Human Molecular Genetics, 2002, Vol. 11, No. 24 3039-3046
© 2002 Oxford University Press
Relative contribution of variation within the APOC3/A4/A5 gene cluster in determining plasma triglycerides
1Division of Cardiovascular Genetics, Department of Medicine, British Heart Foundation Laboratories, Rayne Building, Royal Free and University College Medical School, London, UK, 2Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, WI, USA, 3MRC Epidemiology and Medical Care Unit, Wolfson Institute of Preventive Medicine, London, UK and 4Genome Sciences Department, Lawrence Berkeley National Laboratory, Berkeley, CA, USA
Received July 15, 2002; Accepted September 16, 2002
| ABSTRACT |
|---|
|
|
|---|
Since triglycerides (TG) are a major independent risk factor for coronary heart disease, understanding their genetic and environmental determinants is of major importance. Mouse models indicate an inverse relationship between levels of the newly identified apolipoprotein AV (APOAV) and TG concentrations. We have examined the relative influence of human APOA5 variants on plasma lipids, compared to the impact of variation in APOC3 and APOA4 which lie in the same cluster. Single nucleotide polymorphisms (SNPs) in APOA5 (S19W, -1131T>C) and APOA4 (T347S, Q360H) and an APOA4/A5 intergenic T>C SNP were examined in a large study of healthy middle-aged men (n=2808). APOA5 19WW and -1131CC men had 52% and 40% higher TG (P<0.003) compared to common allele homozygotes, respectively, effects which were independent and additive. APOA4 347SS men had 23% lower TG compared to TT men (P<0.002). Haplotype analysis was carried out to identify TG-raising alleles and included, in addition, four previously genotyped APOC3 SNPs (-2845T>G, -482C>T, 1100C>T, and 3238C>G). The major TG-raising alleles were defined by APOA5 W19 and APOC3 -482T. This suggests that the TG-lowering effect of APOA4 S347 might merely reflect the strong negative linkage disequilibrium with the common alleles of these variants. Thus variation in APOA5 is associated with differences in TGs in healthy men, independent of those previously reported for APOC3, while association between APOA4 and TG reflects linkage disequilibrium with these sites. The molecular mechanisms for these effects remain to be determined.
| INTRODUCTION |
|---|
|
|
|---|
Both genetic and environmental factors determine plasma triglyceride (TG) levels, which are a major, independent risk factor for coronary heart disease (CHD) (1). Understanding these TG determinants and the resulting geneenvironment interactions are thus of importance in CHD management. The latest recognised member of the apolipoprotein gene family, APOA5, identified by comparative sequencing between human and mouse DNA, has been located
27 kb distal to APOA4 in the APOA1/C3/A4 gene cluster on chromosome 11q23 (2). The involvement of variation in the APOA1/C3/A4 locus in determining independent difference in lipid levels is well documented (reviewed in ref. 3). APOAI, synthesised primarily in the liver and to a lesser extent in the intestine, is the major apolipoprotein component of high density lipoproteins (HDL) and plays a key role in reverse cholesterol transport. Thus variation in and around the APOA1 gene has its effect essentially on HDL-cholesterol levels (reviewed in ref. 3). We concentrated here on the other members of the locus, which are known to determine TG levels (reviewed in ref. 3). APOCIII has a distribution similar to APOAI but is found on both TG-rich lipoproteins (TGRL) and HDL. Plasma APOCIII levels strongly correlate with TG levels (4,5), suggesting a major role in the catabolism of TGRL. This effect, confirmed in both apoc3 knockout (6) and APOC3 transgenic mouse models (7), stems from the inhibitory effect of APOCIII on lipoprotein lipase mediated hydrolysis of TGRL (8) and from the displacement of APOE, the major ligand for TGRL clearance, from lipoprotein particles by APOCIII (7). Finally, APOAIV is synthesised mainly in the intestine. Two common amino acid variants (APOA4 T347S and Q360H) have been inconsistently associated with differences in triglyceride, LDL- and HDL-cholesterol levels (reviewed in ref. 3). As an activator of lecithin cholesterol acyl transferase (LCAT) (9), it has been proposed that APOAIV may influence lipid absorption and chylomicron assembly (10). The identification of apoaiv as a satiety factor in rodents (11) has never been confirmed in humans. We and others have shown that variation in APOC3 namely the -482C>T within the insulin responsive element in the promoter, 1100C>T in exon 3 and the 3238C>G (SstI site) in the 3'UTR, is strongly associated with differences in plasma TG levels (1217) and fully reviewed in (3). For the -482T>C, the TG-raising effect showed a strong genotypesmoking interaction (14).
