Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (12)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Freson, K.
Right arrow Articles by Van Geet, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Freson, K.
Right arrow Articles by Van Geet, C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2002, Vol. 11, No. 22 2741-2750
© 2002 Oxford University Press

Pseudohypoparathyroidism type Ib with disturbed imprinting in the GNAS1 cluster and Gs{alpha} deficiency in platelets

Kathleen Freson1, Chantal Thys1, Christine Wittevrongel1, Willem Proesmans2, Marc F. Hoylaerts1, Jos Vermylen1 and Chris Van Geet1,2,*

1Center for Molecular and Vascular Biology and 2Department of Pediatrics, University of Leuven, Belgium

Received June 13, 2002; Accepted August 8, 2002


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Pseudohypoparathyroidism Ib (PHPIb), characterized by parathyroid hormone-resistant hypocalcemia and hyperphosphatemia, is caused by a deregulation in the imprinting status of the GNAS1 cluster, comprising exons XL, NESP55 and 1A and the coding exons of Gs{alpha}. Differences in methylation of exon 1A and sporadically also of exons XL and NESP55 were found and thought to result in long-range effects on Gs{alpha} expression, limited to the proximal renal tubules. The exact imprinting defect is not precisely localized, and the expected differences in Gs{alpha} protein level and function are mainly hypothetical. We describe a PHPIb patient with lack of methylation of the exon XL and 1A promoters, and biallelic methylation of the NESP55 promoter. Platelets of this patient show a functional Gs defect, decreased cAMP formation upon Gs-receptor stimulation, normal Gs{alpha} sequence but reduced Gs{alpha} protein levels. Transcriptional deregulation between the now biallelically active promoters of both exon 1A and exon 1 of Gs{alpha} could explain the decreased Gs{alpha} expression in platelets and presumably in the proximal renal tubules. We found decreased NESP55 and increased XL{alpha}s protein levels in platelets, in agreement with the methylation status of their corresponding first exons. In a megakaryocytic cell line MEG-01, exon 1A is methylated on both alleles, in contrast to the normally maternally methylated exon 1A in leukocytes. Experimental demethylation of exon 1A in MEG-01 cells led to reduced Gs{alpha} expression, in agreement with the observations in the patient. Platelet studies may therefore allow easy evaluation of disturbances of the GNAS1 cluster in PHPIb patients.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The classical Gs{alpha} gene encodes the {alpha} subunit of the Gs protein (Gs{alpha}), which couples hormonal stimulation of several cell membrane receptors to the activation of adenylyl cyclase (1). Gs{alpha} maps to the chromosome 20q13 region, is located in a complex imprinting domain and is regulated by alternative splicing (MIM 139320) (24). This gene has four alternative first exons that correspond to different promoters, and all splice to the common exons 2–13 of the classical Gs{alpha} gene. Gs{alpha} is biallelically expressed from exon 1, at least in most tissues. The chromogranin-like protein NESP55 is maternally expressed from the exon NESP55, while XL{alpha}s and the exon 1A (or exon A/B) transcripts are paternally expressed from exon XL and exon 1A, respectively. The exact biological role of these GNAS1 splice variants is not yet known. The complexity of organization in the GNAS1 cluster was also found in mice with identical opposite patterns of imprinting (5).

Albright's hereditary osteodystrophy (AHO; MIM 300800) is characterized by short stature, obesity, round face, brachydactyly, mental retardation and heterotopic ossifications (6). Patients with features of AHO and resistance to parathyroid hormone (PTH), thyroid-stimulating hormone (TSH) and often other hormones are referred to as having pseudohypoparathyroidism type Ia (PHPIa; MIM 103580) (7). These individuals carry maternally inherited inactivating mutations in one of the 13 classical Gs{alpha} exons, which lead to a 50% reduction in Gs{alpha} activity. Patients with pseudopseudohypoparathyroidism (PPHP), due to a paternally inherited germline Gs{alpha} mutation, have similarly reduced Gs{alpha} activity and the same physical appearance as patients with PHPIa, i.e. AHO without hormonal resistance (8). This role of parental origin in developing either the PHPIa or the PPHP phenotype first suggested that Gs{alpha} might be an imprinted gene (9). Nevertheless, in both PHPIa and PPHP, the Gs activity in erythrocytes is 50% of normal, and RNA studies of different human fetal tissues showed biallellic Gs{alpha} expression (10). Gs{alpha} is therefore believed to be regulated by tissue-specific imprinting, with a monoallelic expression in only a few tissues, such as the proximal renal tubulus, the main PTH target site. Indeed, PHPIa patients have an absent to severely impaired response to PTH, suggesting a Gs activity of <50% in these target cells (11).

More support for the importance of Gs{alpha} imprinting came from the molecular study of the normal adult pituitary gland, where Gs{alpha} is monoallelically expressed from the maternal allele (12). Relaxation of this imprinting, by activation of the normally silent paternal Gs{alpha} allele, is found in somatotroph tumors. Loss of Gs{alpha} imprinting during pituitary somatotroph tumorigenesis suggested an independent regulation of Gs{alpha} imprinting, separately from the NESP55 and XL{alpha}s imprinting, which is retained in these tumors (12). Furthermore, the gene involved in PHP type Ib (PHPIb; MIM 603233) shows linkage to chromosome 20q13.3 and seems to be paternally imprinted (13). Patients with PHPIb only show PTH resistance when the defect is maternally inherited, but lack AHO features, carry no Gs{alpha} mutation and have normal Gs activity in erythrocytes and fibroblasts. Recently, it was found that patients with PHPIb show a loss of methylation at the differentially methylated region comprising exon 1A and sometimes even exons NESP55 and XL (14,15). The genetic mutation, probably in an imprinting control element, has not yet been found, but is expected to be located >=56 kb upstream of the GNAS1 cluster. This regulatory element is expected to exert long-range effects on Gs{alpha} expression, possibly through imprinting of exon 1A.

