Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (96)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by van de Sluis, B.
Right arrow Articles by Wijmenga, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van de Sluis, B.
Right arrow Articles by Wijmenga, C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2002, Vol. 11, No. 2 165-173
© 2002 Oxford University Press

Identification of a new copper metabolism gene by positional cloning in a purebred dog population

Bart van de Sluis, Jan Rothuizen1, Peter L. Pearson, Bernard A. van Oost1 and Cisca Wijmenga+

Department of Medical Genetics, KC04.084.2, University Medical Centre Utrecht, WKZ, Lundlaan 6, 3584 EA Utrecht, The Netherlands and 1Department of Clinical Sciences of Companion Animals, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands

Received September 21, 2001; Revised and Accepted November 12, 2001.

DDBJ/EMBL/GenBank accession nos AY047597AY047600.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Domesticated animal species such as dogs and cats, with their many different characteristics and breed-specific diseases, and their close relationship and shared environment with humans, are a potentially rich source for the identification of the genetic contribution to human biology and disease. Copper toxicosis in Bedlington terriers is a genetic disease occurring with a high prevalence worldwide and is unique to this breed. Copper homeostasis appears to be well regulated in mammals. Two copper carrier proteins have been identified in man and rodents which, when dysfunctional, cause either copper deficiency (Menkes disease) or copper accumulation in various tissues (Wilson disease). However, these proteins are not primarily involved in the biliary excretion of copper. Bedlington terriers have a high prevalence of copper toxicosis and it is well documented that their biliary excretion of copper is impaired. This disease is of direct relevance for the understanding of copper metabolism in mammals. Previously, we mapped the copper toxicosis gene to dog chromosome region 10q26. Based on DNA samples obtained from privately owned dogs, we were able to confine the localization of the copper toxicosis gene to a region of <500 kb by linkage disequilibrium mapping. While screening genes and expressed sequence tags in this region for mutations we found that exon 2 of the MURR1 gene is deleted in both alleles of all affected Bedlington terriers and in single alleles in obligate carriers. Although the function of the MURR1 gene is still unknown, the discovery of a mutated MURR1 gene in Bedlington terriers with copper toxicosis provides a new lead to disentangling the complexities of copper metabolism in mammals.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Naturally occurring canine genetic diseases have been useful models for the study of the pathophysiology, genetics and treatment of homologous diseases in humans (1). In general, genetic diseases in dogs resemble human diseases more faithfully than their rodent counterparts. This is not surprising given the closer evolutionary relationship and higher degree of DNA sequence identity between humans and dogs than between humans and rodents. Dogs receive a high degree of medical scrutiny, nearly comparable to that applied in human medicine, and the same diagnostic procedures are used for humans and dogs. The positional cloning of canine homologs of human disease genes has largely depended on the establishment and maintenance of breeding colonies (26). However, these captured diseases represent only a small portion of the available canine disease models that might be utilized to advance our knowledge of mammalian genetic diseases. Purebred dogs, bred by dedicated dog breeders, offer a unique source of pedigrees to elucidate the molecular basis of simple and complex genetic diseases and traits. The unusual and useful feature of dog breeds that makes them particularly amenable to genetic analysis is that each breed represents an isolated inbred population (79).

Copper is one of the essential heavy metals in man’s life, although it is highly toxic in excess of a certain threshold (10). Therefore, a well regulated copper metabolism is required to ensure cellular copper homeostasis. Yeast has been an indispensable model for understanding genes involved in eukaryotic copper metabolism and homeostasis. Two copper carrier proteins have been identified in man and rodents which, when dysfunctional, cause either copper deficiency (Menkes disease, MIM 277900) or copper accumulation in various tissues (Wilson disease, MIM 309400). Copper toxicosis (CT) in Bedlington terriers, first described by Hardy (11), is an autosomal recessive disorder (12,13). It is characterized by inefficient excretion of copper via the bile (11), resulting in accumulation of copper in the liver, and leading to chronic hepatitis and, finally, cirrhosis (14). An anonymous microsatellite marker, C04107 (15), was shown to be genetically very closely linked to the CT locus in Bedlington terriers. Moreover, tight linkage disequilibrium (LD) has been observed between allele 2 of marker C04107 and the CT locus. Although this marker has been available since 1995, the molecular basis of the disorder has not yet been reported.

In 1999 we reported the localization of the CT locus to canine chromosome region CFA10q26 (16) a region homologous to human chromosome region HSA2p13–21. This localization was able to rule out any candidate gene known at that time (1618). Since the CT mutation has been present in the Bedlington terrier breed for at least 20–30 generations, we were recently able to refine the CT region by homozygosity mapping to a region of 42.3 cR3000 that corresponds to a region of ~9 Mb (19).

The purpose of this study was to isolate the CT gene by positional cloning. We employed homozygosity and LD mapping to refine the CT candidate gene region even further, to a region of <500 kb. A physical map of bacterial artificial chromosomes (BACs) was constructed covering this region. Comparative mapping and sample sequencing was used to construct a transcription map of the region. Several genes, expressed sequence tags (ESTs) and putative transcripts were identified. Mutation analysis revealed a genomic deletion in the MURR1 gene leading to a predicted truncated protein of 94 amino acids, which is conserved in mammals with a so far unknown function.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Homozygosity mapping
In our previous study, by using homozygosity mapping, we showed that the CT locus was mapped between markers FH2523 and C10.602, a region of ~4.6 cM (19). For both FH2523 and C10.602, recombinants were observed, indicating that the CT candidate region could be refined even further. However, at that time only one marker was present within this interval, namely C04107. All affected Bedlington terriers included in our study were homozygous for allele 2 of marker C04107. Therefore, the partial BAC contig covering the 4.6 cM CT region (described below) was used to isolate new polymorphic microsatellite markers. In addition, a new marker, DTR10.5, was reported in the literature (20). These 11 new markers were subjected to our panel of Bedlington terriers. Haplotypes of the Belgian Bedlington terrier pedigree members were created using individual genotypes from the 14 polymorphic markers. In addition, genotypes were determined in 10 single Belgian Bedlington terriers, unrelated to the large Belgian pedigree, and in three English Bedlington terriers. Although the lack of additional family members for these dogs prohibited the construction of phase-known haplotypes, the majority of the haplotypes could be reconstructed easily because the animals shared homozygosity for the majority of the marker alleles of consecutive markers (Table 1). In addition, haplotypes of some of the obligate carriers and unaffected dogs are shown for comparison (Table 1). A complete list of haplotypes of all the 22 affected dogs, 14 obligate carriers and seven unaffected dogs can be found at http://humgen.med.uu.nl/research/copper/sluis2001.