APOAV is synthesised predominantly in the liver. Animal studies indicate that an APOA5 transgene leads to a
65% reduction in TG levels while apoa5 knockout mice have four-times higher TG levels than control litter-mates. Thus, in contrast to APOCIII, where high plasma levels are associated with high TG levels (4,5), APOAV appears to be inversely related to TG levels. A clue to the function of APOAV comes from the upregulation of expression after partial hepatectomy in the rat suggesting that APOAV may act by controlling the secretion of lipids from the liver (18).
In the present study, we have examined the relationship to lipid levels of APOA5 and APOA4 variants in healthy UK middle-aged men (Northwick Park Heart Study II (NPHSII)) in whom the association of APOC3 genotype to lipid levels had already been reported (14). Our study includes 9 variants spanning the APOC3/A4/A5 cluster, to determine the linkage disequilibrium (LD) across the region. Using haplotypes defined by these variants, we have identified the major TG-raising alleles, thus highlighting the relative effect of each gene on plasma TG levels.
| RESULTS |
|---|
|
|
|---|
Strong linkage disequilibrium across the APOC3/A4/A5 locus
Our initial aim was to establish the strength of LD across the human chromosome 11 APOC3/A4/A5 gene cluster, to assess whether genotypic associations could be explained by LD. Thus, we genotyped 2808 men for two APOA5 SNPs, an APOA4/A5 intergenic SNP and two APOA4 variants. Together with four previously determined APOC3 variants (14), the map position of these 9 SNPs are presented in Figure 1A. The LD amongst the variants in the cluster is presented in Table 1. The two APOA5 variants showed strong negative allelic association with each other (D' -1.0, P<0.0005), as did the two APOA4 variants (D' -0.87, P<0.0005). While APOA5 -1131T>C showed strong positive linkage disequilibrium with all the other APOC3 variants, there was no significant LD with APOA4 Q360H. APOA5 S19W showed strong LD with all the variants but less strong with the APOC3 3238C>G and APOA4 Q360H and T347S. When the LD across the region was plotted in relation to the most distal marker S19W (Fig. 1B), it was apparent that these variants represent a block of LD.
|
|
Both APOA5 and APOA4 variants are associated with TG levels in NPHSII
We next examined the genotype distribution for the two APOA5 variants and the intergenic variant and their association with baseline phenotypes (Table 2). Allelic effects were seen primarily on plasma TG and to a lesser extent on HDL-C levels. Men who were homozygous for either -1131T>C (Table 2A) or S19W (Table 2B) rare alleles had 40% and 52% higher plasma TG levels, respectively than common allele homozygotes (P<0.003), supporting a recessive mode of inheritance. Carriers of the rare -1131C allele had lower HDL-C levels than TT men (P<0.04) but this did not reach the nominal levels of statistical significance set for this study (P<0.01). When these two variants were considered together, men who were compound heterozygotes for the two variants (TC/SW) had TG levels that were only 4% higher than non- carriers of the rare allele (1.85 mmol/l versus 1.77 mmol/l) and only those homozygous for either variant showed the strong TG-raising effects (2.42 mmol/l for -1131CC, 2.68 mmol/l for 19WW compared to 1.77 mmol/l for common allele homozygotes) (Fig. 2). Since the allelic association was negative, this implied complementation of the allelic effects. For the APOA4/A5 intergenic T>C variant there was a modest effect on TG levels, but in this case CC men had lower levels and TC men higher TG levels, as compared to TT homozygotes (Table 2C).
|
|
Considering APOA4 T347S and Q360H variants, T347S but not the Q360H had a strong effect on plasma TG levels (P=0.003). However in this case the rare 347SS homozygotes had the lowest plasma TG levels (1.49 mmol/l compared to 1.83 mmol/l for TT homozygotes) (Table 3).
|
Identification of TG-raising haplotypes
We previously reported a strong association between variation in APOC3 and TG levels in NPHSII (14). Whether the APOA5 and APOA4 associations with TG levels, shown above, were independent of APOC3 effects, or explained these APOC3 effects, due to the strong LD, was examined further using haplotype analysis.
