| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Human Molecular Genetics, 2002, Vol. 11, No. 19 2341-2346
© 2002 Oxford University Press
Functional substitution for TAFII250 by a retroposed homolog that is expressed in human spermatogenesis
Howard Hughes Medical Institute, Whitehead Institute and Department of Biology, Massachusetts Institute of Technology, 9 Cambridge Center, Cambridge, MA 02142, USA
Received May 28, 2002; Accepted July 15, 2002
DDBJ/EMBL/GenBank accession nos
| ABSTRACT |
|---|
|
|
|---|
TAFII250, the largest subunit of the general transcription factor TFIID, is expressed from the human X chromosome, at least in somatic cells. In male meiosis, however, the sex chromosomes are transcriptionally silenced, while the autosomes remain active. How then are protein-encoding genes transcribed during human male meiosis? Here we present a novel autosomal human gene, TAF1L, which is homologous to TAFII250 and is expressed specifically in the testis, apparently in germ cells. We hypothesize that during male meiosis, transcription of protein-encoding genes relies upon TAF1L as a functional substitute for TAFII250. Like TAFII250, the human TAF1L protein can bind directly to TATA-binding protein, an essential component of TFIID. Most importantly, transfection with human TAF1L rescued the temperature-sensitive lethality of a hamster cell line mutant in TAFII250. TAF1L lacks introns and evidently arose by retroposition of a processed TAFII250 mRNA during primate evolution. The observation that TAF1L can functionally replace TAFII250 provides experimental support for the hypothesis that during male meiosis, autosomes provide cellular functions usually supplied by the X chromosome in somatic cells.
| INTRODUCTION |
|---|
|
|
|---|
In mammalian spermatocytes (male meiotic cells), the activities of autosomal and sex-linked genes differ starkly. The autosomes are transcriptionally active. In contrast, the entireties of the X and Y chromosomes are condensed to form heterochromatin and are segregated into a special nuclear compartment, the XYbody, where Pol II (RNA polymerase II) is absent, as are critical splicing factors. There appears to be no transcription within this sex chromosome compartment (14). (This phenomenon is distinct from somatic X inactivation, which is the silencing of most but not all genes on one of the two X chromosomes in female cells.) In humans, sex chromosome silencing during male meiosis lasts roughly 15 days, during which time ongoing transcription of protein-encoding genes by Pol II is likely required (5). The largest of the essential factors engaged in Pol II transcription is TAFII250, which, paradoxically, is encoded by the mammalian X chromosome (68). Since the TAFII250 gene is transcriptionally inactive, perhaps another protein acts as a substitute in male meiosis. Specifically, we wondered whether the autosomes encode a TAFII250 isoform that enables or modulates Pol II transcription during male meiosis.
| RESULTS |
|---|
|
|
|---|
TAF1L is a retroposed homolog of TAFII250
We examined the human genome, where the availability of extensive draft sequence facilitated an electronic search for TAFII250 homologs (9,10). The TAFII250 gene (also known as TAF1 or CCG1) spans 100 kb on the human X chromosome (68). Within the genome, we identified only one homologous locus, which we named TAF1L. TAF1L is autosomal, residing on chromosome 9. The TAF1L genomic locus exhibits >94% nucleotide identity to TAFII250's 38 exons, but it completely lacks the latter's 37 introns (Fig. 1) and thus spans only 6.5 kb. This suggested that TAF1L is a retroposed derivative of TAFII250.
|
In the human genome, retroposed copies of genes are commonplace, but most are transcriptionally silent pseudogenes whose protein-coding regions have been disrupted by mutation (11). In contrast, we found that TAF1L is transcribed (Fig. 2) and that its protein-coding potential appeared intact. We confirmed this by sequencing TAF1L cDNA clones isolated from a human testis library. The TAF1L cDNA and genomic sequences proved to be co-linear, and the coding region is 96% identical to that found in long TAFII250 transcripts (Fig. 1). [Alternative splice acceptor sites in exon 5 of TAFII250 yield two distinct transcripts, one being 63 nucleotides longer than the other (6).] We concluded that TAF1L was created by reverse transcription and subsequent autosomal integration of a properly spliced TAFII250 transcript. The result is a single-exon gene that encodes an 1826-residue protein with 95% amino acid identity to human TAFII250 (Fig. 1). Interestingly, there is no apparent remnant of a poly(A) tail in the TAF1L gene, as is observed in many but not all retroposons.
|
TAF1L displays testis-specific expression
If TAF1L assumes the role of TAFII250 in human spermatocytes, TAF1L should be transcribed in testes. Indeed, this is the only human organ in which we have detected TAF1L expression (Fig. 2A). More specifically, our model predicts that TAF1L should be expressed in testicular germ cells. Our data suggest that TAF1L expression may be restricted to such cells: TAF1L is transcribed in normal testis but not in testis lacking germ cells (Fig. 2B). (Alternatively, it is formally possible that TAF1L is expressed in the somatic protein of the testis in a germ-cell-dependent manner.) By contrast, the X-linked TAFII250 gene is expressed widely in human somatic tissues, including germ-cell-deficient testis (Fig. 2.).
Ideally, we would test our assumption that the X-linked TAFII250 gene is transcriptionally silenced in male meiotic cells by RNA in situ hybridization on human testis sections. Unfortunately, this experiment is not feasible because of the high nucleotide sequence identity between TAFII250 and TAF1L (96% in the coding region and 94% in the 3'-UTR; Fig. 1). RNA probes of sufficient length to detect these modest-abundance transcripts would likely lack the ability to discriminate between the two genes' transcripts.
TAF1L interacts with human TBP
We then tested whether the TAF1L and TAFII250 proteins share functional characteristics. TAFII250 has been shown to bind directly to TATA-binding protein (TBP) (6,7). To test whether TAF1L protein interacts with TBP, we performed a two-hybrid analysis in yeast cells. We fused the TAF1L protein to the DNA-binding domain of GAL4, and separately we fused human TBP to the activation domain of GAL4. Neither of the two fusion proteins alone activated a GAL4-responsive lacZ reporter gene. In combination, however, the two fusion proteins strongly activated the reporter gene (Fig. 3), indicating a direct interaction, in eukaryotic cells, of TAF1L and TBP. This supports the hypothesis that TAF1L functions as a TBP-associated factor (TAF).
|
TAF1L rescues the temperature-sensitive lethality of TAFII250 mutant cells
We then tested the ability of the human TAF1L protein to functionally replace TAFII250 in mammalian cells. We took advantage of a hamster cell line, ts13, which is temperature-sensitive because of a single amino acid substitution (G690D) in TAFII250 (12). When shifted to 39.5°C, ts13 cells arrest in the G1 phase of the cell cycle and undergo apoptosis (13,14). The human TAFII250 gene had been cloned by transfecting ts13 cells with human genomic DNA and selecting for growth at 39.5°C (13). The human TAF1L gene that we report was not identified in this transfection screen, suggesting that either (i) the TAF1L protein is not functionally equivalent to TAFII250 or (ii) the TAF1L gene's testis-specific promoter is inactive in ts13 cells, which derive from hamster kidney (8).
To distinguish between these two possibilities, we transfected ts13 cells at the permissive temperature (33.5°C) with a DNA construct in which a ubiquitously expressed viral promoter (cytomegalovirus, CMV) drove expression of human TAF1L coding sequences. We assayed the rescue capability of this pCMNTAF1L construct by selection at 39.5°C. As controls, we conducted parallel experiments with pCMV alone, and also with a construct bearing a single amino acid substitution (G714D) in TAF1La mutation analogous to that in TAFII250 in ts13 cells. At 33.5°C, transfections of ts13 with experimental and control constructs generated neomycin-resistant colonies at similar efficiencies (Fig. 4B). At 39.5°C, neither the pCMV vector alone nor the mutant TAF1L construct yielded any viable cells, but wild-type TAF1L transfectants were viable and readily formed colonies (Fig. 4). By western blotting, we confirmed the presence of wild-type and mutant TAF1L proteins in their respective transfectants (Fig. 4C), indicating that the inability of the mutant TAF1L protein to complement the ts13 mutation is not due to protein degradation. Taken together, our results demonstrate that the human TAF1L protein is functionally interchangeable with TAFII250 in mammalian cells.