View this table:
[in this window]
[in a new window]
 
Table 1. Haplotypes of a selected number of affected, obligate carriers and unaffected Bedlington terriers
 
The region that is homozygous in all affected Bedlington terriers only comprises markers CF10B17 and C04107 (Table 1); it is ~300 kb and flanked by markers CF10B18 and CF10B19. Although marker CF10B19 repeatedly showed a 2,3 genotype in Bedlington terrier UTB10, we cannot exclude that allele 3 is here the result of a mutation event instead of a recombination event. Hence, we included CF10B19 as part of the CT candidate region and considered the region flanked by the markers CF10B18 and CF10B23 as the CT candidate region. This candidate region was completely covered by five BAC clones (Fig. 1), which cover a region of ~500 kb.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 1. Physical map of the canine CT region. Mapped genes and EST in the CT region are shown in the upper part (putative transcripts are not shown), the BAC clones in the middle part and the microsatellite markers below. The refined CT candidate region of ~500 kb is indicated by an arrow.

 
Construction of a BAC contig covering the CT region
Previously, the CT region had been confined to a 42.3 cR3000 interval, between the FH2523 and C10.602 markers (19). Based on a partial BAC contig that was constructed at that time, it was estimated that one cR3000 is equivalent to ~210 kb, implying that the CT candidate region was ~9 Mb. This 9 Mb region was further saturated using EST clones and genes from the corresponding homologous region in the human genome (described below). Canine BAC clones were isolated for many of these human genes and ESTs in order to have multiple starting points for the construction of a BAC contig covering the CT region. ESTs KIAA0903 (AB020710), KIAA0570 (AB011142), DKFZp586J101 (HSM800548), clone 24963 (AF131737) and the genes PEX13 (AB022192) and MHD1 (XM_049272) were used to help in constructing the BAC contig. This resulted in three independent BAC contigs with minimum tiling paths of eight, 10 and 14 clones, estimated to cover some 3 Mb of DNA. Fortunately, the sequence flanking the canine marker DTR10.5 was conserved in man and showed homology to one of the YAC clones covering the human 2p13–p16 region. (Detailed information on the canine BAC and comparative human YAC contig can be found at http://humgen.med.uu.nl/research/copper/sluis2001.)

The C04107 marker was initially isolated in BAC clone N21–27 (16). Starting from this BAC clone a walk was initiated into both directions. Marker FH2523, determining the most proximal boundary of the CT candidate region, was cloned in BAC J20–135, which was within four BAC clones from C04107. The C04107 BAC contig consists of a minimum tiling path of nine BAC clones (Fig. 1). Since this contig contains both markers CF10B18 and CF10B23 it covers the entire CT candidate region. For the remainder of the results we will refer to this contig as the CT-contig.

Comparative mapping and construction of a transcription map of the CT region
It was anticipated that the completion of the human genome sequence would aid in constructing a transcription map of the candidate CT region. However, examining the NCBI (http://www.ncbi.nlm.nih.gov) and ENSEMBL (http://www.ensembl.org/) databases revealed that the sequence information from the human 2p13–p16 region was under-represented in the public databases (May 2001). Nevertheless, more than 40 ESTs, genes or predicted transcripts were identified from the region between genes VRK2 (XM_002687) and MDH1 (XM_049272). However, every new update of the sequence showed large changes in comparison to the previous one with respect to the genes present. Because of these large fluctuations, we decided to focus our attention primarily on those transcripts that could be mapped back onto our CT-contig by either PCR or Southern blot analysis. A total of seven ESTs/genes from the human genome sequence could be localized onto the CT-contig, namely CRM1 (XM_002691), ys77h10.s1 (H93765), SHGC-34371 (G28276), nh35c12.s1 (AA524967), FLJ13305 (AK023367), CCT4 (AF026291) and MURR1 (D85433). In addition, individual BAC clones from the CT-contig were subjected to sample sequencing and subsequent BLAST analysis. Seventeen putative transcripts were identified in the CT region, three of which represented known genes (data not shown). Full-length canine mRNA sequences of MURR1, FLJ13305, CCT4 and nh35c12.s1 were obtained by 5'- and 3'-RACE PCR on liver mRNA derived from an unaffected Beagle.

Mutation analysis
We subjected cDNA FLJ13305, CCT4, MURR1 and nh35c12.s1 to mutation analysis using liver mRNA from Bedlington terriers with CT. After amplification of part of the MURR1 gene from liver RNA from Bedlington terriers, using the primers Murr1–3 and Murr1–5, a deletion fragment of 187 bp was identified in the MURR1 mRNA in all the 22 affected Bedlington terriers included in this study. In contrast, unaffected Bedlington terriers showed the expected 469 bp fragment, whereas the obligate carriers were heterozygous for both the 187 and 469 bp fragment (Fig. 2A). Sequence analysis of both the 187 and 469 bp fragment revealed a homozygous deletion of exon 2 (Fig. 2B).



View larger version (49K):
[in this window]
[in a new window]
 
Figure 2. Mutation analysis of MURR1 gene. (A) RT–PCR of liver cDNA from unaffected (U), affected (A), carrier (C) and H2O as a negative control for the RT–PCR. Locations of the RT–PCR primers used (F and R) are indicated in (D). The size marker indicated by M is a 50 bp ladder. (B) Deletion of exon 2 in liver cDNA from an affected Bedlington terrier with CT. (C) Southern blot analysis of genomic dog DNA digested with EcoRI (E) or BamHI (B) and hybridized with exon 2 or exon 3. Equal amounts of genomic dog DNA were loaded onto the gels (data not shown). (D) Genomic organization of the canine MURR1 gene. The EcoRI (E) and BamHI (B) restriction fragments present in genomic DNA are indicated with lines. A dotted line indicates that the exact location of or the distance to the restriction site is not yet known.