Of the 512 theoretically possible haplotypes derived from all 9 polymorphic sites, only 62 were represented and we considered the twenty-two haplotypes, which occurred in more than 10 individuals, representing 95% of the sample. Significant differences in TG levels were seen overall by haplotype group (P<0.0006). The most common haplotype (haplotype 17) representing 32.3% of the sample, was defined by the common alleles at all 9 variant sites with a mean TG level of 1.75 mmol/l (Fig. 3). The haplotype associated with the highest TG level (haplotype 1) carried the APOA5 S19W rare allele on a common background (2.16 mmol/l). The next three haplotypes associated with high TG levels all carried the rare allele of the APOC3 -482C>T, in combination with (a) all other APOC3 rare alleles and the rare allele of APOA5 -1131T>C (2.15 mmol/l) (haplotype 2), (b) the rare allele of the APOA4/A5 intergenic T>C (2.05 mmol/l) (haplotype 3); or (c) the rare alleles of all APOC3 variants (2.04 mmol/l) (haplotype 4). The fifth haplotype in the ranking carried the APOA5 W19 together with the APOC3 1100T. The rare allele of the APOA5 -1131T>C on a common background was present on a haplotype determining TG levels in the middle of the spectrum (haplotype 10). The common allele of the APOA4 T347S (T347), due to the LD, was present on the 8 haplotypes associated with the highest TG levels, while the S347, associated with a TG-lowering effect, was on haplotypes that, for the most part, carried the common TG-lowering allele APOA5 S19 and to a lesser extent APOC3 -482C.
|
| DISCUSSION |
|---|
|
|
|---|
The results from this study clearly demonstrate that in this large dataset of healthy men representative of the general population, variation in APOA5 strongly contribute to plasma TG levels. The additional novel aspect of this present study is the ability to assess simultaneously the impact of variation in the APOC 3/A4/A5 locus on lipid traits. This is particularly relevant, since of the three genes initially known to constitute this locus (APOA1/C3/A4), polymorphisms in APOC3 have been shown to be strongly associated with plasma TG levels (13) and reviewed in (3). From the univariate analysis our data confirm that variations in APOA5 have a major effect on plasma TG levels, particularly the novel signal peptide variant (S19W) and the independent promoter -1131T>C variant (which also shows a weaker association with HDL-C). While the association with -1131T>C confirms the findings of Pennacchio et al. (2), the effect of S19W is supported by the current findings of Pennacchio et al. (19). In NPHSII, individuals homozygous for either rare allele had significantly higher plasma TG levels (between 4050%) than individuals homozygous for the common alleles. These allelic effects were recessive, as shown by the fact that heterozygotes had levels similar to common allele homozygotes and complementary, which implies that whatever the molecular mechanism these variants are acting independently.
There is strong evidence that LD in the human genome occurs in varying sized blocks, on average 1050 kb in size, interspersed with short intervals of recombinational hotspots (20,21). From the data available, considering the LD across the APOC3/A4/A5 locus (excluding the APOA1 gene, since at present there are no APOA1 data available in this study), it is clear that the two APOA5 variants, S19W, -1131T>C and the intergenic T>C, are all in strong allelic association. The strong LD between APOA5 and APOC3 raised the possibility that the effects on TG seen with APOC3 genotypes (3) might have been due to APOA5 variants. However the subsequent haplotype analysis identified that APOA5 S19W was independent of APOC3 TG-raising associations. The rare APOA5 W19 allele (haplotype 1), on a common background, defined the haplotype associated with the highest TG levels, while the three haplotypes associated with the next highest TG levels all carried the APOC3 -482C>T rare allele (-482T) in combination with either the other APOC3 variants (haplotypes 2 and 4), the APOA5 -1131T>C (haplotype 2) or the APOA4/A5 intergenic T>C (haplotype 3). There is a suggestion that APOC3 -482T requires an additional rare allele to have its effect, as indicated by the fact that the haplotype associated with the lowest TG level has the -482T allele on a wildtype background (haplotype 22). Furthermore, when APOA5 -1131C appeared on a wildtype background (haplotype 10) it was associated with moderate TG levels, and when it occurred together with the rare allele of the APOA4/A5 intergenic T>C it was associated with TG levels near the bottom of the ranking (haplotype 21). These findings support and extend the APOA5 haplotype analysis of Pennacchio et al. (19) which identified two APOA5 TG-raising haplotypes. Their haplotype APOA5*3, defined by APOA5 W19 on a wildtype background, corresponds to the haplotypes ranked 1 and 5 associated with the highest TG levels in NPHSII in our study (see Fig. 3). Their second TG-raising haplotype, APOA5*2 (19), is defined by the -1131C allele. Our results strongly suggest that the TG-raising effect of this haplotype reflect the LD between APOA5 -1131C and the TG-raising APOC3 -482T allele.