In this study, we describe a patient with PHPIb and loss of methylation of the region comprising exons 1A and XL and with biallelic methylation of exon NESP55. Interestingly, we also found decreased Gs activity in her platelets upon stimulation of Gs-coupled receptors. The expression of the proteins NESP55, XL{alpha}s and Gs{alpha} was disturbed in these cells, with less Gs{alpha} in accordance with the decreased Gs function, possibly related to the loss of methylation of the maternal exon 1A. Demethylation of exon 1A in MEG-01 cells also led to reduced Gs{alpha} expression. These results indicate that easily accessible platelets could be ideal cells to study the consequences of GNAS1 imprinting defects, especially in PHPIb.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Platelet Gs function in a patient with PHPIb
The proposita is a 23-year-old woman with PHPIb. We screened the Gs pathway in her platelets and those of both of her asymptomatic parents by an aggregation inhibition test in platelet-rich plasma, as described previously (16). Collagen-induced platelet aggregation was dose-dependently inhibited with several selective Gs-coupled receptor agonists. In contrast to her parents and normal controls (data not shown), the patient had a reduced sensitivity towards the Gs agonists used: the prostacyclin analogue Iloprost, prostaglandin E1, and adenosine, each stimulating different Gs-coupled receptors (Fig. 1). We also measured the second messenger cAMP before and after Gs stimulation with either Iloprost or prostaglandin E1 at different time points and using different agonist concentrations. We performed the stimulations for the proposita on different occasions and compared them with either her parents and healthy brother or an unrelated control. The proposita's platelets again showed a decreased sensitivity towards Gs stimulation, generating lower levels of cAMP than control platelets for the same concentration of agonists (Fig. 2A and B). The difference became more obvious when higher concentrations of agonist are used. No significant differences were seen between her parents or brother. When screening the basal cAMP level in five independent samples and in the presence of a phosphodiesterase inhibitor (IBMX, 100 µmol/l final concentration), the proposita had lower basal cAMP levels compared with her parents or brother (Fig. 2C). We screened the complete Gs{alpha} gene for mutations, but found no abnormality. The patient and both parents were heterozygous for the FokI polymorphism in exon 5 of Gs{alpha}.



View larger version (39K):
[in this window]
[in a new window]
 
Figure 1. Study of the Gs pathway in platelets. Dose-dependent inhibition of collagen-induced platelet aggregation (2 µg/ml) by the indicated concentrations of three Gs-coupled receptor agonists: prostacyclin (Iloprost), prostaglandin E1 and adenosine for the patient and for the parents. This experiment was repeated on two separate occasions with similar results.

 


View larger version (36K):
[in this window]
[in a new window]
 
Figure 2. Platelet adenylyl cyclase activity. (A) Measurement of cAMP levels before and after stimulation with Iloprost (1.25 ng/ml) or prostaglandin E1 (125 and 250 ng/ml) for various time intervals in platelets from the patient (circles), mother (squares), father (diamonds), or brother (triangles). (B) Measurement of cAMP levels before and after stimulation with Iloprost (2 ng/ml) or prostaglandin E1 (100 ng/ml) in the platelets from the patient (circles) and an unrelated control (squares). (C) Basal cAMP levels in the presence of IBMX for platelets from the patient (circles), mother (squares), father (diamonds), or brother (triangles). The data represent the mean±SD of five independent measurements. *P<0.0001 by unpaired Student's t-test.

 
DNA methylation analysis of the GNAS1 cluster in leukocytes
It has recently been found that patients with PHPIb have an aberrant methylation profile of exon 1A and sometimes also even of exons NESP55 and XL (14,15). The complex organization of methylation and alternative splicing in the normal GNAS1 cluster in leukocytes is indicated in Figure 3A. We studied the methylation status of exons 1A, NESP55 and XL using leukocyte DNA from the proposita, her parents and her brother. To evaluate the methylation status of the exon 1A, NESP55 and XL regions, a probe spanning the homologous region of GNAS1 was PCR-amplified, radioactively labeled, and hybridized with leukocyte genomic DNA digested with PstI (for exon 1A), BglII (for exon NESP55) and SacI (for exon XL) alone, or these methylation-insensitive enzymes combined with respectively the methylation-sensitive enzymes AscI, NgomIV and NotI (Fig. 3B). The proposita showed a loss of methylation in exons 1A and XL and a gain of methylation in exon NESP55. No methylation abnormalities were detected in the unaffected parents or brother. We also screened their DNA for an imprinted domain on chromosome 20q11.3, located upstream of the GNAS1 cluster and comprising the neuronatin gene (NAPP) (17). No methylation defect was detected at this locus (Fig. 3C), indicating that the imprinting defect does not extend towards the NAPP region but only involves the GNAS1 cluster.