 
Southern blot analysis of genomic DNA from affected Bedlington terriers confirmed that exon 2 was deleted: all 22 affected dogs showed a homozygous deletion of a 1.5 kb EcoRI fragment and obligate carriers only had one copy of the1.5 kb EcoRI fragment (Fig. 2C). The location of the EcoRI sites was confirmed by sequencing the flanking intronic sequences of exon 2 (accession no. AY047599). In addition, hybridization with exon 3 showed a BamHI junction fragment of 6.7 kb in affected dogs and a 6 kb BamHI fragment in unaffected dogs (Fig. 2D). The fragmentary genomic information that we have accumulated on the genomic structure of the MURR1 gene indicates a genomic deletion of at least 10 kb (Fig. 2D). The distal breakpoint has been localized to a 500 bp BamHI–EcoRI fragment in intron 2 (data not shown). The proximal breakpoint remains to be determined but is in intron 1 since exon 1 is present in all the animals studied. Intron 1 is estimated to be some 40 kb (data not shown).

Notably, we mapped the C04107 marker within intron 1 of the MURR1 gene.

MURR1 gene
The canine full-length mRNA sequence of MURR1 (accession no. AY047597) spans 1518 bp including an open reading frame of 564 bp that encodes a predicted protein consisting of 188 amino acid residues. Direct BAC sequencing of BAC clone N21–27 and E6–166 derived from a normal dog revealed that the normal canine MURR1 gene consists of three exons in total (accession nos AY047598–AY047600). The translation start codon is present in exon 1 including the kozak consensus sequence (21). The translation stop codon TAG is present in exon 3 and a polyadenylation site AATAAA is seen 877 bp downstream of the TAG termination codon.

An expression profile of MURR1 gene in different tissues was performed by hybridization of a human multiple tissue blot using a MURR1 cDNA probe. Northern blot analysis revealed a human transcript of the expected size, ~710 bp (accession no. AX060277), and clearly showed the highest expression of MURR1 in the liver (Fig. 3A). Low expression of MURR1 was identified in human heart, skeleton muscle, kidney and placenta after correction with GAPDH expression (Fig. 3A). Although no obvious MURR1 expression after X-ray film exposure of 3 days was seen in human brain, colon, thymus, spleen, small intestine and lung, RT–PCR could identify expression of the MURR1 gene in canine kidney, kidney medulla, bile bladder, thalamus, fibroblasts, brain, pancreas, spleen, peripheral blood leukocytes and liver (Fig. 3B). Northern blot analysis showed an additional unidentified transcript of ~1.7 kb in human liver, kidney, placenta (data not shown) after longer X-ray film exposure. The nature of this cross-hybridizing transcript in human RNA needs to be further investigated.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 3. Expression profile of MURR1 gene. (A) Northern blot analysis of human poly A+ RNA from brain (1), heart (2), skeletal muscle (3), colon (4), thymus (5), spleen (6), kidney (7), liver (8), small intestine (9), placenta (10), lung (11) and peripheral blood leukocytes (12) hybridized with canine cDNA MURR1 probe and rehybridized with GAPDH cDNA probe as a control. (B) RT–PCR of single-stranded cDNA from canine liver (1), peripheral blood leukocytes (2), fibroblast (3), pancreas (4), kidney (5), kidney medulla (6), bile bladder (7), thalamus (8), testis (9), brain (10) and genomic canine DNA (11) and H2O (12) as a negative control for the RT–PCR. The size marker indicated by M is a 50 bp ladder.

 
The canine MURR1 protein shows high homology with the human (accession no. CAC24864) and mouse Murr1 proteins (accession no. CAC24865) with 87 and 86% amino acid identity, respectively (Fig. 4). The MURR1 gene was first discovered by Nabetani et al. (22), who named this gene Murr1 (mouse) and MURR1 (human) with no further explanation. In the mouse the Murr1 gene harbors an imprinted gene, U2af1-rs1, which is not present in the human gene (22). Database searches also identified MURR1 orthologs in pig (accession no. BF703083), cow (accession no. BE682977) and rat (accession no. BF404829), but no detectable homologs were present in Saccharomyces cerevisiae, Drosophila melanogaster, Caenorhabditis elegans, Fugu rubripe or Danio rerio.



View larger version (47K):
[in this window]
[in a new window]
 
Figure 4. Alignment of the deduced amino acid sequence of MURR1 in dog, human, mouse and Bedlington terriers with copper toxicosis. Amino acid residues that are not identical in at least two sequences are in bold. Conserved predicted helix structure is marked above the alignment sequences with H, conserved sheet structure is marked with E. The conserved protein kinase C phosphorylation site is indicated with ~, the casein kinase II phosphorylation site is indicated with =, and the N-myristoylation site is indicated with +.

 
No homology with any other protein or identifiable domains could be identified to indicate the putative function of the protein. According to different structural prediction programs it seems that the secondary structure of the MURR1 protein is conserved between dog, human and mouse. It contains at least seven helixes and three sheets (Fig. 4). In addition, the predicted sites (a protein kinase C phosphorylation site, a casein kinase II phosphorylation site and an N-myristoylation site) are conserved between the dog, human and mouse MURR1 protein (Fig. 4).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
We describe here the first example of exploiting one of the more than 300 isolated canine populations worldwide to discover a new gene (1). When the gene we have identified is mutated, the Bedlington terrier is affected by CT; therefore, it is likely that the gene is involved in copper homeostasis in mammals. CT in Bedlington terriers has long interested researchers because of its phenotypic similarities to human copper-related diseases, such as Wilson disease and Indian and non-Indian childhood cirrhosis. The cloning of the Wilson disease gene, ATP7B, and the presence of a genetic marker linked to the CT locus in Bedlington terriers, allowed us to exclude the ATP7B gene as a candidate gene for CT based on map location (16). Soon after, additional genes known to be involved in copper metabolism were also excluded as candidates for CT (1618).