The APOA4, S347 allele which was associated with TG-lowering was primarily on a haplotype that carried the common alleles of APOA5 S19W and to a lesser extent APOC3 -482C>T, and thus its TG-lowering effect might be due to negative LD with these variants rather than due to a functional effect per se. Thus the haplotype data identifies the important TG-raising sites in the cluster, namely APOA5 S19W and APOC3 -482C>T.
There is good evidence to suggest that these two polymorphisms in APOC3 and APOA5 may have independent functional effects on plasma TG levels. The -482C>T SNP lies within an APOC3 insulin response element. The C>T change results in a loss of insulin repression of APOC3 leading to elevated APOCIII levels (22). For APOA5 the change from hydrophilic serine to hydrophobic tryptophan (S19W) within the hydrophobic domain of the APOAV signal peptide could radically affect its translocation across the endoplasmic reticulum, suggesting that S19W is potentially a functional change. A common three amino acid insertion/deletion variant in the signal peptide of APOB, which modulates the amount of APOB17 secreted by liver cells (23), is associated with differences in plasma lipid traits (24). The inverse relationship between apoAV and plasma TG levels, highlighted by the mouse transgenic and knockout studies (2), support a role for APOAV in human triglyceride metabolism and suggests that APOAV acts as a brake on triglyceride secretion from the liver. We propose that the W19 variant acts at the level of translocation of the growing APOAV peptide to reduce the amount of mature APOAV secreted across the endoplasmic reticulum where it will become associated with nascent APOB-containing lipoprotein particles. We speculate that if APOAV were to act by limiting the TG content of growing lipoprotein particles, for example if it were to influence MTP function, in subjects homozygous for the rare W19 variant, the resulting VLDL would be TG-enriched, which would be reflected in higher plasma TG levels. For the -1131T>C, which is located upstream of the proximal promoter no obvious transcription factor binding sites could be identified which suggests that this site itself may not be functional but is in LD with another functional site(s). Our haplotype analysis suggests that the functional change is APOC3 -482C>T. However, the possibility cannot be discounted that these sites are acting as markers for functional changes elsewhere in the gene cluster.
In conclusion, although the exact physiological function of APOCIII and APOAV remain undetermined, there are plausible explanations from the accumulated data on plasma lipid metabolism for their independent associations with TG levels, despite their strong LD. Future work aimed at examining even larger human study populations should help delineate the exact contribution of polymorphisms within this cluster to plasma triglycerides. Nonetheless, our results support an important role for this locus in determining TG levels, an independent risk factor for CHD (1).
| MATERIALS AND METHODS |
|---|
|
|
|---|
Population study (Northwick Park Heart Study (NPHSII))
This is a large prospective study of healthy middle-aged (5061 years) men drawn from nine UK general practices. Of the initial cohort of 3052 men, 2808 DNA samples were available. The study has been ongoing for nine years and men were followed-up annually for lipid levels (five years) (25,26). Briefly, 9 general medical practices participated in the study and men were excluded when there was a history of unstable angina, myocardial infarction, cerebrovascular disease, life-threatening malignancy or regular medication with aspirin or anticoagulants. Ethical approval was obtained from the USA National Institute of Health, who partially funded the study and from the local ethical committee in the UK. Serum TG and cholesterol concentrations were determined by automated enzymatic procedures (Sigma, Poole, Dorset) and APOB and APOAI were measured using immunoturbidometry (Incstar, Wokingham, Berkshire). Plasma high-density lipoprotein cholesterol (HDL-C) was measured using polyethylene glycol 8000 and enzymatic colorimitry (27) on plasma samples taken during the sixth year of the study.