View larger version (111K):
[in this window]
[in a new window]
 
Figure 3. Methylation studies of leukocyte DNA. (A) Schematic representation of the normal GNAS1 cluster. All of the different first exons are represented by white boxes and indicated by their names. The alternative splicing and parent-specific transcription are indicated by arrows. The sites of parent-specific DNA methylation are shown by asterisks. The probes used in Southern blot analysis are represented by black boxes: NESP55 (nucleotides 846–1585; GenBank accession no. AJ009849), XL{alpha}s (nucleotides 295–1481; GenBank accession no. AJ224868) and exon 1A (nucleotides 661–2021; GenBank accession no. AF246983). (B) Southern blot analysis: the allele-specific methylation pattern of exons 1A, NESP55 and XL are shown for the parents [1,2], the patient [3], and her brother [4]. P, PstI; A, AscI; B, BglII; Ng, NgomIV; S SacI; N NotI. (C) The allele-specific methylation pattern of the neuronatin gene (NAPP) for the patient [1] and her parents [2,3].

 
Based on her DNA methylation pattern of the GNAS1 cluster with a lack of the maternally specific methylation marks, paternal uniparental (iso)disomy could be possible in this patient. This was described earlier in one other patient with PHPIb (18). However, linkage analysis of markers on chromosome 20q13.3 in this family excluded the possibility of uniparental disomy (Fig. 4). The patient and her non-affected brother share the same haplotypes, so the imprinting defect is probably a de novo epigenetic phenomenon.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 4. Haplotype analysis of genomic DNA from the patient, her brother and her parents. DNA markers are studied across the chromosome 20q region.

 
Platelet protein expression
We thus showed that the patients leukocyte DNA has a disturbed imprinting of the complete GNAS1 cluster, but we also found that her platelets have a decreased Gs{alpha} function while the Gs{alpha} gene sequence is normal. Because platelet RNA is very unstable, semiquantitative PCR analysis was too variable to show a significant decrease in Gs{alpha} gene expression in the patient (data not shown). Therefore, we studied platelet Gs{alpha}, NESP55 and XL{alpha}s at the protein level in the platelets from the patient, her parents and her healthy brother. All of these experiments were repeated on two separate samples, generating similar results. The patient, having a loss of imprinting of exon XL and a biallelic methylation of exon NESP55, demonstrates in her platelets an overexpression of XL{alpha}s and a decreased expression of NESP55 when compared with the other family members (Fig. 5A). The transcript starting from exon 1A does not generate a functional protein, and therefore cannot be studied at the protein level. The patient's platelets contain less Gs{alpha} protein, explaining their decreased Gs functionality. There is no different expression of a GNAS1-independent protein, Gq{alpha}, in the patient. A model for this disturbed imprinting and alternative GNAS1 transcription regulation is proposed in Figure 5B. This model compares the imprinting status of leukocyte DNA from the patient with that from normal individuals (Fig. 3A).




View larger version (41K):
[in this window]
[in a new window]
 
Figure 5. Platelet protein expression level and patient leukocyte DNA methylation model. (A) Western blot analysis of Gs{alpha} (52 and 45 kDa subunits), NESP55 (55 kDa), XL{alpha}s (93 kDa), and Gq{alpha} (43 kDa) in platelets from the patient [4], her parents [1, 2], and her brother [3]. Different amounts of the total platelet protein fraction (12.5–25 µg) were loaded and analyzed by specific monoclonal (for XL{alpha}s) or polyclonal (for Gs{alpha}, NESP55 and Gq{alpha}) antibodies. The positions of the size markers are included. (B) Model of the GNAS1 imprinting cluster in the leukocytes of the patient. A loss of methylation for exons XL and 1A and a gain of methylation for exon NESP55 was detected in her leukocyte genomic DNA.

 
DNA methylation analysis of the GNAS1 cluster in MEG-01 cells
It is known that patients with PHPIb have no Gs functional defect in their erythrocytes and fibroblasts (19,20). It is suggested that abnormal imprinting only affects those tissues where there is a specific imprinting of the paternal GNAS1 allele, such as in the renal proximal tubules, in which only the maternal allele is active (21). Because platelets lack DNA, we could not study their methylation pattern directly. We therefore used the megakaryocytic cell line MEG-01 to analyze the methylation status of all members in the GNAS1 cluster (Fig. 6A and B). Interestingly, we found that in MEG-01 cells, both parental alleles of exon 1A are methylated, instead of only the maternal allele. The erythroleukemia cell line K562 has a normal maternal methylation of exon 1A (data not shown). Although the MEG-01 cell line shares many properties of megakaryocytes, we do not know yet if this cell line is completely representative of true megakaryocytes regarding their epigenetic mechanism. We therefore hypothesize that the regulation of Gs{alpha} transcription is different in megakaryocytes compared with leukocytes and erythrocytes. The imprinting of exons XLs{alpha} and NESP55 in the megakaryocytic cell line was similar to that in leukocytes.





View larger version (90K):
[in this window]
[in a new window]
 
Figure 6. Methylation studies on megakaryocytic MEG-01 cells. (A) The methylation pattern in MEG-01 cells and leukocytes is shown for exons 1A, NESP55 and XL. P, PstI; A, AscI; B, BglII; Ng, NgomIV; S, SacI; N, NotI. (B) Model of the GNAS1 imprinting cluster as found in MEG-01 cells. There is a gain of methylation for exon1A. (C) Effects of Aza-C treatment on Gs{alpha} mRNA expression. MEG-01 and K562 cells were cultured in RPMI medium containing 0, 1.25, 2.5, 5 and 10 µM Aza-C for 48 hours. The amount of Gs{alpha} mRNA was estimated by RT–PCR analysis with ß-actin being used as control.

