Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (19)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Koppens, P. F.J.
Right arrow Articles by Degenhart, H. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Koppens, P. F.J.
Right arrow Articles by Degenhart, H. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2002, Vol. 11, No. 21 2581-2590
© 2002 Oxford University Press

Carriership of a defective tenascin-X gene in steroid 21-hydroxylase deficiency patients: TNXBTNXA hybrids in apparent large-scale gene conversions

Paul F.J. Koppens*, Theo Hoogenboezem and Herman J. Degenhart

Department of Paediatrics, Erasmus MC–Sophia, Rotterdam, The Netherlands

Received April 11, 2002; Accepted July 19, 2002


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Steroid 21-hydroxylase deficiency is caused by a defect in the CYP21A2 gene. CYP21A2, the adjacent complement C4 gene and parts of the flanking genes RP1 and TNXB constitute a tandemly duplicated arrangement in the central (class III) region of the major histocompatibility complex. The typical number of repeats of the CYP21/C4 region is two, with one repeat carrying CYP21A2 and the other carrying the highly homologous pseudogene CYP21A1P. By comparison with this standard, three categories of CYP21A2 defects have traditionally been distinguished: CYP21A2 deletions, large-scale gene conversions of CYP21A2 into a structure similar to CYP21A1P, and smaller mutations in CYP21A2 (also derived from CYP21A1P, by means of small-scale gene conversions). The genetic mechanisms suggested by these designations have originally been inferred from the layout of the haplotypes involved and were later confirmed by observation of deletions and small mutations, but not large-scale conversions, as de novo events. Apparent large-scale conversions account for the defect in 9 out of 77 chromosomes in our patient group. We here demonstrate that 4 out of these 9 ‘conversions’ extend into the flanking TNXB gene, which encodes tenascin-X. This implies that ~1 in every 10 steroid 21-hydroxylase deficiency patients is a carrier of tenascin-X deficiency, which is associated with a recessive form of the Ehlers–Danlos syndrome. Currently available data on the structure of ‘deletion’ and ‘large-scale conversion’ chromosomes strongly suggests that both are the result of the same mechanism, namely unequal meiotic crossover. Since it is unlikely that the term ‘large-scale gene conversion’ describes a mechanism that actually occurs between the CYP21A2 and CYP21A1P genes, we propose the discontinuation of that terminology.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Steroid 21-hydroxylase deficiency is the foremost cause of congenital adrenal hyperplasia (CAH), an inborn error of metabolism with an incidence ranging between 1 : 10 000 and 1 : 15 000 in most populations (15). CAH due to 21-hydroxylase deficiency is characterized by an impaired adrenocortical synthesis of cortisol and aldosterone. Lack of aldosterone often results in severe salt loss in untreated paediatric patients, a potentially life-threatening condition. Also, the adrenal, which has increased in size due to continuous adrenocorticotrophic hormone (ACTH) stimulation induced by lack of cortisol, shunts excess precursor steroids into the androgen synthesis pathway. The elevated androgen levels then cause pre- and postnatal virilization.

Steroid 21-hydroxylase deficiency has a wide range of clinical manifestations that are associated with more or less severe defects of the CYP21A2 gene. Over 15 years ago, it was found that CYP21A2 and the highly homologous but deficient pseudogene CYP21A1P lie in the central region of the human major histocompatibility complex (MHC) near the two genes encoding the fourth component of complement (C4A and C4B) in a tandemly duplicated arrangement (6,7). The C4 genes may be 20.5 or 14.2 kb in size, depending on the presence or absence of an endogenous retroviral sequence in the ninth intron. On the telomeric side, the CYP21/C4 region is flanked by the RP1 gene (also named G11 or STK19), which encodes a serine–threonine kinase (810). Centromeric to the CYP21/C4 region lies TNXB, which encodes the extracellular matrix protein tenascin-X (1113). The stretch of DNA that is duplicated encompasses part of RP1, all of C4, all of CYP21 and part of TNXB. In this report, we will use the shorthand notation ‘RCCX module’ (9,14,15), derived from the names of the above-mentioned genes (RPC4CYP21TNX) for the duplicated region. The RCCX module may be ‘long’ or ‘short’ depending on the size of the C4 gene. Most chromosomes bear two modules, with a CYP21A2 gene in the centromeric and a CYP21A1P gene in the telomeric position (Fig. 1), but monomodular and trimodular haplotypes are common in most populations studied (2,15), including the Dutch (16). The duplicated sections of TNXB and RP1 are truncated pseudogenes named TNXA and RP2, respectively.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 1. Overview of the C4/CYP21 area, showing two RCCX modules as found on most chromosomes. TNXB is the full-size 68 kb gene for tenascin-X, TNXA (shown as a hatched box; also known as XA) is a truncated pseudogene of 5.7 kb that lacks most of the coding sequence of TNXB and has a deletion of 120 bp (indicated by the small triangle) spanning an exon–intron boundary (1114). CYP21A2 (also known as CYP21B) is the active steroid 21-hydroxylase gene; CYP21A1P (shown in black; also known as CYP21A) is a full-size pseudogene containing several deleterious mutations throughout its sequence, including three in-phase stop codons (27). The C4 genes express variants of the fourth component of complement with different affinities, known as C4A and C4B. The arrangement with C4A in the telomeric and C4B in the centromeric module is common, but the specificity of the C4 genes cannot be determined by means of the restriction sites shown, and many alternative arrangements have been described in the literature. About three-quarters of all RCCX modules are ‘long’ (33 kb in size); the others are ‘short’ (27 kb). The difference depends on the presence or absence of an endogenous retroviral sequence in one of the introns of the C4 gene. The arrows show the orientation of transcription; there is an overlap between the 3' sections of the oppositely transcribed genes TNXB and CYP21A2, and of TNXA and CYP21A1P, respectively. Bottom: characteristic TaqI and BglII restriction fragments. Top: scale in kb, with the centromeric RCCX duplication boundary at 0.

 
TaqI and BglII restriction analyses of genomic DNA have become tried-and-proven methods to establish the overall genetic arrangement of the CYP21/C4 region (7,1722). TaqI polymorphisms are especially useful because they provide information about several genes: (i) because of a polymorphism in the 5' flank, CYP21A2 is characterized by a 3.7 kb TaqI fragment and CYP21A1P by a 3.2 kb fragment (6,7); (ii) because of a 120 bp deletion in TNXA that does not occur in TNXB (1114), TNXB is characterized by a 2.5 kb TaqI fragment and TNXA by a 2.4 kb fragment (7,21); (iii) the size and the position (but not the C4A or C4B specificity) of the C4 genes can be deduced: a telomeric ‘long’ C4 gene is characterized by a 7.0 kb TaqI fragment, a telomeric ‘short’ C4 gene by a 6.4 kb fragment, a non-telomeric ‘long’ C4 gene by a 6.0 kb TaqI fragment and a non-telomeric ‘short’ C4 gene by a 5.4 kb fragment (in this context, the term ‘telomeric’ refers to the C4 gene adjacent to RP1, and ‘non-telomeric’ to C4 genes adjacent to RP2) (15,18,22). BglII restriction patterns show the number of modules: there is always one 11 kb fragment representing the centromeric module, and a 12 kb fragment for each of the other modules. These fragments and probing strategies used to detect them have been discussed in detail elsewhere (2,18,2022).

Studies of TaqI and BglII restriction fragment ratios of 21-hydroxylase deficiency alleles early on led to their classification into three main categories of defects:

(1) chromosomes with a CYP21A1P-like gene and no CYP21A2 gene (‘CYP21A2 deletions’);

(2) chromosomes with two CYP21A1P-like genes and no CYP21A2 gene (‘large-scale gene conversions’);

(3) chromosomes with at least one (defective) CYP21A2 gene; here, further analysis demonstrated that most (but not all) defective CYP21A2 genes carried one or more of a limited set of mutations typically found in CYP21A1P, and these defects were therefore designated ‘small-scale gene conversions’.

Although the names of these categories suggest that each has been generated by a specific genetic mechanism, this classification was primarily based on the difference between each category and the typical arrangement shown in Figure 1 (with one CYP21A2 and one CYP21A1P gene). It was soon recognized that the first two categories (‘deletions’ and ‘large-scale conversions’) typically carry a hybrid gene with the 5' portion of CYP21A1P joined onto the 3' portion of CYP21A2 (20,2326). Since the 5' portion contains the extra TaqI site (6,7,27), the hybrid is recognized as a CYP21A1P-like gene in restriction analysis of genomic DNA. However, since the neighbouring TNXB gene remains unaffected in such hybrids, its characteristic 2.5 kb TaqI fragment is retained. Consequently, the ratio between the 12 and 11 kb BglII fragments is the same as between the 2.4 and 2.5 kb TaqI fragments in these haplotypes (2,21).

Unequal meiotic crossover is believed to be the mechanism causing CYP21A2 deletions, a notion firmly supported by studies of deletion haplotypes (7,20,23,2830) and de novo events (31; P.F.J. Koppens, H.J.M. Smeets, I.J. de Wijs and H.J. Degenhart, manuscript in preparation). The location of the recombination breakpoint determines the size of the pseudogene-like portion, and hence the genetic defects carried by these deletion chromosomes. While in rare cases, enough of CYP21A2 has been retained to produce a partially active 21-hydroxylase enzyme (32), nearly all of the hybrid genes studied so far include at least an 8 bp deletion in the third exon, leading to premature termination of translation (2426,29,30). Recently, breakpoint locations beyond the 3' end of CYP21A2 have been found (14,33,34; P.F.J. Koppens, H.J.M. Smeets, I.J. de Wijs, H.J. Degenhart, manuscript in preparation). Such alleles carry an additional genetic defect, because a part of the tenascin-X-producing TNXB gene has been replaced by its TNXA counterpart, containing a 120 bp deletion on an exon–intron boundary. In these haplotypes, the TNXBTNXA hybrid is characterized by a 2.4 kb rather than a 2.5 kb TaqI fragment, and the above-mentioned parity with the BglII 12 and 11 kb fragment ratio does not apply. A homozygous defect of TNXB causes type II Ehlers–Danlos syndrome, a connective-tissue disease (33,34).

Insight into the mechanisms of gene conversions has not progressed at the same pace, however. The ‘large-scale gene conversion’ chromosomes with two CYP21A1P-like genes (that is, two genes characterized by a 3.2 kb TaqI fragment) indeed carry a stretch of CYP21A1P-like DNA encompassing several exons (25,26), although here too an exception where the ‘converted’ region was limited in size and the gene retained some activity has been demonstrated (35). Most ‘small-scale gene conversions’, on the other hand, involve a stretch of CYP21A1P-like DNA that is at most a few hundred base pairs in size and contains only one recognizable mutation as a marker of ‘CYP21A1P-ness’.

We here report on the extension of the pseudogene-like region in bimodular chromosomes with two CYP21A1P-like genes (termed ‘large-scale gene conversions’ in the above-mentioned categorization). Out of nine such haplotypes in a population of steroid 21-hydroxylase deficiency from 39 families studied by us, five had a CYP21A1PCYP21A2 transition zone in the CYP21A2 gene, but the other four were pseudogene-like well into the TNXB gene. This implies that ~10% of the patients with classical 21-hydroxylase deficiency in the population that we studied are also carriers of tenascin-X deficiency. Thus, defectiveness of the TNXB gene due to the 120 bp deletion normally found in the TNXA pseudogene appears to be much more common than previously reported, and also much more common in bimodular ‘conversion’ haplotypes than in monomodular ‘deletion’ haplotypes.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
CYP21/C4 haplotyping
We determined CYP21/C4 haplotypes in a population of 39 Dutch families of steroid 21-hydroxylase deficiency patients (16,26) using TaqI and BglII restriction analysis and CYP21A2 and C4 cDNA probes. The principal markers for CYP21A2 and CYP21A1P are the 3.7 and 3.2 kb TaqI fragments, respectively (Fig. 1). The 3' flanking region of these genes is usually investigated by BglII digestion, because the CYP21A2 cDNA probe overlaps the 2.4 and 2.5 kb TaqI fragments in this region by only a few hundred base pairs, often resulting in poor visualization of the bands. Normally, the estimated ratio of the TaqI 2.4 and 2.5 kb bands is equal to the ratio of the BglII 12 and 11 kb bands. However, we could distinguish the 2.4 and 2.5 kb bands on many autoradiograms (Table 1), and in some patients with an apparent ‘large-scale conversion’ of CYP21A2 into CYP21A1P, a discrepancy between the TaqI and BglII patterns clearly existed. An example of a family study is shown in Figure 2; the results were interpreted as follows: lane 1 (father): two bimodular chromosomes with a total of two CYP21A2 genes, two CYP21A1P genes, two long telomeric C4 genes and two long non-telomeric C4 genes; lane 2 (mother): one bimodular and one monomodular chromosome with a total of one CYP21A2 gene, two CYP21A1P genes, two long telomeric C4 genes, and one short non-telomeric C4 gene; lane 3 (healthy sister of the patient): one bimodular and one monomodular chromosome with a total of two CYP21A2 genes, one CYP21A1P gene, two long telomeric C4 genes and one long non-telomeric C4 gene; lane 4 (patient with salt-losing steroid 21-hydroxylase deficiency): two bimodular chromosomes with a total of one CYP21A2 gene, three CYP21A1P genes, two long telomeric C4 genes, and one short and one long non-telomeric C4 gene. The band ratios (listed in Table 1: family 19) were determined by laser densitometry as reported earlier (16). CYP21A2 mutation analysis (26) showed that the paternal defect was the common splice junction mutation in the second intron (Fig. 2A). The following haplotypes were deduced: a and b (paternal): CYP21A2C4long–CYP21A1PC4long [haplotype A1 in our earlier report (16)]; c (maternal): CYP21A2C4long (haplotype B1); d (maternal): CYP21A1PC4short–CYP21A1PC4long (haplotype D2). Lane 5 in Figure 2 shows an example of a person (not related to family 19) with two monomodular chromosomes: one with a CYP21A2 gene and a long C4 gene and one with a CYP21A1P gene and a long C4 gene.


View this table:
[in this window]
[in a new window]
 
Table 1. Family studies of bimodular CYP21/C4/TNX haplotypes without a CYP21A2 gene
 


View larger version (70K):
[in this window]
[in a new window]
 
Figure 2. Family study of TaqI and BglII restriction patterns and CYP21A2 defects. (A) Pedigree with CYP21A2 mutations at nucleotide 656 assigned to each haplotype. (B) TaqI restriction patterns of genomic DNA hybridized to a mixture of the CYP21A2 and C4 cDNA probes; fragment sizes are in kb; the C4 fragment sizes listed (7.0, 6.0, 5.4) are those traditionally used in the literature (18), although the actual fragments are ~0.15 kb larger. (C) BglII restriction patterns obtained with the CYP21A2 probe only. Lanes 1–4: father, mother, healthy sister, patient. Lane 5: unrelated individual with two monomodular chromosomes, one with a CYP21A2 gene and one with a CYP21A1P pseudogene; the C4 gene on each chromosome is ‘long’.

 
Surprisingly, the band ratio of the TaqI 2.5 and 2.4 kb fragments deviates from the band ratio of the BglII 11 and 12 kb fragments in the mother and the patient in family 19 (Figure 2: lanes 2 and 4). This finding, which suggests that the TNXB gene on this chromosome is in part TNXA-like, triggered the subsequent investigation of the structure of TNXB on similar bimodular ‘conversion’ haplotypes. Table 1 shows the relative band intensities and the deduced haplotypes for all eight families where such a CYP21A1PCYP21A1P haplotype was found. Haplotype designations are the same as in our earlier report (16). The families listed in Table 1 represent nine CYP21A1PCYP21A1P haplotypes. Even though the 2.4 and 2.5 kb TaqI fragments could not always be distinguished clearly, four of these nine haplotypes apparently had two 2.4 kb TaqI fragments and no 2.5 kb fragment; these chromosomes all had one short and one long C4 gene. This suggested that the 120 bp deletion was present not only in TNXA, as expected, but also in TNXB. The other five chromosomes carried a 2.4 kb and a 2.5 kb TaqI fragment, indicating that they did not have the 120 bp deletion in TNXB; four of these had two long C4 genes, while in one case (family 3), two interpretations were possible (Table 1). We found such apparent discrepancies between the BglII and TaqI restriction fragments on two other chromosomes. One of these carried steroid 21-hydroxylase deficiency and resulted from a de novo unequal crossover generating a monomodular chromosome (P.F.J. Koppens, H.J.M. Smeets, I.J. de Wijs and H.J. Degenhart, manuscript in preparation). The other was found in a control on a bimodular chromosome where the TNXA gene had partly assumed a TNXB-like structure that is probably the same as reported earlier (36). All other chromosomes tested, including 15 monomodular CYP21A2 deletion’ alleles, had the 120 bp present in TNXB and, for multimodular chromosomes, absent in TNXA. Table 2 lists the frequencies of the haplotypes carrying steroid 21-hydroxylase in our study group.


View this table:
[in this window]
[in a new window]
 
Table 2. CYP21/C4/TNX haplotypes carrying classical steroid 21-hydroxylase deficiency in Dutch patients
 
Characteristics of normal TNXA and TNXB genes
The presence of a TNXA-like 120 bp deletion in the TNXB gene adjacent to the centromeric CYP21A1P gene in four of the nine ‘large-scale conversion’ haplotypes in our population would imply that these steroid 21-hydroxylase deficiency patients would also be carriers of tenascin-X deficiency. To confirm this finding and to further characterize the putative TNXBTNXA hybrid, a 2.8 kb region of either TNXA or TNXB was specifically amplified. This region was selected because the forward primer lies upstream of the duplication boundary and is specific to TNXA or TNXB, while the reverse primer lies downstream of the 120 bp deletion (in this context, ‘downstream’ is relative to the transcription of the TNXB gene). Thus, the amplified region includes the TNXBTNXA transition zone in the hybrid (Fig. 3).



View larger version (12K):
[in this window]
[in a new window]
 
Figure 3. Amplified region of the TNXB and TNXA genes. Open boxes are exons; the triangle indicates the site of the 120 bp deletion. The bold arrows represent the primer sites for the TNX PCRs; the reverse primer is the same for both genes, but the forward primers are specific and their starting positions differ by 36 bp. Polymorphic restriction sites deduced from published TNXA and TNXB sequences are shown. The centre of the figure indicates the extent of the PflMI restriction fragments (2344, 2688, 2808) shown in Figure 4.

 
To further narrow down the location of the TNXBTNXA breakpoint, we searched for informative differences between normal TNXA and TNXB genes, other than the 120 bp deletion. Comparison of published TNX sequences [EMBL/GenBank/DDBJ accession nos S38953 (11), X71937 (13), AF077974 (36), AL049547 (37), AF019413 (38), U89337 (39), AF086641 (14) and L26263 (9,40)] revealed several neutral polymorphisms throughout the amplified region, some of which can be detected by restriction analysis: PflMI at 276 bp downstream of the duplication boundary of the RCCX module, StyI at 719 bp, BstUI at 1626 bp, and PvuII at 2190 bp [Fig. 3; sequence AL049547 (37) was used to compute fragment sizes and nucleotide positions]. In contrast to the 120 bp deletion, these differences do not cause a defect in the TNX gene, so they cannot a priori be considered pseudogene (TNXA)-like, and sequencing of the TNXATNXB hybrids would not locate a typical transition point. To determine which of the polymorphisms could be used as specific markers, we amplified a large number of TNXA and TNXB genes from individuals with one to three copies of TNXA and two copies of TNXB, digested the products with the restriction endonucleases mentioned above, and analysed them on agarose or polyacrylamide gels.

The most informative restriction sites to distinguish TNXA from TNXB were the PflMI site (present in 193 out of 241 TNXA genes and 0 out of 294 TNXB genes) and the PvuII site (present in 5 out of 131 TNXA genes and 85 out of 129 TNXB genes). The StyI and BstUI sites were highly polymorphic in both genes, and therefore could not be used as a reliable marker of either TNXA or TNXB. All 298 TNXB genes tested contained the 120 bp deletion, as opposed to only 1 out of 270 TNXA genes.

Characteristics of TNXBTNXA hybrid genes
Since the amplified region contains only a single PflMI site, detection of this polymorphism and of the 120 bp difference could conveniently be done in a single experiment. Figure 3 shows the fragments that can be expected after PflMI restriction of the TNXA and TNXB PCR products; the restriction fragments found in each family with a ‘large-scale conversion’ haplotype are listed in Table 1.

Typical PflMI banding patterns are shown in Figure 4. Out of the four bimodular CYP21A1PCYP21A1P chromosomes with the 120 bp deletion in TNXB, one carried the PflMI site at bp 276 (Fig. 4: lane 6); the remaining three, and the five CYP21A1PCYP21A1P chromosomes without the 120 bp deletion in TNXB, did not have this site (Fig. 4: lane 5). This shows that in one case, the transition between a TNXA-like sequence and a TNXB-like sequence lies within 276 bp of the RCCX duplication boundary. In the other three cases, the transition probably lies further downstream, because absence of the PflMI site is a TNXB-like feature (although it also occurs in ~20% of the TNXA genes). All four genes are, of course, TNXA-like at the site of the 120 bp insertion (bp 2290) and possibly already at bp 2190, since they did not carry a PvuII site found in most TNXB genes (results not shown).



View larger version (60K):
[in this window]
[in a new window]
 
Figure 4. PflMI restriction analysis of PCR-amplified fragments of the TNXA and TNXB genes. Lane 1: TNXA without the PflMI site. Lane 2: TNXA, heterozygous for the PflMI site. Lane 3: TNXA, homozygous for the PflMI site. Lane 4: TNXB, no PflMI site. Lane 5: TNXB, heterozygous for the 120 bp deletion without the PflMI site. Lane 6: TNXB, heterozygous for the 120 bp deletion with the PflMI site. Left: 5 µl SmartLadder (Eurogentec, Seraing, Belgium); electrophoresis was for 28 h at 40 V on 1% agarose.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
TNXBTNXA hybrids
Combined defectiveness of the CYP21A2 and TNXB genes has so far been described in a few isolated cases in CYP21A2 deletions caused by meiotic unequal crossover. We here report that such ‘double–deficiency’ alleles are indeed rare on monomodular chromosomes, but relatively common (four out of nine cases) on bimodular chromosomes with two CYP21A1P-like genes (usually termed ‘large-scale conversions’ in the literature). This haplotype is characterized by two 2.4 kb TaqI fragments matching the 120 bp deletion in both TNX genes, and distinguishing it from previously described ‘large-scale conversions’ which have one 2.4 and one 2.5 kb fragment. Given the large number of CYP21A2/C4 haplotyping reports available to date [most of which were recently reviewed by White and Speiser (5)], it is surprising that this haplotype has not been documented before: an apparently similar case was reported only once (41), before the discovery of the TNX genes. Poor resolution or poor visualization of the 2.4 and 2.5 kb bands sometimes (but not always) hampers the analysis when a CYP21A2 cDNA probe is used. However, studies with probes that overlap a large part of these fragments (15,21,42) did not detect this haplotype either. To find the TNXBTNXA transition zone in this type of hybrid, we checked which of the polymorphisms in published TNX sequences (for references, see the Results section) are reliable markers of ‘TNXA-ness’ or ‘TNXB-ness’. A characteristic PflMI site at 276 bp downstream of the RCCX duplication boundary was present in one of the four TNXBTNXA hybrids, but absent in the others, indicating that at least two distinct transition zones exist: upstream of the PflMI site in one case (family 14) and downstream in the others (Table 1 and Fig. 5). Previously, we characterized the CYP21P pseudogenes in these, and other, haplotypes. The haplotype with the PflMI site (in family 14; Table 1) also carried different CYP21P genes than the other three haplotypes [see Table 5 in our earlier report (26): second haplotype of family 14]. This suggests that these hybrids (Fig. 5C,D) were created by independently occurring recombinations instead of a by a single event followed by secondary mutation that caused the PflMI difference. In our patient group (26), TNXBTNXA hybrids were found on 4 out of 77 chromosomes, a frequency of 0.052 (95% confidence interval 0.018–0.12) (43). Considering a carrier rate for classical steroid 21-hydroxylase deficiency of ~1 : 50, we estimate the frequency of such dual-deficiency alleles in the general population in The Netherlands at 1 : 1000. Since two independent variants exist in the relatively small patient group examined here, it seems likely that a systematic re-evaluation of apparent large-scale conversions in other populations by a suitable PCR method (33; this report) will detect similar haplotypes. Interestingly, TNXBTNXA hybrid genes were recently reported in two Dutch patients suffering from Ehlers–Danlos syndrome (34). The number of RCCX modules was not determined in that study, so it seems possible that these patients have the bimodular structure described here.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 5. Amplified region of TNXA and TNXB (bottom) showing the site of the 120 bp deletion (triangle) in TNXA and the beginning of the TaqI fragment that partly overlaps the CYP21A2 or CYP21A1P gene (Fig. 1). The location of the TaqI site in the TNX genes is the same relative to the nearby RCCX duplication boundary, but the 120 bp size difference determines whether the fragment is 2.4 or 2.5 kb. The polymorphic sites used as markers for TNXA or TNXB are shown. The four amplified stretches of DNA are (A) regular TNXA PCR; (B) regular TNXB PCR, which produces similar stretches for a haplotype with a normal CYP21A2 gene and one with a CYP21A2CYP21A1P hybrid; (C) and (D) TNXB PCR of a TNXB–TNXA hybrid with two different conversion zones, typical of the novel haplotype described here. TNXA-like sequences are shown in black and TNXB-like sequences in white, and putative transition zones between them are hatched. Top: scale in bp.

 
Recombinational mechanisms
Chromosomes carrying two RCCX modules, each with a CYP21A1P-like gene, have been called ‘large-scale gene conversions’ because, as compared with the typical layout, the CYP21A2 gene appears to have been converted into a CYP21A1P gene. It has, however, become clear that the ‘converted’ CYP21A1P gene on such chromosomes is either a CYP21A1PCYP21A2 hybrid (25,26) or a regular CYP21A1P gene adjacent to a TNXATNXB hybrid (this report), and thus structurally indistinguishable from the CYP21A1P genes on ‘CYP21A2-deletion’ chromosomes. Crossing-over between misaligned monomodular and bimodular chromosomes during meiosis was proposed more than a decade ago as a mechanism causing CYP21A2 deletions (1,7,15,20,28). Two more recent reports (14,36) have described this mechanism in considerable detail for CYP21A2 deletions where the putative recombination occurred within the TNX genes. The recombination breakpoint in the TNXBTNXA hybrid (on a monomodular chromosome) described there (14) was localized between the 120 bp deletion and the centromeric duplication boundary of the RCCX module, and this hybrid is therefore quite similar to those described here on bimodular chromosomes. Although definite proof awaits the description of a de novo event, the structural similarity makes it highly likely that bimodular CYP21A1PCYP21A1P haplotypes arise by the same mechanism as monomodular CYP21A1P-only haplotypes, namely meiotic unequal crossover: in this case involving a trimodular CYP21A1PCYP21A1PCYP21A2 chromosome (1,15). Such a recombination between a bimodular and a monomodular chromosome (1) would only differ from those described elsewhere (14,20,36) by the presence of one additional RCCX module on each chromosome. An outline of these putative recombination events is shown in Figure 6. We therefore propose that, in this context, the term ‘gene conversion’ be reserved for small-scale events only, ideally with demonstrable non-converted regions on either side of the converted region. Gene conversion is indeed a reasonable explanation for small-scale CYP21A2CYP21A1P sequence transfer, as supported by studies of de novo mutations (4446) and sperm cells (47). Although historically understandable, the term ‘large-scale gene conversion’ in its present sense suggests a mechanism that probably never occurs between RCCX modules. Instead, the term ‘CYP21A2 deletion by unequal crossover’ adequately describes all chromosomes with a hybrid RCCX module and without a CYP21A2 gene, irrespective of the number of CYP21A1P genes.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 6. Putative unequal crossovers producing bimodular haplotypes with two CYP21P-like genes. (A) Crossover producing a CYP21A2CYP21A1P hybrid. (B) Crossover producing a TNXBTNXA hybrid. Black, CYP21A1P; hatched, TNXA; the triangle represents the 120 bp deletion in TNXA. The exact crossover site may vary within the TNX or CYP21 genes.

 

    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Subjects and haplotyping
The study population of 21-hydroxylase deficiency patients, family members and controls was the same as before (26); a family where a de novo CYP21 deletion occurred was now included into the haplotype count in Table 2. CYP21/C4 haplotyping was done as described earlier (2,16). Briefly, TaqI and BglII restriction patterns were obtained with the CYP21A2 cDNA probe pC21/3c (6) and the 5' section of the C4 cDNA probe pAT-A (48). Band ratios were measured by laser densitometry, and haplotypes were deduced from the segregation of the patterns (16).

Amplification and restriction analysis of TNXA and TNXB
Parts of TNXA and TNXB that encompass the site of the 120 bp deletion normally found in TNXA only were specifically amplified. The forward primer for TNXB (TCTCTGCCCTGGGAATGACAG) lies beyond the duplication boundary of the RCCX module, in the large non-duplicated part of the TNXB gene. The forward primer for TNXA (CTTGAGCTGCAGATGGGATAC) lies within the RP2 pseudogene. The reverse primer (CAATCCCCACCCTGAACAAGT) was the same for both genes, and lies between the site of the 120 bp deletion and the 3' end of the CYP21A2/CYP21A1P gene (Fig. 3). A touchdown PCR protocol was used to amplify these stretches of ~2.8 kb: first, 8 cycles of 30 s at 94°C, 60 s at 66°C decreasing by 0.5°C/cycle, and 3 min at 72°C; next, 26 cycles of 30 s at 94°C, 60 s at 62°C, and 3 min at 72°C extending by 30 s per cycle. Amplification was done with 0.5 units of Thermoperfect DNA polymerase (Integro, Leuvenheim, The Netherlands) in the presence of 1.5 mM MgCl2 and 1% formamide. The size of the PCR product directly shows the presence or absence of the 120 bp deletion/insertion. For further analysis, the PCR products were digested with PflMI (New England Biolabs, Beverly, MA, USA), StyI (Eurogentec, Seraing, Belgium), BstUI (New England Biolabs, Beverly, MA, USA) or PvuII (Gibco BRL, Gaithersburg, MD, USA). The products were analysed on agarose or polyacrylamide gels.


    ACKNOWLEDGEMENTS
 
The authors wish to thank Professor Dr S.L.S. Drop and Dr S.M.P.F. de Muinck Keizer-Schrama (Sophia Children's Hospital, Rotterdam), Dr W. Deetman-Oostdijk and Dr J. Derksen (Leiden University Medical Centre), and Dr J.J.J. Waelkens (Catharina Hospital, Eindhoven) for providing the families' blood samples, and Dr D.J.J. Halley for her valuable comments about the manuscript.


    FOOTNOTES
 
* To whom correspondence should be addressed at: Erasmus MC, Laboratory of Paediatrics, Room Ee1502b, PO Box 1738, 3000 DR Rotterdam, The Netherlands. Tel: +31 104088047; Fax: +31 104089486; Email: koppens{at}kgk.fgg.eur.nl Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
1 Strachan, T. (1990) Molecular pathology of congenital adrenal hyperplasia. Clin. Endocrinol., 32, 373–393.[Medline]

2 New, M.I. (1998) Diagnosis and management of congenital adrenal hyperplasia. Annu. Rev. Med., 49, 311–328.[Web of Science][Medline]

3 Morel, Y. and Miller, W.L. (1991) Clinical and molecular genetics of congenital adrenal hyperplasia due to 21-hydroxylase deficiency. Adv. Hum. Genet., 20, 1–68.[Medline]

4 Wedell, A. (1998) Molecular genetics of congenital adrenal hyperplasia (21-hydroxylase deficiency): implications for diagnosis, prognosis and treatment. Acta Paediatr., 87, 159–164.[Web of Science][Medline]

5 White, P.C. and Speiser, P.W.(2000) Congenital adrenal hyperplasia due to 21-hydroxylase deficiency. Endocr. Rev., 21, 245–291.[Abstract/Free Full Text]

6 White, P.C., Grossberger, D., Onufer, B.J., Chaplin, D.D., New, M.I., Dupont, B. and Strominger, J.L. (1985) Two genes encoding steroid 21-hydroxylase are located near the genes encoding the fourth component of complement in man. Proc. Natl Acad. Sci. USA, 82, 1089–1093.[Abstract/Free Full Text]

7 Carroll, M.C., Palsdottir, A., Belt, K.T. and Porter, R.R. (1985) Deletion of complement C4 and steroid 21-hydroxylase genes in the HLA class III region. EMBO J., 4, 2547–2552.[Web of Science][Medline]

8 Sargent, C.A., Anderson, M.J., Hsieh, S.L., Kendall, E., Gomez-Escobar, N. and Campbell, R.D. (1994) Characterisation of the novel gene G11 lying adjacent to the complement C4A gene in the human major histocompatibility complex. Hum. Mol. Genet., 3, 481–488.[Abstract/Free Full Text]

9 Shen, L., Wu, L.C., Sanlioglu, S., Chen, R., Mendoza, A.R., Dangel, A.W., Carroll, M.C., Zipf, W.B. and Yu, C.Y. (1994) Structure and genetics of the partially duplicated gene RP located immediately upstream of the complement C4A and the C4B genes in the HLA class III region. J. Biol. Chem., 269, 8466–8476.[Abstract/Free Full Text]

10 Gomez-Escobar, N., Chou, C.F., Lin, W.W., Hsieh, S.L. and Campbell, R.D. (1998) The G11 gene located in the major histocompatibility complex encodes a novel nuclear serine/threonine protein kinase. J. Biol. Chem., 47, 30954–30960.

11 Gitelman, S.E., Bristow, J. and Miller, W.L. (1992) Mechanism and consequences of the duplication of the human C4/P450c21/gene X locus. Mol. Cell. Biol., 12, 2124–2134; 3313.[Abstract/Free Full Text]

12 Matsumoto, K., Ishihara, N., Ando, A., Inoko, H. and Ikemura, T. (1992) Extracellular matrix protein tenascin-like gene found in human MHC class III region. Immunogenetics, 36, 400–403.[Web of Science][Medline]

13 Bristow, J., Tee, M.K., Gitelman, S.E., Mellon, S.H. and Miller, W.L. (1993) Tenascin-X: a novel extracellular matrix protein encoded by the human XB gene overlapping P450c21B. J. Cell Biol., 122, 265–278.[Abstract/Free Full Text]

14 Yang, Z., Mendoza, A.R., Welch, T.R., Zipf, W.B. and Yu, C.Y. (1999) Modular variations of the human major histocompatibility complex class III genes for serine/threonine kinase RP, complement component C4, steroid 21-hydroxylase CYP21, and tenascin TNX (the RCCX module). J. Biol. Chem., 274, 12147–12156.[Abstract/Free Full Text]

15 Blanchong, C.A., Zhou, B., Rupert, K.L., Chung, E.K., Jones, K.N., Sotos, J.F., Zipf, W.B., Rennebohm, R.M. and Yu, C.Y. (2000) Deficiencies of human complement component C4A and C4B and heterozygosity in length variants of RP–C4–CYP21–TNX (RCCX) modules in Caucasians: the load of RCCX genetic diversity on major histocompatibility complex-associated disease. J. Exp. Med., 191, 2183–2196.[Abstract/Free Full Text]

16 Koppens, P.F.J., Hoogenboezem, T., Halley, D.J.J., Barendse, C.A.M., Oostenbrink, A.J. and Degenhart, H.J. (1992) Family studies of the steroid 21-hydroxylase and complement C4 genes define 11 haplotypes in classical congenital adrenal hyperplasia in The Netherlands. Eur. J. Pediatr., 151, 885–892.[Web of Science][Medline]

17 Donohoue, P.A., Van Dop, C., Jospe, N. and Migeon, C.J. (1986) Congenital adrenal hyperplasia: molecular mechanisms resulting in 21-hydroxylase deficiency. Acta Endocrinol., 113 (Suppl. 279), 315–320.

18 Schneider, P.M., Carroll, M.C., Alper, C.A., Rittner, C., Whitehead, A.S., Yunis, E.J. and Colten, H.R. (1986) Polymorphism of the human complement C4 and steroid 21-hydroxylase genes. Restriction fragment length polymorphisms revealing structural deletions, homoduplications, and size variants. J. Clin. Invest., 78, 650–657.[Web of Science][Medline]

19 Higashi, Y., Tanae, A., Inoue, H. and Fujii-Kuriyama, Y. (1988) Evidence for frequent gene conversion in the steroid 21-hydroxylase P-450(C21) gene: implications for steroid 21-hydroxylase deficiency. Am. J. Hum. Genet., 42, 17–25.[Web of Science][Medline]

20 White, P.C., Vitek, A., Dupont, B. and New, M.I. (1988) Characterization of frequent deletions causing steroid 21-hydroxylase deficiency. Proc. Natl Acad. Sci. USA, 85, 4436–4440.[Abstract/Free Full Text]

21 Morel, Y., André, J., Uring-Lambert, B., Hauptmann, G., Bétuel, H., Tossi, M., Forest, M.G., David, M., Bertrand, J. and Miller, W.L. (1989) Rearrangements and point mutations of P450c21 genes are distinguished by five restriction endonuclease haplotypes identified by a new probing strategy in 57 families with congenital adrenal hyperplasia. J. Clin. Invest., 83, 527–536.[Web of Science][Medline]

22 Schneider, P.M. (1990). C4 DNA RFLP reference typing report. Compl. Inflamm., 7, 218–224.

23 Donohoue, P.A., Guethlein, L., Collins, M.M., Van Dop, C., Migeon, C.J., Bias, W.B. and Schmeckpeper, B.J. (1995) The HLA-A3,Cw6,B47,DR7 extended haplotypes in salt losing 21-hydroxylase deficiency and in the Old Order Amish: identical class I antigens and class II alleles with at least two crossover sites in the class III region. Tissue Antigens, 46, 163–172.[Web of Science][Medline]

24 Helmberg, A., Tabarelli, M., Fuchs, M.A., Keller, E., Dobler, G., Schnegg, I., Knorr, D., Albert, E. and Kofler, R. (1992) Identification of molecular defects causing congenital adrenal hyperplasia by cloning and differential hybridization of polymerase chain reaction-amplified 21-hydroxylase (CYP21) genes. DNA Cell Biol., 11, 359–368.[Web of Science][Medline]

25 Levo, A. and Partanen, J. (1997) Mutation–haplotype analysis of steroid 21-hydroxylase (CYP21) deficiency in Finland. Implications for the population history of defective alleles. Hum. Genet., 99, 488–497.[Web of Science][Medline]

26 Koppens, P.F.J., Hoogenboezem, T. and Degenhart, H.J.(2000) CYP21 and CYP21P variability in steroid 21-hydroxylase deficiency patients and in the general population in The Netherlands. Eur. J. Hum. Genet., 8, 827–836.[Web of Science][Medline]

27 Higashi, Y., Yoshioka, H., Yamane, M., Gotoh, O. and Fujii-Kuriyama, Y. (1986) Complete nucleotide sequence of two steroid 21-hydroxylase genes tandemly arranged in human chromosome: a pseudogene and a genuine gene. Proc. Natl Acad. Sci. USA, 83, 2841–2845.[Abstract/Free Full Text]

28 Rumsby, G., Carroll, M.C., Porter, R.R., Grant, D.B. and Hjelm, M. (1986) Deletion of the steroid 21-hydroxylase and complement C4 genes in congenital adrenal hyperplasia. J. Med. Genet., 23, 204–209.[Abstract/Free Full Text]

29 Chu, X., Braun-Heimer, L., Rittner, C. and Schneider, P.M. (1992) Identification of the recombination site within the steroid 21-hydroxylase gene (CYP21) of the HLA-B47,DR7 haplotype. Exp. Clin. Immunogenet., 9, 80–85.[Web of Science][Medline]

30 Lee, H.H., Chang, J.G., Tsai, C.H., Tsai, F.J., Chao, H.T. and Chung, B.C. (2000) Analysis of the chimeric CYP21P/CYP21 gene in steroid 21-hydroxylase deficiency. Clin. Chem., 46, 606–611.[Abstract/Free Full Text]

31 Sinnott, P.J., Collier, S., Costigan, C., Dyer, P.A., Harris, R. and Strachan, T. (1990) Genesis by meiotic unequal crossover of a de novo deletion that contributes to steroid 21-hydroxylase deficiency. Proc. Natl Acad. Sci. USA, 87, 2107–2111.[Abstract/Free Full Text]

32 l'Allemand, D., Tardy, V., Grüters, A., Schnabel, D., Krude, H. and Morel, Y. (2000) How a patient homozygous for a 30-kb deletion of the C4–CYP21 genomic region can have a nonclassic form of 21-hydroxylase deficiency. J. Clin. Endocr. Metab., 85, 4562–4567.[Abstract/Free Full Text]

33 Burch, G.H., Gong, Y., Liu, W., Dettman, R.W., Curry, C.J., Smith, L., Miller, W.L. and Bristow, J. (1997) Tenascin-X deficiency is associated with Ehlers–Danlos syndrome. Nat. Genet., 17, 104–108.[Web of Science][Medline]

34 Schalkwijk, J., Zweers, M.C., Steijlen, P.M., Dean, W.B., Taylor, G., van Vlijmen, I.M., van Haren, B., Miller, W.L. and Bristow, J. (2001) A recessive form of the Ehlers–Danlos syndrome caused by tenascin-X deficiency. N. Engl. J. Med., 345, 1167–1175.[Abstract/Free Full Text]

35 Killeen, A.A., Sane, K.S. and Orr, H.T. (1991) Molecular and endocrine characterization of a mutation involving a recombination between the steroid 21-hydroxylase functional gene and pseudogene. J. Steroid Biochem. Mol. Biol., 38, 677–686.[Web of Science][Medline]

36 Rupert, K.L., Rennebohm, R.M. and Yu, C.Y. (1999) An unequal crossover between the RCCX modules of the human MHC leading to the presence of a CYP21B gene and a tenascin TNXB/TNXA-RP2 recombinant between C4A and C4B genes in a patient with juvenile rheumatoid arthritis. Exp. Clin. Immunogenet., 16, 81–97.[Web of Science][Medline]

37 Barlow, K.(2000) EMBL/GenBank/DDBJ accession no. AL049547.

38 Rowen, L., Dankers, C., Baskin, D., Faust, J., Loretz, C., Ahearn, M.E., Banta, A., Schwartzell, S., Smith, T.M., Spies, T. and Hood, L. (1999) Sequence determination of 300 kilobases of the human class III MHC locus. EMBL/GenBank/DDBJ accession no. AF019413.

39 Rowen, L., Dankers, C., Baskin, D., Faust, J., Loretz, C., Ahearn, M.E., Banta, A., Schwartzell, S., Smith, T.M., Spies, T. and Hood, L. (1999) Sequence determination of 300 kilobases of the human class III MHC locus. EMBL/GenBank/DDBJ accession no. U89337.

40 Yu, C.Y. (1991) The complete exon–intron structure of a human complement component C4A gene. DNA sequences, polymorphism, and linkage to the 21-hydroxylase locus. J. Immunol., 146, 1057–1066.[Abstract]

41 Dawkins, R.L., Martin, E., Kay, P.H., Garlepp, M.J., Wilton, A.N. and Stuckey, M.S. (1987) Heterogeneity of steroid 21-hydroxylase genes in classical congenital adrenal hyperplasia. J. Immunogenet., 14, 89–98.[Medline]

42 Bachega, T.A.S.S., Billerbeck, A.E.C., Madureira, G., Arnhold, I.J.P., Medeiros, M.A., Marcondes, J.A.M., Longui, C.A., Nicolau, W., Bloise, W. and Mendonça, B.B. (1999) Low frequency of CYP21B deletions in Brazilian patients with congenital adrenal hyperplasia due to 21-hydroxylase deficiency. Hum. Hered., 49, 9–14.[Web of Science][Medline]

43 Linder, A. (1960) Statistische Methoden, 3. Auflage. Birkhäuser Verlag, Basel–Stuttgart, pp. 286–287.

44 Collier, S., Tassabehji, M., Sinnott, P.J. and Strachan, T. (1993) A de novo pathological point mutation at the 21-hydroxylase locus: implications for gene conversion in the human genome. Nat. Genet., 3, 260–265; 4, 101.

45 Tajima, T., Fujieda, K. and Fujii-Kuriyama, Y. (1993) De novo mutation causes steroid 21-hydroxylase deficiency in one family of HLA-identical affected and unaffected siblings. J. Clin. Endocr. Metab., 77, 86–89.[Abstract]

46 Ordoñez-Sánchez, M., Ramírez-Jiménez, S., López-Gutierrez, A.U., Riba, L., Gamboa-Cardiel, S., Cerillo-Hinojosa, M., Altamirano-Bustamante, N., Calzada-León, R., Robles-Valdés, C., Mendoza-Morfín, F. and Tusié-Luna, M.T. (1998) Molecular genetic analysis of patients carrying steroid 21-hydroxylase deficiency in the Mexican population: identification of possible new mutations and high prevalence of apparent germ-line mutations. Hum. Genet., 102, 170–177.[Web of Science][Medline]

47 Tusié-Luna, M.T. and White, P.C. (1995) Gene conversions and unequal crossovers between CYP21 (steroid 21-hydroxylase gene) and CYP21P involve different mechanisms. Proc. Natl Acad. Sci. USA, 92, 10796–10800.[Abstract/Free Full Text]

48 Belt, K.T., Carroll, M.C. and Porter, R.R. (1984) The structural basis of the multiple forms of human complement component C4. Cell, 36, 907–914.[Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Clin. Chem.Home page
S. Parajes, C. Quinterio, F. Dominguez, and L. Loidi
A Simple and Robust Quantitative PCR Assay to Determine CYP21A2 Gene Dose in the Diagnosis of 21-Hydroxylase Deficiency
Clin. Chem., September 1, 2007; 53(9): 1577 - 1584.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
H.-H. Lee, Y.-J. Lee, P. Chan, and C.-Y. Lin
Use of PCR-Based Amplification Analysis as a Substitute for the Southern Blot Method for CYP21 Deletion Detection in Congenital Adrenal Hyperplasia
Clin. Chem., June 1, 2004; 50(6): 1074 - 1076.
[Full Text] [PDF]


Home page
Clin. Chem.Home page
P. F.J. Koppens, H. J. Degenhart, and H.-H. Lee
PCR-based Detection of CYP21 Deletions * One of the authors of the Technical Brief cited above responds:
Clin. Chem., September 1, 2003; 49(9): 1555 - 1557.
[Full Text] [PDF]


Home page
J. Med. Genet.Home page
P F J Koppens, H J M Smeets, I J de Wijs, and H J Degenhart
Mapping of a de novo unequal crossover causing a deletion of the steroid 21-hydroxylase (CYP21A2) gene and a non-functional hybrid tenascin-X (TNXB) gene
J. Med. Genet., May 1, 2003; 40(5): e53 - 53.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (19)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Koppens, P. F.J.
Right arrow Articles by Degenhart, H. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Koppens, P. F.J.
Right arrow Articles by Degenhart, H. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?