|
TAF1L retroposition occurred during primate evolution
To determine when in human evolution the TAF1L retroposition event occurred, we searched for TAF1L orthologs in the genomes of other mammals. We employed PCR primers that would likely amplify TAF1L but not TAFII250 genomic sequences. We found that TAF1L is present in apes and Old World monkeys but is absent in New World monkeys and rodents (Fig. 5A). We sequenced TAF1L orthologs in six apes and Old World monkeys (chimpanzee, gorilla, orangutan, gibbon, baboon and macaque), and found that the 5.5 kb open reading frame is conserved and intact in all six species, in each case displaying >97% nucleotide identity and >95% predicted protein sequence identity to human TAF1L. Analysis of rates of non-synonymous substitution (Ka) and synonymous substitution (Ks) in TAF1L orthologs revealed that the Ka/Ks ratio is consistently <1 (Fig. 5B), indicating that the TAF1L protein has been subject to functional constraint and purifying selection. Taken together, these results suggest two conclusions. First, the TAF1L retroposition probably occurred
2540 million years ago, prior to the radiation of extant Old World monkey lineages, but after their divergence from New World monkeys (15). Second, the functional integrity of the TAF1L protein apparently has been conserved among diverse Old World monkeys and apes, including humans.
|
| DISCUSSION |
|---|
|
|
|---|
In this study, we identified an autosomal retrogene that encodes a functional substitute for the product of its X-linked progenitor. The autosomal gene, TAF1L, appears to be expressed only in spermatogenic cells, whereas the X-linked homolog, TAFII250, is widely expressed. Several other examples of active, testis-specific autosomal retrogenes with X-linked progenitors have been identified in human and/or mouse (1624). In each known case, the autosomal retrogene is specifically expressed in testis, while the X-linked source gene is widely expressed. However, apart from TAFII250 and TAF1L, functional comparisons of X- and autosome-encoded isoforms have yet to be conducted.
Our study raises questions about evolutionary pressures that may have favored the functional substitution of essential somatic factors by gametogenesis-specific homologs. It has been hypothesized that autosomal, testis-specific retrogenes evolved to compensate for inactivation of their X-linked source genes during male meiosis (16). Our discovery of the functional interchangeability of X-encoded TAFII250 and autosome-encoded TAF1L is an important step in validating this hypothesis.
Human TAFII250 joins a small group of widely expressed TFIID components for which tissue-selective homologs have been functionally characterized. In mice, a homolog of TAFII130 is essential for ovarian follicle development (25). Spermiogenesis in mice requires TRF2, a TBP homolog (26), while spermatogenesis in Drosophila requires a testis-specific homolog of dTAFII80 (27). To date, all functionally characterized, tissue-selective homologs of TFIID components appear to be engaged in gametogenesis. Among these examples, the case of human TAFII250 is unique in that we are cognizant of specific adaptive pressures (stemming from X inactivation during male meiosis) that may have driven the evolution of the tissue-specific homolog, TAF1L.
Autosomal retropositioning of X-linked genes appears to have been a recurrent, if infrequent, event throughout mammalian evolution. Among the few molecularly documented events, the most ancient involves PGK2, which arose via retroposition at least 130 million years ago, prior to the divergence of the marsupial and eutherian mammalian lineages (28). More recent events involving PHDA2, G6pd2 and Zfa have been reported (1820,29). Our present findings indicate that TAF1L arose during primate evolution, after our species' lineage diverged from that of New World monkeys (Fig. 5A). The coming availability of complete DNA sequences of the human, mouse and other mammalian genomes will provide unprecedented opportunity to assess systematically the history and extent of retroposition of all X-linked genes during mammalian evolution.
| MATERIALS AND METHODS |
|---|
|
|
|---|
cDNA sequencing by PCR screening of library subpools
Lambda phage lysates were prepared from 24 subpools (
80 000 clones each) of an amplified human testis cDNA library (Clontech). TAF1L-positive subpools were identified by PCR using primer pairs selected from the human TAF1L genomic locus (GenBank accession AL355811). Eleven TAF1L-positive subpools were identified. We then amplified 5' and 3' cDNA fragments separately from the positive subpools by two successive PCRs. In the first PCR (35 cycles), one TAF1L-specific primer and one vector primer were used. A 1 : 100 dilution of the first PCR product served as template in the second, nested PCR (25 cycles), where a second TAF1L-specific primer and a second vector primer were used to further amplify the cDNA fragment. The resulting PCR products were sequenced directly using the nested primers. Using these cDNA fragment sequences, a composite full-length cDNA sequence of TAF1L was assembled electronically.