 
Based on the different methylation status of exon 1A in MEG-01 and K562 cells, a different transcriptional regulation between the promoters for exon 1A and the classical Gs{alpha} gene was expected in these cells. We hypothesized that demethylation of the exon 1A region with 5-azacytidine (Aza-C) would reduce Gs{alpha} mRNA expression. MEG-01 and K562 cells were treated for 48 hours with different concentrations of Aza-C before Gs{alpha} and ß-actin mRNA levels were quantified by RT–PCR analysis. Figure 6C shows that demethylation of the two exon 1A alleles in MEG-01 cells resulted in decreased expression of Gs{alpha} mRNA in a dose-dependent manner, while this effect was not so obvious in the K562 cells, where only one exon1A allele is methylated.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In this study, we describe a patient with PHPIb with only the typical renal resistance to PTH and no features of AHO or resistance to other hormones. Recently, it was found that patients with PHPIb have no mutation in the Gs{alpha} or PTH1 receptor gene but do have a so-called imprinting mutation in the GNAS1 cluster (14,15,20,22,23). GNAS1 imprinting studies of leukocyte DNA of all PHPIb patients studied to date revealed that in these patients the exon 1A region is unmethylated on both alleles and that there is a concomitant biallelic exon 1A transcription (14,15). However, the NESP55 and XL{alpha}s promoter regions were imprinted abnormally in only a subset of the studied PHPIb patients (14,15). It therefore seems unlikely that these GNAS1 transcripts play a major role in the pathogenesis of PHPIb or in the tissue-specific imprinting of Gs{alpha}, but no detailed studies are yet available on this issue. Our patient has an abnormal imprinting of the complete GNAS1 region, comprising a loss of methylation in the exon 1A and XL regions with a gain of methylation in the exon NESP55 region. We studied the methylation of the neuronatin gene, located upstream of the GNAS1 cluster on chromosome 20q11.3 for two reasons: first, to determine whether the imprinting defect is specifically connected to the GNAS1 region; secondly, because vesico-ureteric reflux (VUR; MIM 193000), a polygenic condition from which the proposita, her father and two other family members suffer, has been linked to chromosome 20 (24). However, no methylation defect was detected in this region. Bastepe et al. (15) described a patient with PHPIb and a more overall GNAS1 methylation defect, but, in contrast to our patient's parents, a NESP55 methylation defect was also detected in his mother and aunt. We therefore hypothesize that the methylation defect in our patient is sporadic, since her healthy brother carries the same haplotypes in the chromosome 20q13 region.

The Gs{alpha} defect in PHPIb patients is very tissue-specific, only affecting the proximal renal tubules but not other cells such as erythrocytes or fibroblasts. Surprisingly, when the patient's platelets were functionally tested, decreased Gs signaling and cAMP formation were detected. The Gs{alpha} gene sequence was normal but there was decreased Gs{alpha} protein expression in platelets. The Gs{alpha} gene is biallelically expressed in normal and patient platelets (studied by the FokI polymorphism in exon 5). In order to understand why the GNAS1 transcriptional regulation in platelets seems different to that in other cells, such as erythrocytes or fibroblasts, DNA methylation analysis would be needed. Therefore, we analyzed the DNA methylation pattern of the GNAS1 cluster in the megakaryocytic cell line MEG-01. Compared with the maternal methylation of exon 1A in most tissues, including leukocytes, fibroblasts and the erythroleukemia cell line K562, both exon 1A alleles are methylated in MEG-01 cells. Such a tissue-specific gene control by DNA methylation has been found for other genes (25,26). We hypothesize that loss of methylation occurs on both exon 1A alleles of the megakaryocytic DNA of a PHPIb patient. However, the megakaryocytes of our patient were not available to confirm this claim. A disturbed transcriptional regulation between exons 1A and 1 of the Gs{alpha} gene would then be more pronounced in platelets compared with other cells, and probably accounts for the decreased Gs{alpha} expression. By genome demethylation analysis using Aza-C treatment of cells, we could provide some evidence for this statement; indeed demethylation of exon 1A resulted in reduced Gs{alpha} expression in MEG-01 cells.

In accordance with their methylation abnormality, NESP55 and XL{alpha}s were respectively under- and overexpressed in platelets. We do not know whether these proteins play a functional role in platelets and we have no evidence that their disturbed expression is involved in the patient's platelet dysfunction. Furthermore, there is no evidence that either exon NESP55 or exon XL regions are involved in the imprinting of Gs{alpha}, since they are not expressed in tissues where Gs{alpha} is imprinted (2729).

Further studies will focus on the methylation status of exon 1A in human megakaryocytes to elucidate the mechanism regulating transcription of the GNAS1 cluster.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Patient description
The proposita is a 23-year-old woman who presented at the age of 11 years with hypocalcemia of 4.8 mg/dl [normal values (N): 9–11], low ionized serum calcium of 0.87 mmol/l (N: 1.14–1.29), hyperphosphatemia of 9.3 mg/dl (N: 4–5.5) and increased serum PTH levels of 210.4 pg/ml (N: 3–40), and this in the absence of renal insufficiency. There was no urinary cAMP response to intravenous PTH infusion (1 µg/kg), with urinary cAMP levels (in nmol cAMP/mg creatinine) of 2.0, 0.8 and 1.0 before and 0.3 and 0.75 respectively 30 and 60 min after PTH infusion, compatible with PTH resistance. She had no clinical or radiological features of AHO; her height and weight were within the normal range, and X-rays of both hands showed normal bone age and metacarpal length. She has a normal intelligence. Total thyroxine (T4) 7.3 µg/dl (N: 5.5–12), free T4 1 ng/dl (N: 0.7–1.9), total triiodothyronine (T3) 112.6 mg/dl (N: 80–190), serum TSH 2.4 mIE/l (N: 0.15–4.6), calcitonin <2 pg/ml (N: 0–28), 25-hydroxyvitamin D3 22.2 ng/ml (N: 7–60) and 1,25-dihydroxyvitamin D3 levels 58.1 pg/ml (N: 20–80) were all normal. Cerebral metastatic calcifications were discovered on CT scan, localized in both nuclei lentiformes. She furthermore suffers from VUR and from total perception deafness of the left ear. She never showed any clinical sign of thrombosis.

No clinical abnormalities were found in her parents or her brother and especially no PTH resistance was discovered in them with also normal bone-mineral content studies. There is no family history of calcium disorders, hypothyroidism or thombophilia.

Cell culture
The properties of the human megakaryocytic cell line MEG-01 have been described in detail previously (30). MEG-01 cells are positive for the platelet glycoprotein IIb/IIIA and glycoprotein Ib antigens and can still produce functional platelet-sized particles (30,31). The human leukemia cell line K562 has erythroid features (32,33). Both cells are grown in RPMI 1640 medium (Invitrogen) supplemented with 10% FBS, 1x non-essential amino acids and 1 mmol/l sodium pyruvate at 37°C in a humified atmosphere of 5% CO2.

Linkage analysis
Polymorphic microsatellite markers on chromosome 20q were used to PCR-amplify 300 ng of genomic DNA with Platinium Taq PCRxDNA polymerase (Life Technologies, Invitrogen). PCR products were run on an ALF DNA sequencer (Amersham Pharmacia Biotech) and analyzed with the Fragment Manager software (Amersham Pharmacia Biotech).

Platelet aggregation inhibition test and cAMP measurement
Platelet aggregation was performed on two dual-channel Chrono-Log Aggregometers (Chronolog Corp, Havertown, PA) as described previously (16). Aggregation inhibition studies involved dose–response curves with Gs agonists: prostaglandin E1 (Prostin, 0–1 µg/ml; Pharmacia-Upjohn), the stable prostacyclin analogue Iloprost (Ilomédine, 0–5 ng/ml; Schering) or adenosine (0–400 µmol/l Aldrich) were added to platelet-rich plasma (PRP) 1 min prior to induction of aggregation by collagen (2 µg/ml).

Platelet cAMP was measured after incubating PRP with Iloprost (1.25 and 2 ng/ml) or prostaglandin E1 (100, 125 and 250 ng/ml), stopping the reaction at different time points by the addition of 12% trichloroacetic acid and using a cAMP enzyme immunoassay (Amersham, Pharmacia Biotech). Basal cAMP levels in the platelets of the patient and the other family members were measured in the presence of the phosphodiesterase inhibitor isobutylmethylxanthine (IBMX, 100 µmol/l final concentration).

Methylation analysis of the GNAS1 cluster
Genomic DNA was isolated from leukocytes and the megakaryocytic cell line MEG-01 according to a salting-out procedure (34). Southern blot analysis was preformed after double digestion of genomic DNA with different combinations of methylation-insensitive enzymes (PstI, BglII and SacI) and methylation sensitive enzymes (AscI, NgomIV and NotI) as previously described (14,15). DNA samples (15 µg) were digested with the restriction enzymes PstI, SacI, NotI (MBI Fermentas), AscI, NgomIV (New England Biolabs) and BglII (Roche), separated by electrophoresis on a 1% agarose gel and transferred to Genescreen nylon membrane (NEN; Life Science Products). 32P-labeled exon 1A-, XL- or NESP55-specific PCR fragments were used as genomic probes, and hybridization was performed under high-stringency conditions using Rapid-hyb buffer (Amersham Pharmacia). Primer sequences are available on request.

Platelet immunoblot analysis
Platelets isolated from citrated blood were lysed directly in ice-cold PBS containing 1% igepal CA-630 (Sigma Chemical Co.), 2 mmol/l Na3VO4, 1 mmol/l EDTA, 1 mmol/l phenylmethanesulfonyl fluoride, 2 mmol/l DTE, 1% aprotinin and 2 mmol/l NaF, and incubated on ice for 60 minutes. Lysates were cleared of insoluble debris by centrifugation at 14 000g for 20 min at 4°C. Platelet protein fractions were mixed with Laemmli sample buffer (5% SDS reducing buffer), resolved by SDS–PAGE on 7% (for XL{alpha}s) or 10% (for Gs{alpha}, Gq{alpha} and NESP55) acrylamide gels, and transferred to Hybond ECL–nitrocellulose membrane (Amersham, Pharmacia Biotech). The blots were blocked for 1 h at room temperature in Tris-buffered saline with Tween (TBS-T; 0.1% Tween-20) supplemented with 5% non-fat dried milk. Incubation with primary antibody (overnight at 4°C) and with secondary antibody (2–3 h at room temperature) was performed in TBS-T with 5% non-fat milk. Blots were revealed with a polyclonal anti-Gs{alpha} antibody (Calbiochem), a monoclonal anti-XL{alpha}s antibody (11F7), a polyclonal anti-Gq{alpha} antibody (Calbiochem) or a polyclonal anti-NESP55 antibody. The secondary antibody was conjugated with HRP, and staining was performed with the western blotting ECL detection reagent (Amersham, Pharmacia Biotech). The primary anti-XL{alpha}s monoclonal and anti-NESP55 polyclonal antibodies were produced in our laboratory by injection of mice or rabbits with recombinant fusion proteins consisting of the amino acids encoded by either the complete exon XL or the complete exon NESP55, each coupled to glutathione-S-transferase (GST). These recombinant fusion proteins were expressed in Escherichia coli and purified by affinity chromatography on immobilized gluthione (Amersham Biosciences). The antibodies were purified on protein A Sepharose beads (Amersham Biosciences), controlled for their specificity by detection of recombinant XL{alpha}s and NESP55, and were used at 50 µg/ml.