DNA genotyping
Genotyping for the S19W, -1131T>C and the APOA5/A4 intergenic T>C were carried out by PCR and restriction enzyme digestion. All PCRs were performed in a MJ Research thermal cycler, using Taq polymerase (Amersham, UK).
S19W.
The following forward and reverse oligonucleotides were used for amplification:
Forward oligo 5' GGCTCTTCTTTCAGGTGGGTCTCCG
Reverse oligo 5' GCCTTTCCGTGCCTGGGTGGT
This amplification was designed to force a G>A (T in the reverse primer) which introduced a TaqI restriction site in the rare allele. After restriction enzyme digestion the common S allele gave fragments of 134 bp and 23 bp while the W allele gave a single 157 bp product. The PCR conditions were an initial denaturing at 96°C for 5 mins, followed by 30 cycles of 96°C/30 secs; 63°C/30 secs; 72°C/45 secs, and a final extension of 72°C/10 mins.
-1131T>C.
The following oligonucleotides were used for amplification:
Forward 5' GGAGCTTGTGAACGTGTGTATGAGT
Reverse 5' CCCCAGGAACTGGAGCGAAATT
This amplification was designed to force a C>A (T in the reverse primer), which introduced a MseI restriction site. These primers yielded a PCR fragment of 154 bp which after restriction enzyme digestion produced fragments of 133 bp and 21 bp for the T allele and a single uncut product for the C allele. The PCR conditions were an initial denaturation of 96°C/5 mins followed by 30 cycles of 96°C/30 secs 60°C/30 secs, 72°C/30 secs, and a final extension period at 72°C/10 mins.
APOA5/A4 intergenic T>C.
The following oligonucleotides were used for amplification:
Forward 5' GTGCCTGTCACCACCGTTTGG
Reverse 5' ATGCATTAGCCTCTGCTGTTC
This amplification was designed to force an A>G (in bold), which introduced a HaeIII restriction site producing a PCR fragment of 162 bp; after digestion this resulted in fragments 141 bp and 21 bp for the T allele and a single uncut product for the C allele. The PCR conditions were an initial denaturation of 96°C/5 mins followed by 30 cycles of 96°C/30 secs, 58°C/30 secs, 72°C/30 secs and a final extension period at 72°C/10 mins. All PCR products were separated using micro-array diagonal gel electrophoresis (MADGE) (28).
APOA4 T347S and Q360H polymorphisms were genotyped as previously described (29).
Statistical analysis
Statistical analysis was conducted using Intercooled STATA (version 6) (College Station, TX, USA) unless otherwise stated. Deviations from HardyWeinberg equilibrium were assessed using a
2 test. Pairwise linkage disequilibrium coefficients between polymorphisms were estimated using log-linear analysis (A) and their extents were expressed as the ratio of the unstandardized coefficients to their maximal value (+D(B).') (30,31). Cholesterol, TG, APOAI and APOB levels were available at baseline and cholesterol and TG for an additional five years. HDL-C concentrations were available for year 6 of the study. APOB and APOAI levels were only available in a subset of the subjects (there were no significant differences in any of the characteristics between those with and those without APOAI and APOB measures). TG, HDL-C, APOB, diastolic and systolic blood pressure were log transformed to normalise the distribution and obtain equality of variance, which are requirements of the analysis used. Associations between genotype and TG, cholesterol, HDL-C, APOB and APOAI age, body mass index (BMI), systolic and diastolic blood pressure were examined using ANOVA. ANOVA was employed to investigate the effect of APOA4 and APOA5 variants on levels of baseline TG and year 6 HDL. Haplotypes were estimated using PHASE (32) with a burn-in of 10 000 followed by 5000 interactions. In order to check consistency repeat runs were conducted. The results from repeat runs show minor inconsistencies, however haplotypes associated with high and low TG levels remained essentially the same. Differences in TG by haplotypes were considered using regression, allowing for the fact that each individual contributed twice, by the cluster option in STATA. Haplotypes present in less than 10 individuals were not considered in the analysis.