Expression analysis by RTPCR
Normal human tissue cDNA samples were purchased from Clontech. Human normal testis and germ-cell-deficient testis (Sertoli-cell-only-syndrome) biopsy samples were kindly provided by S. Silber (St Louis, MO). To construct bulk cDNA from testis biopsies, total RNA prepared using TRIzol reagent (Gibco BRL) was treated with DNase I to digest residual genomic DNA, and reverse-transcribed. Gene-specific PCR primers were designed to avoid cross-amplification between TAFII250 and TAF1L. PCR conditions and primer sequences have been deposited at GenBank.
Yeast two-hybrid assay
Using the vector pAS2-1 (Clontech), the entire human TAF1L coding region was cloned in frame with the GAL4 DNA-binding domain, generating the construct TAF1LGAL4-BD. The entire human TBP coding region was PCR-amplified from bulk human testis cDNA and fused with the GAL4 activation domain in the vector pACT2 (Clontech), generating the construct TBPGAL4-AD. The human inserts of both resulting constructs were sequenced to confirm their integrity. Plasmids were transformed into yeast strain Y187 (GAL1UAS GAL1TATAlacZ). Quantitative liquid culture assays for ß-galactosidase activity were performed as described by the manufacturer (Clontech).
Transfection constructs
The entire human TAF1L coding region was cloned into the pCMVTag2A vector (Stratagene), resulting in pCMVTAF1L.
A second construct, pCMVTAF1L (G714D), was derived from pCMVTAF1L by oligonucleotide-directed mutagenesis. The following four primers were used: primer 1, CATCT CTGAAGAAGAGTCGAA; primer 2, TCTTGGTTG CCATGTCAACCTGCATCATTA; primer 3, TAATGATG CAGGTTGACATGGCAACCAAGA; and primer 4, AGGTTGTTCTCAAGTGCCTG. Primers 1 and 4 are outer primers. Primers 2 and 3 are inner primers; these two primers are complementary to each other and contain the desired nucleotide change (underlined). Two DNA fragments (501 and 172 bp) were amplified by PCR with primers 1 and 2 or primers 3 and 4, respectively. The overlapping PCR products were mixed and subjected to PCR amplification with primers 1 and 4. The resulting fragment (643 bp) harbors the desired G-to-A substitution at nucleotide 2141 of the TAF1L coding region. Restriction digestion yielded an EcoRIPstI fragment that was used to replace the corresponding portion of pCMVTAF1L, resulting in pCMVTAF1L (G714D).
Influenza hemagglutinin (HA) epitope-tagged versions of pCMVTAF1L and pCMVTAF1L (G714D) were then derived. DNA encoding three tandem copies of HA was PCR-amplified from pCU180 using primers GGAAGA TCTTTACCCATACGATGTTCCT and GGAAGATC TTGAGCAGCGTAATCTGGA. The amplified DNA was digested with BglII and ligated into BamHI-restricted pCMVTAF1L and pCMVTAF1L (G714D), generating the constructs pCMVHA3TAF1L and pCMVHA3TAF1L (G714D), respectively.
Transfection of ts13 cells
Prior to transfection, hamster ts13 cells were cultured at 33.5°C in 10% CO2 in Dulbecco's modified Eagle's medium with 10% fetal calf serum and penicillinstreptomycin (8). All transfections were performed using LIPOFECTIN reagent (Life Technologies), and in each case 3 µg plasmid DNA was used as suggested by the manufacturer. Two days after transfections, cells were split 1 : 12 and subjected to selection with neomycin or at 39.5°C.
TAF1L orthologs
To identify TAF1L orthologs, we performed PCR on genomic DNAs from diverse mammals using three different pairs of primers. PCR conditions and primer sequences have been deposited at GenBank: accession nos G73370 (shown in Fig. 5A), G73371 (not shown) and G73372 (not shown).