Although the CT locus was linked to marker C04107, recombination events between the CT locus and marker C04107 (23,24) suggested that C04107 was still at a certain distance from the CT gene. We have not identified a recombinant event in our cohort of CT-affected dogs, but we have nevertheless based our strategy on these observations. We initially set out to refine the CT candidate region further by LD mapping in affected dogs, which would result in identical regions of homozygosity encompassing the CT locus. Although Ostrander and Kruglyak (9) advocated this approach, they also suggested that extensive inbreeding could result in rather large regions of LD, thereby hampering the fine mapping of a disease locus. However, since the CT mutation has existed in the Bedlington terrier breed for 20–30 generations, the regions of LD around the disease mutation that are shared between the Belgian and British Bedlington terriers should be fairly small. Nevertheless, we were surprised to find that in our cohort of only 22 affected dogs—most of which come from one Belgian pedigree—the CT region could be refined to a region as small as ~500 kb.

The region that was shared in homozygous form by all the affected dogs was isolated in BAC clones. The ‘conservative’ CT-contig consisted of nine overlapping BAC clones; the region was further refined to 500 kb, flanked by the markers CF10B18 and CF10B23. The 500 kb region is covered by five BAC clones. A transcription map was generated from this region using a combination of human genome sequence data and sample sequencing of canine BAC clones. The human sequence revealed six different transcripts; the combined approach revealed 16 putative transcripts in this region. Since the identity of most of the transcripts from this region has not yet been determined, we focused our attention on the known genes. One of these genes, MURR1, revealed a deletion of exon 2, resulting in an in-frame deletion and the production of a predicted truncated protein of 94 amino acid residues instead of 188 amino acid residues. Southern blot analysis and PCR analysis using intronic primers clearly demonstrated the presence of a genomic deletion that spans at least 10 kb and encompasses exon 2.

The presence of a deletion of exon 2 of the MURR1 gene in all affected Bedlington terriers in a homozygous state suggests that MURR1 is the disease-causing gene in CT in Bedlington terriers. Interestingly, however, the C04107 marker is located within intron 1 of MURR1. This would make C04107 an excellent predictive marker for CT especially, given the extensive LD between allele 2 of this marker and the CT locus. Nevertheless, this localization of C04107 within the MURR1 gene also raises the intriguing question of how to explain the recombinants described previously. It cannot be excluded that recombination between C04107 and the site of the deletion associated with CT can lead to an uncoupling between allele 2 of C04107 and the CT mutation. Therefore, it would be interesting to test the recombinant dogs for the presence of the CT mutation. Alternatively, different mutations may be present in the MURR1 gene and associated with different C04107 alleles, although it is very unlikely that several mutations would occur in a purebred dog. However, an incorrect diagnosis of the disease may also provide a logical explanation for the observed discrepancy. In our cohort of Bedlington terriers, the CT affection status is determined by hepatic copper concentrations of >=1000 µg/g dry weight of liver. In contrast, Haywood et al. (24) considered dogs to be affected with CT when hepatic copper concentrations exceeded 400 µg/g dry weight of liver. Normal liver copper concentrations in dogs vary widely and even in healthy dogs may exceed 400 µg/g dry weight of liver (25). An extensive survey on a much larger panel of Bedlington terriers would resolve this issue.

The large genomic deletion causing a truncated MURR1 protein of 94 amino acids suggests a loss-of-function mutation which would lead to the complete loss of protein function. The function of the MURR1 protein remains to be elucidated since this protein is completely unknown and shows no homology with any other protein or identifiable motifs. The MURR1 gene seems to be restricted to vertebrates and perhaps only to mammals because no detectable homologs are present in S.cerevisiae, D.melanogaster, C.elegans, F.rubripe or D.rerio. In addition, the results of the structural and site predictions are too limited to indicate the putative function of the protein.

We know that in affected Bedlington terriers copper is stored in the lysosomes due to an inefficient excretion of copper via the bile (26). Recently, our knowledge about copper uptake into the cell and cellular copper transport into different proteins has increased substantially (10). However, knowledge about the cellular processes acting downstream of the Wilson disease protein ATP7B and involving copper excretion into the bile is limited. It is known that ATP7B redistributes to vesicular structures and to apical vacuoles reminiscent of bile canaliculi at high copper levels (27). Therefore, it is tempting to speculate that the accumulation of copper in the lysosomes is associated with a defect in the lysosomal vesicles transport to the bile canalicular membrane for excretion into the bile. An 84% copper level reduction in the bile of affected Bedlington terriers is seen (H.Roelofsen, personal communication), confirming these speculations. Although the exact role of MURR1 still needs to be elucidated, the ubiquitous expression pattern of the gene is consistent with a general function of the protein, such as vesicle transport. The fact that most copper is retained in the liver (28), where copper is excreted out of the body, explains why other tissues of affected Bedlington terriers do not show any copper accumulation. In addition, the high level of expression of MURR1 in the liver adds to the importance of MURR1 in copper excretion by the liver.

The function of MURR1 in copper homeostasis in mammalian cells should be investigated in the future. Moreover, MURR1 becomes a good candidate gene for the human copper storage disorders that still need to be elucidated, including Indian childhood cirrhosis (29) and non-Indian childhood cirrhosis (30), as well as the copper toxicosis disorders seen in other dog breeds and in sheep (25,31).


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Animals and samples for DNA isolation
Blood was collected from 23 related Bedlington terriers of Belgian origin (nine affected, 12 carriers, two unaffected) and 10 unrelated affected Bedlington terriers (19). The pedigree of the Belgian Bedlington terriers has been depicted by van de Sluis (19). DNA was isolated according to Miller et al. (32). Diagnostic criteria were described and the results of the copper analysis were published by Rothuizen et al. (33). In addition, DNA from three affected English Bedlington terriers was kindly provided by Dr Nigel Holmes (Centre for Preventive Medicine, Animal Health Trust, Suffolk, UK).