Statistical significance was taken as P<0.01. Following the suggestions of Rothman (33) and Perneger (34,35), this more conservative P-value was used in preference to correcting for multiple comparisons.
| ACKNOWLEDGEMENTS |
|---|
P.J.T., E.H., S.M. and S.E.H. are all supported by the British Heart Foundation. This work was also supported by the NIH, NHLBI, Programs for Genomic Application Grant HL66681 and performed under Department of Energy Contract DE-AC0376SF00098, University of California (L.A.P., E.M.R.). NPHSII was supported by the British Medical Research Council, the USA National Institute of Health (grant NHLBI 33014) and Du Pont Pharma, Wilmington, USA. We would like to thank Prof. Ian Day and Dr Divya Palamen for APOAIV genotyping of NPHSII and Peter Wootton and Ka Wah Li for excellent technical assistance. The following general practices collaborated in the study: The Surgery, Aston Clinton; Upper Gordon Road, Camberley; The Health Centre, Carnoustie; Whittington Moor Surgery, Chesterfield; The Market Place Surgery, Halesworth; The Health Centre, Harefield; Potterells Medical Centre, North Mymms; Rosemary Medical Centre, Parkstone, Poole; The Health Centre, St Andrews.
| FOOTNOTES |
|---|
* To whom correspondence should be addressed at: Division of Cardiovascular Genetics, British Heart Foundation Laboratories, Department of Medicine, Rayne Building, Royal Free and University College Medical School, 5 University St, London WC1E 6JJ, UK. Tel: +44 2076796968; Fax: +44 2076796212; Email: p.talmud{at}ucl.ac.uk
| REFERENCES |
|---|
|
|
|---|
1 Hokanson, J.E. and Austin, M.A. (1996) Plasma triglyceride level is a risk factor for cardiovascular disease independent of high-density lipoprotein cholesterol level: a meta-analysis of population-based prospective studies. J. Cardiovasc. Risk., 3, 213219.[Medline]
2
Pennacchio, L.A., Olivier, M., Hubacek, J.A., Cohen, J.C., Cox, D.R., Fruchart, J.C., Krauss, R.M. and Rubin, E.M. (2001) An apolipoprotein influencing triglycerides in humans and mice revealed by comparative sequencing. Science, 294, 169173.
3 Groenendijk, M., Cantor, R.M., de Bruin, T.W. and Dallinga-Thie, G.M. (2001) The apoAI-CIII-AIV gene cluster. Atherosclerosis, 157, 111.[ISI][Medline]
4 Shoulders, C.C., Harry, P.J., Lagrost, L., White, S.E., Shah, N.F., North, J.D., Gilligan, M., Gambert, P. and Ball, M.J. (1991) Variation at the apo AI/CIII/AIV gene complex is associated with elevated plasma levels of apo CIII. Atherosclerosis, 87, 239247.[ISI][Medline]
5 Bainton, D., Miller, N.E., Bolton, C.H., Yarnell, J.W., Sweetnam, P.M., Baker, I.A., Lewis, B. and Elwood, P.C. (1992) Plasma triglyceride and high density lipoprotein cholesterol as predictors of ischaemic heart disease in British men: the Caerphilly and Speedwell Collaborative Heart Disease Studies. Br. Heart J., 68, 6066.
6
Maeda, N., Li, H., Lee, D., Oliver, P., Quarfordt, S.H. and Osada, J. (1994) Targeted disruption of the apolipoprotein C-III gene in mice results in hypotriglyceridaemia and protection from postprandial hypertriglyceridaenia. J. Biol. Chem., 269, 2361023616.
7 Aalto Setala, K., Fisher, E.A., Chen, X., Chajek Shaul, T., Hayek, T., Zechner, R., Walsh, A., Ramakrishnan, R., Ginsberg, H.N. and Breslow, J.L. (1992) Mechanism of hypertriglyceridemia in human apolipoprotein (apo) CIII transgenic mice. Diminished very low density lipoprotein fractional catabolic rate associated with increased apo CIII and reduced apo E on the particles. J. Clin. Invest., 90, 18891900.[ISI][Medline]
8 Shachter, N.S., Hayek, T., Leff, T., Smith, J.D., Rosenberg, D.W., Walsh, A., Ramakrishnan, R., Goldberg, I.J., Ginsberg, H.N. and Breslow, J.L. (1994) Overexpression of apolipoprotein CII causes hypertriglyceridemia in transgenic mice. J. Clin. Invest., 93, 16831690.[Medline]
9
Steinmetz, A. and Utermann, G. (1985) Activation of lecithin cholesterol acyltransferase by human apolipoprotein A-IV. J. