J. (1997) Differential subcellular localization, expression and biological toxicity of BRCA1 and the splice variant BRCA1-delta11b. Oncogene, 9, 116.
70 Barik, S. (1997) Mutagenesis and gene fusion by megaprimer PCR. In White,B.A. (ed.), PCR Cloning ProtocolsMethods in Molecular Biology. Humana Press, Totowa, New Jersey, USA, Vol. 67, pp. 173182.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
A. I. McClatchey and M. Giovannini Membrane organization and tumorigenesis--the NF2 tumor suppressor, Merlin Genes & Dev., October 1, 2005; 19(19): 2265 - 2277. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