GenBank accession numbers
Primer sequences and RTPCR conditions for human genes: TAFII250, G73373; TAF1L, G73374; FTH1, G65764; and RBMY, G73375. TAF1L sequences: human cDNA, AF390562; chimp genomic, AF390563; gorilla genomic, AF390564; orangutan genomic, AF390565; gibbon genomic, AF390566; baboon genomic, AF390567; and macaque genomic, AF390568.
| ACKNOWLEDGEMENTS |
|---|
We thank S. Silber for testis biopsy samples, R. Tjian for ts13 cells, T. Huffaker for the HA3 plasmid, Yerkes Primate Center for chimpanzee, gorilla, orangutan and gibbon DNA samples, Joerg Gromoll for a macaque DNA sample, K. Rice for a baboon DNA sample, N. Watson for advice on microscopy, and A. Arango, A. Baltus, J. Bradley, L. Brown, K. Kleene, F. Lewitter, D. Menke, J. Potash, S. Rozen and H. Skaletsky for comments on the manuscript. P.J.W. is the recipient of a Medical Foundation postdoctoral fellowship.
| FOOTNOTES |
|---|
* To whom correspondence should be addressed. Tel: +1 6172585203; Fax: +1 6172585578; Email: page_admin{at}wi.mit.edu
AF390562AF390568 and G73370G73375 ![]()
| REFERENCES |
|---|
|
|
|---|
1 Handel, M.A., Park, C. and Kot, M. (1994) Genetic control of sex-chromosome inactivation during male meiosis. Cytogenet. Cell Genet., 66, 8388.[Web of Science][Medline]
2 Solari, A.J. (1974). The behaviour of the XY pair in mammals. Int. Rev. Cytol., 38, 273317.[Web of Science][Medline]
3 Ayoub, N., Richler, C. and Wahrman, J. (1997) Xist RNA is associated with the transcriptionally inactive XY body in mammalian male meiosis. Chromosoma, 106, 110.[Web of Science][Medline]
4 Richler, C., Ast, G., Goitein, R., Wahrman, J., Sperling, R. and Sperling, J. (1994) Splicing components are excluded from the transcriptionally inactive XY body in male meiotic nuclei. Mol. Biol. Cell, 5, 13411352.[Abstract]
5 Sharpe, R.M. (1993) Regulation of spermatogenesis. In Knobil, E. and Neill, J.D. (eds), The Physiology of Reproduction, Raven Press, New York, 1, pp. 13631434.
6 Ruppert, S., Wang, E.H. and Tjian, R. (1993) Cloning and expression of human TAFII250: a TBP-associated factor implicated in cell-cycle regulation. Nature, 362, 175179.[Medline]
7 Hisatake, K., Hasegawa, S., Takada, R., Nakatani, Y., Horikoshi, M. and Roeder, R.G. (1993) The p250 subunit of native TATA box-binding factor TFIID is the cell-cycle regulatory protein CCG1. Nature, 362, 179181.[Medline]
8 Sekiguchi, T., Miyata, T. and Nishimoto, T. (1988) Molecular cloning of the cDNA of human X chromosomal gene (CCG1) which complements the temperature-sensitive G1 mutants, tsBN462 and ts13, of the BHK cell line. EMBO J., 7, 16831687.[Web of Science][Medline]
9 Lander, E.S., Linton, L.M., Birren, B., Nusbaum, C., Zody, M.C., Baldwin, J., Devon, K., Dewar, K., Doyle, M., FitzHugh, W. et al. (2001) Initial sequencing and analysis of the human genome. Nature, 409, 860921.[Medline]
10
Venter, J.C., Adams, M.D., Myers, E.W., Li, P.W., Mural, R.J., Sutton, G.G., Smith, H.O., Yandell, M., Evans, C.A., Holt, R.A. et al. (2001) The sequencing of the human genome. Science, 291, 13041351.
11 Vanin, E.F. (1985) Processed pseudogenes: characteristics and evolution. Annu. Rev. Genet., 19, 253272.[Web of Science][Medline]
12 Hayashida, T., Sekiguchi, T., Noguchi, E., Sunamoto, H., Ohba, T. and Nishimoto, T. (1994) The CCG1/TAFII250 gene is mutated in thermosensitive G1 mutants of the BHK21 cell line derived from golden hamster. Gene, 141, 267270.[Web of Science][Medline]
13 Sekiguchi, T., Yoshida, M.C., Sekiguchi, M. and Nishimoto, T. (1987) Isolation of a human X chromosome-linked gene essential for progression from G1 to S phase of the cell cycle. Exp. Cell Res., 169, 395407.[Web of Science][Medline]
14 Sekiguchi, T., Nakashima, T., Hayashida, T., Kuraoka, A., Hashimoto, S., Tsuchida, N., Shibata, Y., Hunter, T. and Nishimoto, T. (1995) Apoptosis is induced in BHK cells by the tsBN462/13 mutation in the CCG1/TAFII250 subunit of the TFIID basal transcription factor. Exp. Cell. Res., 218, 490498.[Web of Science][Medline]
15 Kumar, S. and Hedges, S.B. (1998) A molecular timescale for vertebrate evolution. Nature, 392, 917920.
16 McCarrey, J.R. and Thomas K. (1987) Human testis-specific PGK gene lacks introns and possesses characteristics of a processed gene. Nature, 326, 501505.[Medline]
17
Dahl, H.H., Brown, R.M., Hutchison, W.M., Maragos, C. and Brown, G.K. (1990) A testis-specific form of the human pyruvate dehydrogenase E1
subunit is coded for by an intronless gene on chromosome 4. Genomics, 8, 225232.[Web of Science][Medline]
18 Hendriksen, P.J., Hoogerbrugge, J.W., Baarends, W.M., de Boer, P., Vreeburg, J.T., Vos, E.A., van der Lende, T. and Grootegoed, J.A. (1997) Testis-specific expression of a functional retroposon encoding glucose-6-phosphate dehydrogenase in the mouse. Genomics, 41, 350359.[Web of Science][Medline]
19 Ashworth, A., Skene, B., Swift, S. and Lovell-Badge, R. (1990) Zfa is an expressed retroposon derived from an alternative transcript of the Zfx gene. EMBO J., 9, 15291534.[Web of Science][Medline]
20
Mardon, G., Luoh, S.W., Simpson, E.M., Gill, G., Brown, L.G. and Page, D.C. (1990) Mouse Zfx protein is similar to Zfy-2: each contains an acidic activating domain and 13 zinc fingers. Mol. Cell. Biol., 10, 681688.
21
Das, B., McMahon, K.W., Jenkins, N.A., Gilbert, D.J., Copeland, N.G. and MacDonald, C.C. (2001) The gene for a variant form of the polyadenylation protein CstF-64 is on chromosome 19 and is expressed in pachytene spermatocytes in mice. J. Biol. Chem., 276, 80448050.
22
Sargent, C.A., Young, C., Marsh, S., Ferguson-Smith, M.A. and Affara, N.A. (1994) the glycerol kinase gene family: structure of the Xp gene, and related intronless retroposons. Hum. Mol. Genet., 3, 13171324.
23 Sedlacek, Z., Munstermann, E., Dhorne-Pollet, S., Otto, C., Bock, D., Schutz, G. and Poustka, A. (1999) Human and mouse XAP-5 and XAP-5-like (X5L) genes: identification of an ancient functional retroposon differentially expressed in testis. Genomics, 61, 125132.[Web of Science][Medline]
24
Elliott, D.J., Venables, J.P., Newton, C.S., Lawson, D., Boyle, S., Eperon, I.C. and Cooke, H.J. (2000) An evolutionarily conserved germ cell-specific hnRNP is encoded by a retrotransposed gene. Hum. Mol. Genet., 9, 21172124.
25
Freiman, R.A., Albright, S.R., Zheng, S., Sha, W.C., Hammer, R.E. and Tjian, R. (2001) Requirement of tissue-selective TBP-associated factor TAFII105 in ovarian development. Science, 293, 20842087.
26
Zhang, D., Penttila, T.L., Morris, P.L., Teichmann, M. and Roeder, R.G. (2001) Spermiogenesis deficiency in mice lacking the Trf2 gene. Science, 292, 11531155.
27
Hiller, M.A., Lin, T.Y., Wood, C. and Fuller, M.T. (2001) Developmental regulation of transcription by a tissue-specific TAF homolog. Genes Dev., 15, 10211030.
28
Boer, P.H., Adra, C.N., Lau, Y.F. and McBurney, M.W. (1987) The testis-specific phosphoglycerate kinase gene Pgk-2 is a recruited retroposon. Mol. Cell. Biol., 7, 31073112.
29 Fitzgerald, J., Wilcox, S.A., Graves, J.A. and Dahl, H.H. (1993) A eutherian X-linked gene, PDHA1, is autosomal in marsupials: a model for the evolution of a second, testis-specific variant in eutherian mammals. Genomics, 18, 636642.[Web of Science][Medline]
30 Ma, K., Inglis, J.D., Sharkey, A., Bickmore, W.A., Hill, R.E., Prosser, E.J., Speed, R.M., Thomson, E.J., Jobling, M., Taylor, K. et al. (1993) A Y chromosome gene family with RNA-binding protein homology: candidates for the azoospermia factor AZF controlling human spermatogenesis. Cell, 75, 12871295.[Web of Science][Medline]
31 Jeanmougin, F., Thompson, J.D., Gouy, M., Higgins, D.G. and Gibson, T.J. (1998) Multiple sequence alignment with Clustal X. Trends Biochem. Sci., 23, 403405.[Web of Science][Medline]
32 Li, W.H. (1993) Unbiased estimation of the rates of synonymous and nonsynonymous substitution. J. Mol. Evol., 36, 9699.[Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
K. Zheng, F. Yang, and P. J. Wang Regulation of Male Fertility by X-Linked Genes J Androl, January 1, 2010; 31(1): 79 - 85. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Dass, S. Tardif, J. Y. Park, B. Tian, H. M. Weitlauf, R. A. Hess, K. Carnes, M. D. Griswold, C. L. Small, and C. C. MacDonald Loss of polyadenylation protein {tau}CstF-64 causes spermatogenic defects and male infertility PNAS, December 18, 2007; 104(51): 20374 - 20379. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Cheng, M. G. Buffone, M. Kouadio, M. Goodheart, D. C. Page, G. L. Gerton, I. Davidson, and P. J. Wang Abnormal Sperm in Mice Lacking the Taf7l Gene Mol. Cell. Biol., April 1, 2007; 27(7): 2582 - 2589. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Yang, R. D. L. Fuente, N. A. Leu, C. Baumann, K. J. McLaughlin, and P. J. Wang Mouse SYCP2 is required for synaptonemal complex assembly and chromosomal synapsis during male meiosis J. Cell Biol., May 22, 2006; 173(4): 497 - 507. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Vinckenbosch, I. Dupanloup, and H. Kaessmann Evolutionary fate of retroposed gene copies in the human genome PNAS, February 28, 2006; 103(9): 3220 - 3225. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Frontini, E. Soutoglou, M. Argentini, C. Bole-Feysot, B. Jost, E. Scheer, and L. Tora TAF9b (Formerly TAF9L) Is a Bona Fide TAF That Has Unique and Overlapping Roles with TAF9 Mol. Cell. Biol., June 1, 2005; 25(11): 4638 - 4649. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Falender, R. N. Freiman, K. G. Geles, K. C. Lo, K. Hwang, D. J. Lamb, P. L. Morris, R. Tjian, and J. S. Richards Maintenance of spermatogenesis requires TAF4b, a gonad-specific subunit of TFIID Genes & Dev., April 1, 2005; 19(7): 794 - 803. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Siep, E. Sleddens-Linkels, S. Mulders, H. van Eenennaam, E. Wassenaar, W. A. Van Cappellen, J. Hoogerbrugge, J. A. Grootegoed, and W. M. Baarends Basic helix-loop-helix transcription factor Tcfl5 interacts with the Calmegin gene promoter in mouse spermatogenesis Nucleic Acids Res., December 7, 2004; 32(21): 6425 - 6436. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hiller, X. Chen, M. J. Pringle, M. Suchorolski, Y. Sancak, S. Viswanathan, B. Bolival, T.-Y. Lin, S. Marino, and M. T. Fuller Testis-specific TAF homologs collaborate to control a tissue-specific transcription program Development, November 1, 2004; 131(21): 5297 - 5308. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Caenepeel, G. Charydczak, S. Sudarsanam, T. Hunter, and G. Manning The mouse kinome: Discovery and comparative genomics of all mouse protein kinases PNAS, August 10, 2004; 101(32): 11707 - 11712. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Han, W. Xie, S. R. Hammes, and J. DeJong Expression of the Germ Cell-specific Transcription Factor ALF in Xenopus Oocytes Compensates for Translational Inactivation of the Somatic Factor TFIIA J. Biol. Chem., November 14, 2003; 278(46): 45586 - 45593. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Chen and J. L. Manley In Vivo Functional Analysis of the Histone 3-like TAF9 and a TAF9-related Factor, TAF9L J. Biol. Chem., September 12, 2003; 278(37): 35172 - 35183. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Nolte, S. Niemann, and U. Muller Specific sequence changes in multiple transcript system DYT3 are associated with X-linked dystonia parkinsonism PNAS, September 2, 2003; 100(18): 10347 - 10352. [Abstract] [Full Text] [PDF] |
||||