Aza-C treatment and RT–PCR analysis
For DNA demethylation experiments, 1x106 MEG-01 and K562 cells were plated per 60 mm dish and cultured in RPMI medium containing 0, 1.25, 2.5, 5 and 10 µmol/l of the methyltransferase inhibitor 5-azacytidine (Aza-C) (Sigma, St Louis, MO) for 48 h (35). Total RNA was extracted from cultured MEG-01 cells using TRIzol reagent (Gibco BRL) according to the manufacturer's protocol. Approximately 1 µg total RNA, in the presence of an RNaseI inhibitor (Invitrogen), was used for oligo(dT)-primed first-strand cDNA synthesis using M-MLV reverse transcriptase (Invitrogen). The reverse-transcriptase reaction was terminated by heating for 5 min at 95°C, and the mixture was diluted (1/2). The cDNA content was normalized using primers for ß-actin. The following primer sets were used to generate specific fragments: primers for the GNAS1 amplification were GSF-(GGCTGCCTCGGGAACAGTAAG) and GSR-(TAATCATGCCCTATGGTGGGTG) and those for ß-actin amplification were ßF-(ACCAACTGGGACGACATGGAG) and ßR-(GTGAGGATCTTCATGAGGTAGTC). PCR was performed by adding 3 µl cDNA aliquots to the reaction mixture containing 25 pmol of each primer, 200 mmol/l dNTP, 1x PCR buffer (Invitrogen) and 1 U recombinant Taq polymerase (Invitrogen). PCR was performed in a PTC-100 programmable Thermal Controller (MJ Research Inc., Biozym) using the following conditions: 95°C for 5 min followed by 20 cycles of 95°C for 30 s, 58°C for 45 s and 72°C for 50 s, and final extension at 72°C for 10 min. All reactions were performed in duplicate on separate RNA samples.


    ACKNOWLEDGEMENTS
 
This work was supported by research grants G. 0271.00 and KAN2000-1523100 from the FWO-Vlaanderen and OT/00/25, KU Leuven. C. Van Geet is a Clinical Research Investigator of the Fund for Scientific Research, Flanders, Belgium.


    FOOTNOTES
 
* To whom correspondence should be addressed at: Center for Molecular and Vascular Biology, UZ-Gasthuisberg, Herestraat 49, 3000 Leuven, Belgium. Tel: +32 16345775; Fax: +32 16345990; Email: christel.vangeet{at}uz.kuleuven.ac.be Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
1 Dessauer, C.W., Posner, B.A. and Gilman, A.G. (1996) Visualizing signal transduction: receptors, G-proteins, and adenylate cyclases. Clin. Sci., 91, 527–537.[Medline]

2 Kozasa, T., Itoh, H., Tsukamoto, T. and Kaziro, Y. (1988) Isolation and characterization of the human Gs{alpha} gene. Proc. Natl Acad. Sci. USA, 85, 2081–2085.[Abstract/Free Full Text]

3 Hayward, B.E., Kamiya, M., Strain, L., Moran, V., Campbell, R., Hayashizaki, Y. and Bonthron, D.T. (1998) The human GNAS1 gene is imprinted and encodes distinct paternally and biallelically expressed G proteins. Proc. Natl Acad. Sci. USA, 95, 10038–10043.[Abstract/Free Full Text]

4 Hayward, B.E., Moran, V., Strain, L. and Bonthron, D.T. (1998) Bidirectional imprinting of a single gene: GNAS1 encodes maternally, paternally, and biallelically derived proteins. Proc. Natl Acad. Sci. USA, 95, 15475–15480.[Abstract/Free Full Text]

5 Peters, J., Wroe, S.F., Wells, C.A., Miller, H.J., Bodle, D., Beechey, C.V., Williamson, C.M. and Kelsey, G. (1999) A cluster of oppositely imprinted transcripts at the Gnas locus in the distal imprinting region of mouse chromosome 2. Proc. Natl Acad. Sci. USA, 96, 3830–3835.[Abstract/Free Full Text]

6 Albright, F., Burnett, C.H., Smith, P.H. and Parson, W. (1942) Pseudohypoparathyroidism—an example of ‘Seabright Bantam syndrome’. Endocrinology, 30, 922–932.[Web of Science]

7 Patten, J.L., Johns, D.R., Valle, D., Eil, C., Gruppuso, P.A., Steele, G., Smallwood, P.M. and Levine, M.A. (1990) Mutation in the gene encoding the stimulatory G protein of adenylate cyclase in Albright's hereditary osteodystrophy. N. Engl. J. Med., 322, 1412–1419.[Abstract]

8 Fischer, J.A., Egert, F., Werder, E. and Born, W. (1998) An inherited mutation associated with functional deficiency of the {alpha}-subunit of the guanine nucleotide-binding protein Gs in pseudo- and pseudopseudohypoparathyroidism. J. Clin. Endocrinol. Metab., 83, 935–938.[Abstract/Free Full Text]

9 Davies, S.J. and Hughes, H.E. (1993) Imprinting in Albright's hereditary osteodystrophy. J. Med. Genet., 30, 101–103.[Abstract/Free Full Text]

10 Campbell, R., Gosden, C.M. and Bonthron, D.T. (1994) Parental origin of transcription from the human GNAS1 gene. J. Med. Genet., 31, 607–614.[Abstract/Free Full Text]

11 Chase, L.R., Melson, G.L. and Aurbach, G.D. (1969) Pseudohypoparathyroidism: defective excretion of 3',5'-AMP in response to parathyroid hormone. J. Clin. Invest., 48, 1832–1844.[Web of Science][Medline]

12 Hayward, B.E., Barlier, A., Korbonits, M., Grossman, A.B., Jacquet, P., Enjalbert, A. and Bonthron, D.T. (2001) Imprinting of the Gs{alpha} gene GNAS1 in the pathogenesis of acromegaly. J. Clin. Invest., 107, 31–36.[Web of Science][Medline]

13 Jüppner, H., Schipani, E., Bastepe, M., Cole, D.E.C., Lawson, M.L., Mannstadt, M., Hendy, G.N., Plotkin, H., Koshiyama, H., Koh, T. et al. (1998) The gene responsible for pseudohypoparathyroidism Ib is paternally imprinted and maps in four unrelated kindreds to chromosome 20q13.3. Proc. Natl Acid. Sci. USA, 95, 11798–11803.[Abstract/Free Full Text]

14 Liu, J., Litman, D., Rosenberg, M.J., Yu, S., Biesecker, L.G. and Weinstein, L.S. (2000) A GNAS1 imprinting defect in pseudohypoparathyroidism IB. J. Clin. Invest., 106, 1167–1174.[Web of Science][Medline]

15 Bastepe, M., Pincus, J.E., Sugimoto, T., Tojo, K., Kanatan, M., Azuma, Y., Kruse, K., Rosenbloom, A.L., Koshiyama, H. and Jüppner, H. (2001) Positional dissociation between the genetic mutation responsible for pseudohypoparathyroidism type IB and the associated methylation defect at exon A/B: evidence for a long-range regulatory element within the imprinted GNAS1 locus. Hum. Mol. Genet., 10, 1231–1241.[Abstract/Free Full Text]

16 Freson, K., Hoylaerts, M.F., Jaeken, J., Eysen, M., Arnout, J., Vermylen, J. and Van Geet, C. (2000) Genetic variation of the extra-large stimulatory G protein {alpha}-subunit leads to Gs hyperfunction in platelets and is a risk factor for bleeding. Thromb. Haemost., 86, 733–738.

17 Evans, H.K., Wylie, A.A., Murphy, S.K. and Jirtle, R.L. (2001) The neuronatin gene resides in a micro-imprinted domain on human chromosome 20q11.2. Genomics, 77, 99–104.[Web of Science][Medline]

18 Levine, M.A., Downs, R.W. Jr, Moses, A.M., Breslau, N.A., Marx, S.J., Lasker, R.D., Rizzoli, R.E., Aurbach, G.D. and Spiegel, A.M. (1983) Resistance to multiple hormones in patients with pseudohypoparathyroidism. Association with deficient activity of guanine nucleotide regulatory protein. Am. J. Med., 74, 545–556.[Web of Science][Medline]

19 Bastepe, M., Lane, A.H. and Jüppner, H. (2001) Paternal uniparental isodisomy of chromosome 20q—and the resulting changes in GNAS1 methylation—as a plausible cause of pseudohypoparathyroidism. Am. J. Hum. Genet., 68, 1283–1289.[Web of Science][Medline]

20 Silve, C., Santora, A., Breslau, N., Moses, A. and Spiegel, A. (1986) Selective resistance to parathyroid hormone in cultured skin fibroblasts from patients with pseudohypoparathyroidism type Ib. J. Clin. Endocrinol. Metab., 62, 640–644.[Abstract/Free Full Text]

21 Weinstein, L.S., Yu, S., Warner, D.R. and Liu, J. (2001) Endocrine manifestations of stimulatory G protein subunit mutations and the role of genomic imprinting. Endocrine Rev., 22, 675–705.[Abstract/Free Full Text]

22 Schipani, E., Weinstein, L.S., Bergwitz, C., Iida-Klein, A., Kong X.F., Stuhrmann, M., Kruse, K., Whyte, M.P., Murray, T., Schmidtke, J. et al. (1995) Pseudohypoparathyroidism type Ib is not caused by mutations in the coding exons of the human parathyroid hormone (PTH)/PTH-related peptide receptor gene. J. Clin. Endocrinol. Metab., 80, 1611–1621.[Abstract/Free Full Text]

23 Fukumoto, S., Suzawa, M., Takeuchi, Y., Kodama, Y., Nakayama, K., Ogata, E., Matsumoto, T. and Fujita, T. (1996) Absense of mutations in parathyroid hormone (PTH) PTH-related protein receptor complementary deoxyribonucleic acid in patients with pseudohypoparathyroidism type Ib. J. Clin. Endocrinol. Metab., 81, 2554–2558.[Abstract]

24 Feather, S.A., Malcolm, S., Woolf, A.S., Wright, V., Blaydon, D., Reid, C.J.D., Flinter, F.A., Proesmans, W., Devriendt, K., Carter, J. and Warwicker, P. (2000) Primary, nonsyndromic vesicoureteric reflux and its nephropathy is genetically heterogeneous, with a locus on chromosome 1. Am. J. Hum. Genet., 66, 1420–1425.[Web of Science][Medline]

25 Kusui, C., Kimura, T., Ogita, K., Nakamura, H., Matsumura, Y., Koyama, M., Azuma, C. and Murata, Y. (2001) DNA methylation of the human oxytocin receptor gene promoter regulates tissue-specific gene suppression. Biochem. Biophys. Res. Commun., 289, 681–686.[Web of Science][Medline]

26 Futscher, B.W., Oshiro, M.M., Wozniak, R.J., Holtan, N., Hanigan, C.L., Duan, H. and Domann, F.E. (2002) Role for DNA methylation in the control of cell-type specific maspin expression. Nat. Genet., 31, 175–179.[Web of Science][Medline]

27 Pasolli, H.A., Klemke, M., Kehlenbach, R.H., Wang, Y., and Huttner, W.B. (2000) Characterization of the extra-large G-protein {alpha}-subunit XL{alpha}s. I. Tissue distribution and subcellular localization. J. Biol. Chem., 275, 33622–33632.[Abstract/Free Full Text]

28 Lovisetti-Scamiform, P., Fischer-Colbrie, R., Leitner, B., Scherzer, G. and Winkler, H. (1999) Relative amounts and molecular forms of NESP55 in various bovine tissues. Brain Res., 829, 99–106.[Web of Science][Medline]

29 Yu, S., Gavrilova, O., Chen, H., Lee, R., Liu, J., Pacak, K., Parlow, A.F., Quon, M.J., Reitman, M.L. and Weinstein, L.S. (2000) Paternal vs. maternal transmission of a stimulatory G protein {alpha} subunit knockout produces opposite effects on energy metabolism. J. Clin. Invest., 105, 615–623.[Web of Science][Medline]

30 Ogura, M., Morishima, Y., Ohno, R., Kato, Y., Hirabayashi, N., Nagura, H. and Saito, H. (1985) Establishment of a novel human megakaryoblastic leukemia cell line, MEG-01, with positive Philadelphia chromosome. Blood, 66, 1384–1392.[Abstract/Free Full Text]

31 Battinelli, E., Willoughby, S.R., Foxall, T., Valeri, C.R. and Loscalzo, L. (2001) Induction of platelet formation from megakaryocytoid cells by nitric oxide. Proc. Natl Acad. Sci. USA, 98, 14458–14463.[Abstract/Free Full Text]

32 Klein, E., Ben-Bassat, H., Neumann, H., Ralph, P., Zeuthen, J., Polliak, A. and Vanky, F. (1976) Properties of the K562 cell line, derived from a patient with chronic myeloid leukemia. Int. J. Cancer, 18, 421–431.[Web of Science][Medline]

33 Gahmberg, C.G. and Andersson, L.C. (1981) K562—a human leukemia cell line with erythroid features. Semin. Hematol., 18, 72–77.[Web of Science][Medline]

34 Sambrook, J., Fritsch, E.F. and Mniatis, T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

35 Kusui, C., Kimura, T., Ogita, K., Nakamura, H., Matsumura, Y., Koyama, M., Azuma, C. and Murata, Y. (2001) DNA methylation of the human oxytocin receptor gene promoter regulates tissue-specific gene suppression. Biochem. Biophys. Res. Commun., 289, 681–686.[Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Clin. Endocrinol. Metab.Home page
K. Freson, B. Izzi, J. Jaeken, M. Van Helvoirt, C. Thys, C. Wittevrongel, F. de Zegher, and C. Van Geet
Compound Heterozygous Mutations in the GNAS Gene of a Boy with Morbid Obesity, Thyroid-Stimulating Hormone Resistance, Pseudohypoparathyroidism, and a Prothrombotic State
J. Clin. Endocrinol. Metab., December 1, 2008; 93(12): 4844 - 4849.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
K. Freson, B. Izzi, V. Labarque, M. Van Helvoirt, C. Thys, C. Wittevrongel, M. Bex, R. Bouillon, N. Godefroid, W. Proesmans, et al.
GNAS Defects Identified by Stimulatory G Protein {alpha}-Subunit Signalling Studies in Platelets
J. Clin. Endocrinol. Metab., December 1, 2008; 93(12): 4851 - 4859.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. D. Phillips, D. P. Steensma, M. A. Pulsipher, G. J. Spangrude, and J. P. Kushner
Congenital erythropoietic porphyria due to a mutation in GATA1: the first trans-acting mutation causative for a human porphyria
Blood, March 15, 2007; 109(6): 2618 - 2621.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
K. Freson, J. Jaeken, M. Van Helvoirt, F. de Zegher, C. Wittevrongel, C. Thys, M. F. Hoylaerts, J. Vermylen, and C. Van Geet
Functional polymorphisms in the paternally expressed XL{alpha}s and its cofactor ALEX decrease their mutual interaction and enhance receptor-mediated cAMP formation
Hum. Mol. Genet., May 15, 2003; 12(10): 1121 - 1130.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (12)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Freson, K.
Right arrow Articles by Van Geet, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Freson, K.
Right arrow Articles by Van Geet, C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?