DNA probes for comparative mapping
The probes ys77h10.s1pr, SHGC-34371pr, FLJ13305pr, nh35c12.s1pr, cct4pr, crm1pr, pex13pr, mdh1pr, KIAA0903pr, KIAA0570pr, DKFZp586J101pr and 24963pr correspond to the human ESTs/genes ys77h10.s1 (H93765), SHGC-34371 (G28276), FLJ13305 (AK023367), nh35c12.s1 (AA524967), CCT4 (AF026291) CRM1 (XM_002691), PEX13 (AB022192), MDH1 (XM_049272), KIAA0903 (AB020710), KIAA0570 (AB011142), DKFZp586J101pr (HSM800548) and clone 24963 (AF131737), respectively. These probes were obtained by PCR amplification from human genomic DNA or human placenta cDNA. Primers (sequence information can be found at http://humgen.med.uu.nl/research/copper/sluis2001) were selected from the coding regions. PCR reactions were performed in a GeneAmp® PCR system 9700 (Perkin Elmer) in a 20 µl volume containing 50 ng template DNA or cDNA, 50 ng of each oligonucleotide primer, 200 mM dNTP and 0.5 U Amplitaq Gold (Perkin Elmer), in 1x PCR buffer II with 2.5 mM MgCl2 (Perkin Elmer). DNA was initially denaturated at 95°C for 10 min and was then subjected to 35 cycles of 95°C for 30 s, annealing for 30 s (for temperatures see http://humgen.med.uu.nl/research/copper/sluis2001) and at 72°C for 1 min, followed by a final extension step of 4 min at 72°C. The identity of all probes was confirmed by sequence analysis.

Construction of the BAC contig
Overlapping BAC clones were isolated by screening a total canine BAC library (34) by colony hybridization with [{alpha}-32P]dATP- and [{alpha}-32P]dCTP-labeled overgos (35). The overgos were generated from BAC end sequences determined as previously described by van de Sluis et al. (19). The verification of the overlapping BAC clones was determined by PCR using PCR primers generated from the BAC end sequences.

BAC clones were isolated from the total BAC library by colony hybridization with [{alpha}-32P]dATP-labeled probes crm1pr, pex13pr, mdh1pr, KIAA0903pr, KIAA0570pr, DKFZp586J101pr and 24963pr. The hybridization procedure and the verification of the positive BAC clones were performed as described by van de Sluis et al. (16).

Comparative mapping
BAC DNA was isolated by the alkaline lysis method as described on the BacPac website (http://bacpac.med. buffalo.edu). BAC DNA were digested with EcoRI, BamHI and EcoRI–BamHI, separated on a 0.7% agarose gel, transferred to Hybond N+ (Amersham), and hybridized at 65°C with ys77h10.s1pr, SHGC-34371pr, FLJ13305pr, nh35c12.s1 and cct4pr probes (36).

Construction of a microsatellite-enriched library of BAC clones
BAC DNA from the BAC clones comprising the CT-contig (Results) was isolated by the alkaline lysis method. 500 ng BAC DNA was digested with Sau3AI (Roche) and adapters were ligated to the end of the restriction fragments and the restriction fragments were amplified using adapter-specific primers as described before (37). The amplified product was enrichment for CA and GAAA repeats, performed as previously described by Korstanje et al. (38) using 3' biotinylated [CA]22 and 3' biotinylated [GAAA]7 oligos. The enriched fragments were amplified by PCR using the adapter-specific primers as described previously (37). The PCR products were cloned into the pCR 2.1 cloning vector using the TA-cloning kit (Invitrogen). Positive clones were identified by colony hybridization and their identity was determined by sequence analysis using BigDye Terminator cycle sequencing (Applied Biosystems), followed by separation on an ABI Prism 3700 DNA analyzer (Applied Biosystems). Thereafter, specific primers were generated to amplify the microsatellite repeat sequences. Primer sequences are listed at http://humgen.med.uu.nl/research/copper/sluis2001. The approximate localization and order of the microsatellite markers was determined by PCR analysis of the individual BAC clones comprising the CT-contig.

Sample sequencing of the CT-contig
BAC DNA of the BAC clones; J20–135, G6–181, E6–166, N21–27, L3–237, M22–353 and D17–109 were isolated as described before. 500 ng BAC DNA was partially digested with Sau3AI (Roche) to obtain DNA fragments between 400 and 2000 bp using 0.25 and 0.5 U enzyme in a reaction volume of 50 µl. The resulting digests were ligated into pBluescript SK (Stratagene) digested with BamHI, transformed and plated on LB agar plates with 50 µg/ml ampicillin. Subclones were randomly selected for sequence analysis using M13 forward (-21M13F) and reverse (M13-R-2) primers.

DNA marker analysis
Dog DNA was amplified for each of the 10 newly isolated canine microsatellite markers and marker DTR10.5 (20) as described above. Markers FH2422, FH2523, C04107 were genotyped previously (19). The forward primer of each marker was labeled with HEX, TET or FITC fluorescent dyes, which allowed separation of the marker alleles on an automated ABI377 DNA sequencer. The markers were analyzed as described by Wijmenga et al. (39).

Homozygosity mapping
For each canine microsatellite marker we determined whether the dogs were heterozygous or homozygous. If additional family members were available, haplotypes were constructed to determine identity by descent of the mutant chromosome. The haplotypes of all typed dogs are available as an online resource at http://humgen.med.uu.nl/research/copper/sluis2001.

5'- and 3'-RACE PCR of the MURR1 gene
Full-length mRNA sequence of MURR1 was obtained by 5'- and 3'-RACE using the Marathon cDNA Amplification kit (Clontech) and the following primers: 5' primer GATCTGAACTACTGAGAAAGTTGGG and 3' primer CCCAACTTTCTCAGTAGTTCAGATC. The RACE–PCR products were subsequently cloned and analyzed by sequence analysis.

Mutation analysis
Mutation analysis in MURR1 mRNA sequence was performed using the primer combination Murr1–3 CCCAGGAAGCTTTCCACGG and Murr1–5 GTTGACTGACCTTGACTTCATC, and Murr1–4 CTGTTGCCATAATGGAGCTGG and Murr1–2 CCTCAACCCCAAGATCAAGAG. The PCR was performed as described above but instead of genomic DNA, cDNA of an affected Bedlington terrier and a Beagle was used. PCR products were separated on a 1.5% agarose gel and were analyzed by sequence analysis.

Bioinformatics
Sequences obtained by sample sequencing were analyzed by a Basic BLAST search (http://www.ncbi.nlm.nih.gov) using blastn and blastx. Database searches to find MURR1 orthologs in other species were performed using all available databases available through NCBI (http://www.ncbi.nlm.nih.gov) and the fugu and zebra fish database (http://fugu.hgmp.mrc.ac.uk/blast/). The presence domains and structural motifs within the MURR1 protein were analyzed using different prediction programs (http://www.embl-heidelberg.de/predictprotein/submit_def.html; http://jura.ebi.ac.uk:8888/; and http://www.expasy.ch/tools/scnpsit1.html).

RT–PCR
Total RNA from different tissues of a Beagle was used to synthesize single-stranded cDNA using the Reverse Transcription System (Promega). The reverse transcriptase reaction was performed according to the manufacturer’s specifications (Promega). MURR1 expression was performed using the primer combination Murr1–3 and Murr1–5. The PCR reaction was performed as described above. PCR products were separated on a 2% agarose gel.

Northern blot analysis
Human 12-lane multiple tissue northern (MTNTM) blot was hybridized with [{alpha}-32P]dCTP-labeled cDNA dog MURR1 probe, containing exon 2 and exon 3 according to the manufacturer’s specifications (Clontech). The northern blot was rehybridized with [{alpha}-32P]dCTP-labeled cDNA GAPDH probe as a control.


    ACKNOWLEDGEMENTS
 
We thank Nigel Holmes (Animal Health Trust, New Market, UK) for collecting DNA samples of Bedlington terriers in the UK, Martin Wapenaar for his critical review, Ellen van Binsbergen and Monique van Wolferen for technical assistance, Harm van Bakel for bioinformatic assistance and Jackie Senior for improving the manuscript. We thank the British Bedlington terrier club for their financial support. This work also received financial support from the International Copper Association (TPT0551-98) and the Netherlands Organization for Scientific Research (NWO 902-23-254).


    FOOTNOTES
 
+ To whom correspondence should be addressed. Tel: +31 30 250 4286; Fax: +31 30 250 5301; Email: t.n.wijmenga@med.uu.nl Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
1 Patterson,D.F. (2002) Canine Genetic Disease Information System. Mosby, Harcourt Health Science, St Louis, MO.

2 Lingaas,F., Aarskaug,T., Sletten,M., Bjerkas,I., Grimholt,U., Moe,L., Juneja,R.K., Wilton,A.N., Galibert,F., Holmes,N.G. et al. (1998) Genetic markers linked to neuronal ceroid lipofuscinosis in English setter dogs. Anim. Genet., 29, 371–376.[ISI][Medline]

3 Acland,G.M., Ray,K., Mellersh,C.S., Gu,W., Langston,A.A., Rine,J., Ostrander,E.A. and Aguirre,G.D. (1998) Linkage analysis and comparative mapping of canine progressive rod-cone degeneration (prcd) establishes potential locus homology with retinitis pigmentosa (RP17) in humans. Proc. Natl Acad. Sci. USA, 95, 3048–3053.[Abstract/Free Full Text]

4 Acland,G.M., Ray,K., Mellersh,C.S., Langston,A.A., Rine,J., Ostrander,E.A. and Aguirre,G.D. (1999) A novel retinal degeneration locus identified by linkage and comparative mapping of canine early retinal degeneration. Genomics, 59, 134–142.[ISI][Medline]

5 Lin,L., Faraco,J., Li,R., Kadotani,H., Rogers,W., Lin,X., Qiu,X., de Jong,P.J., Nishino,S. and Mignot,E. (1999) The sleep disorder canine narcolepsy is caused by a mutation in the hypocretin (orexin) receptor 2 gene. Cell, 98, 365–376.[ISI][Medline]

6 Jonasdottir,T.J., Mellersh,C.S., Moe,L., Heggebo,R., Gamlem,H., Ostrander,E.A. and Lingaas,F. (2000) Genetic mapping of a naturally occurring hereditary renal cancer syndrome in dogs. Proc. Natl Acad. Sci. USA, 97, 4132–4137.[Abstract/Free Full Text]

7 Ostrander,E.A. and Giniger,E. (1997) Semper fidelis: what man’s best friend can teach us about human biology and disease. Am. J. Hum. Genet., 61, 475–480.[ISI][Medline]

8 Ostrander,E.A., Galibert,F. and Patterson,D.F. (2000) Canine genetics comes of age. Trends Genet., 16, 117–124.[ISI][Medline]

9 Ostrander,E.A. and Kruglyak,L. (2000) Unleashing the canine genome. Genome Res., 10, 1271–1274.[Free Full Text]

10 Pena,M.M., Lee,J. and Thiele,D.J. (1999) A delicate balance: homeostatic control of copper uptake and distribution. J. Nutr., 129, 1251–1260.[Abstract/Free Full Text]

11 Hardy,R.M., Stevens,J.B. and Stowe,C.M. (1975) Chronic progressive hepatitis in Bedlington terriers associated with elevated liver copper concentrations. Minnesota Veterinarian, 15, 13–24.

12 Johnson,G.F., Sternlieb,I., Twedt,D.C., Grushoff,P.S. and Scheinberg,I. (1980) Inheritance of copper toxicosis in Bedlington terriers. Am. J. Vet. Res., 41, 1865–1866.[ISI][Medline]

13 Owen,C.A.,Jr and Ludwig,J. (1982) Inherited copper toxicosis in Bedlington terriers: Wilson’s disease (hepatolenticular degeneration). Am. J. Pathol., 106, 432–434.[ISI][Medline]

14 Twedt,D.C., Sternlieb,I. and Gilbertson,S.R. (1979) Clinical, morphologic and chemical studies on copper toxicosis of Bedlington terriers. J. Am. Vet. Med. Assoc., 175, 269–275.[ISI][Medline]

15 Yuzbasiyan-Gurkan,V., Blanton,S.H., Cao,Y., Ferguson,P., Li,J., Venta,P.J. and Brewer,G.J. (1997) Linkage of a microsatellite marker to the canine copper toxicosis locus in Bedlington terriers. Am. J. Vet. Res., 58, 23–27.[ISI][Medline]

16 van de Sluis,B.J., Breen,M., Nanji,M., van Wolferen,M., de Jong,P., Binns,M.M., Pearson,P.L., Kuipers,J., Rothuizen,J., Cox,D.W. et al. (1999) Genetic mapping of the copper toxicosis locus in Bedlington terriers to dog chromosome 10, in a region syntenic to human chromosome region 2p13–p16. Hum. Mol. Genet., 8, 501–507.

17 Nanji,M.S. and Cox,D.W. (1999) The copper chaperone Atox1 in canine copper toxicosis in Bedlington terriers. Genomics, 62, 108–112.[ISI][Medline]

18 Dagenais,S.L., Guevara-Fujita,M., Loechel,R., Burgess,A.C., Miller,D.E., Yuzbasiyan-Gurkan,V., Brewer,G.J. and Glover,T.W. (1999) The canine copper toxicosis locus is not syntenic with ATP7B or ATX1 and maps to a region showing homology to human 2p21. Mamm. Genome, 10, 753–756.[ISI][Medline]

19 van de Sluis,B., Kole,S., van Wolferen,M., Holmes,N.G., Pearson,P.L., Rothuizen,J., van Oost,B.A. and Wijmenga,C. (2000) Refined genetic and comparative physical mapping of the canine copper toxicosis locus. Mamm. Genome, 11, 455–460.[ISI][Medline]

20 Tiret,L., Kessler,J.L., Bentolila,S., Faure,S., Bach,J.M., Weissenbach,J. and Panthier,J.J. (2000) Assignation of highly polymorphic markers on a canine purebred pedigree. Mamm. Genome, 11, 703–705.[ISI][Medline]

21 Kozak,M. (1987) An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res., 15, 8125–8148.[Abstract/Free Full Text]

22 Nabetani,A., Hatada,I., Morisaki,H., Oshimura,M. and Mukai,T. (1997) Mouse U2af1-rs1 is a neomorphic imprinted gene. Mol. Cell. Biol., 17, 789–798.[Abstract]

23 Holmes,N.G., Herrtage,M.E., Ryder,E.J. and Binns,M.M. (1998) DNA marker C04107 for copper toxicosis in a population of Bedlington terriers in the United Kingdom. Vet. Rec., 142, 351–352.[Abstract/Free Full Text]

24 Haywood,S., Fuentealba,I.C., Kemp,S.J. and Trafford,J. (2001) Copper toxicosis in the Bedlington terrier: a diagnostic dilemma. J. Small Anim. Pract., 42, 181–185.[ISI][Medline]

25 Thornburg,L.P. (2000) A perspective on copper and liver disease in the dog. J. Vet. Diagn. Invest., 12, 101–110.[Abstract/Free Full Text]

26 Johnson,G.F., Morell,A.G., Stockert,R.J. and Sternlieb,I. (1981) Hepatic lysosomal copper protein in dogs with an inherited copper toxicosis. Hepatology, 1, 243–248.[ISI][Medline]

27 Roelofsen,H., Wolters,H., Van Luyn,M.J., Miura,N., Kuipers,F. and Vonk,R.J. (2000) Copper-induced apical trafficking of ATP7B in polarized hepatoma cells provides a mechanism for biliary copper excretion. Gastroenterology, 119, 782–793.[ISI][Medline]

28 Linder,M.C., Wooten,L., Cerveza,P., Cotton,S., Shulze,R. and Lomeli,N. (1998) Copper transport. Am. J. Clin. Nutr., 67, 965S–971S.[Abstract]

29 Tanner,M.S. (1998) Role of copper in Indian childhood cirrhosis. Am. J. Clin. Nutr., 67, 1074S–1081S.[Abstract]

30 Muller,T., Feichtinger,H., Berger,H. and Muller,W. (1996) Endemic Tyrolean infantile cirrhosis: an ecogenetic disorder. Lancet, 347, 877–880.[ISI][Medline]

31 Sutherland,R.J. (1982) Copper toxicosis in sheep. J. Am. Vet. Med. Assoc., 180, 984.[ISI][Medline]

32 Miller,S.A., Dykes,D.D. and Polesky,H.F. (1988) A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res., 16, 1215.[Free Full Text]

33 Rothuizen,J., Ubbink,G.J., van Zon,P., Teske,E., van den Ingh,T.S. and Yuzbasiyan-Gurkan,V. (1999) Diagnostic value of a microsatellite DNA marker for copper toxicosis in west-European Bedlington terriers and incidence of the disease. Anim. Genet., 30, 190–194.[ISI][Medline]

34 Li,R., Mignot,E., Faraco,J., Kadotani,H., Cantanese,J., Zhao,B., Lin,X., Hinton,L., Ostrander,E.A., Patterson,D.F. et al. (1999) Construction and characterization of an eightfold redundant dog genomic bacterial artificial chromosome library. Genomics, 58, 9–17.[ISI][Medline]

35 Han,C.S., Sutherland,R.D., Jewett,P.B., Campbell,M.L., Meincke,L.J., Tesmer,J.G., Mundt,M.O., Fawcett,J.J., Kim,U.J., Deaven,L.L. et al. (2000) Construction of a BAC contig map of chromosome 16q by two-dimensional overgo hybridization. Genome Res., 10, 714–721.[Abstract/Free Full Text]

36 Church,G.M. and Gilbert,W. (1984) Genomic sequencing. Proc. Natl Acad. Sci. USA, 81, 1991–1995.[Abstract/Free Full Text]

37 Groot,P.C. and van Oost,B.A. (1998) Identification of fragments of human transcripts from a defined chromosomal region: representational difference analysis of somatic cell hybrids. Nucleic Acids Res., 26, 4476–4481.[Abstract/Free Full Text]

38 Korstanje,R., Gillissen,G.F., den Bieman,M.G., Versteeg,S.A., van Oost,B.A., Fox,R.R., van Lith,H.A. and van Zutphen,L.F.M. (2001) Mapping of Rabbit chromosome 1 markers generated from a microsatellite enriched chromosome-specific library. Anim. Genet., 32, 308–312.[ISI][Medline]

39 Wijmenga,C., van den Heuvel,L.P., Strengman,E., Luyten,J.A., van der Burgt,I.J., de Groot,R., Smeets,D.F., Draaisma,J.M., van Dongen,J.J., De Abreu,R.A. et al. (1998) Localization of the ICF syndrome to chromosome 20 by homozygosity mapping. Am. J. Hum. Genet., 63, 803–809.[ISI][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Vet Rec.Home page
T. S. G. A. M. van den Ingh, P. M. Punte, E. N. L. J. Hoogendijk, and J. Rothuizen
Possible nutritionally induced copper-associated chronic hepatitis in two dogs
Vet Rec., November 24, 2007; 161(21): 728 - 728.
[Full Text] [PDF]


Home page
J. Med. Genet.Home page
P de Bie, P Muller, C Wijmenga, and L W J Klomp
Molecular pathogenesis of Wilson and Menkes disease: correlation of mutations with molecular defects and disease phenotypes
J. Med. Genet., November 1, 2007; 44(11): 673 - 688.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
S. Lutsenko, N. L. Barnes, M. Y. Bartee, and O. Y. Dmitriev
Function and Regulation of Human Copper-Transporting ATPases
Physiol Rev, July 1, 2007; 87(3): 1011 - 1046.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
B. van de Sluis, P. Muller, K. Duran, A. Chen, A. J. Groot, L. W. Klomp, P. P. Liu, and C. Wijmenga
Increased Activity of Hypoxia-Inducible Factor 1 Is Associated with Early Embryonic Lethality in Commd1 Null Mice
Mol. Cell. Biol., June 1, 2007; 27(11): 4142 - 4156.
[Abstract] [Full Text] [PDF]


Home page
Vet Rec.Home page
S. Haywood
Copper toxicosis in Bedlington terriers
Vet Rec., November 11, 2006; 159(20): 687 - 687.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. M. Lim, M. A. Cater, J. F. B. Mercer, and S. La Fontaine
Copper-dependent Interaction of Dynactin Subunit p62 with the N Terminus of ATP7B but Not ATP7A
J. Biol. Chem., May 19, 2006; 281(20): 14006 - 14014.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
E. A. Ostrander and R. K. Wayne
The canine genome
Genome Res., December 1, 2005; 15(12): 1706 - 1716.
[Abstract] [Full Text] [PDF]


Home page
BMJHome page
B. Michell
What could Dr Finlay and Mr Herriot learn from each other?
BMJ, November 26, 2005; 331(7527): 1220 - 1221.
[Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
Y. Guo, L. Nyasae, L. T. Braiterman, and A. L. Hubbard
NH2-terminal signals in ATP7B Cu-ATPase mediate its Cu-dependent anterograde traffic in polarized hepatic cells
Am J Physiol Gastrointest Liver Physiol, November 1, 2005; 289(5): G904 - G916.
[Abstract] [Full Text] [PDF]


Home page
J HeredHome page
J. Aguirre-Hernandez and D. R. Sargan
Evaluation of Candidate Genes in the Absence of Positional Information: A Poor Bet on a Blind Dog!
J. Hered., September 1, 2005; 96(5): 475 - 484.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Burstein, J. E. Hoberg, A. S. Wilkinson, J. M. Rumble, R. A. Csomos, C. M. Komarck, G. N. Maine, J. C. Wilkinson, M. W. Mayo, and C. S. Duckett
COMMD Proteins, a Novel Family of Structural and Functional Homologs of MURR1
J. Biol. Chem., June 10, 2005; 280(23): 22222 - 22232.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Biasio, T. Chang, C. J. McIntosh, and F. J. McDonald
Identification of Murr1 as a Regulator of the Human {delta} Epithelial Sodium Channel
J. Biol. Chem., February 13, 2004; 279(7): 5429 - 5434.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Y. Wang, K. Joh, S. Masuko, H. Yatsuki, H. Soejima, A. Nabetani, C. V. Beechey, S. Okinami, and T. Mukai
The Mouse Murr1 Gene Is Imprinted in the Adult Brain, Presumably Due to Transcriptional Interference by the Antisense-Oriented U2af1-rs1 Gene
Mol. Cell. Biol., January 1, 2004; 24(1): 270 - 279.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Y. Tao, F. Liu, L. Klomp, C. Wijmenga, and J. D. Gitlin
The Copper Toxicosis Gene Product Murr1 Directly Interacts with the Wilson Disease Protein
J. Biol. Chem., October 24, 2003; 278(43): 41593 - 41596.
[Abstract] [Full Text] [PDF]


Home page
J HeredHome page
B. van de Sluis, A. T. Peter, and C. Wijmenga
Indirect Molecular Diagnosis of Copper Toxicosis in Bedlington Terriers Is Complicated by Haplotype Diversity
J. Hered., May 1, 2003; 94(3): 256 - 259.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
H. Shim and Z. L. Harris
Genetic Defects in Copper Metabolism
J. Nutr., May 1, 2003; 133(5): 1527S - 1531.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
I. Hamza, J. Prohaska, and J. D. Gitlin
Essential role for Atox1 in the copper-mediated intracellular trafficking of the Menkes ATPase
PNAS, February 4, 2003; 100(3): 1215 - 1220.
[Abstract] [Full Text] [PDF]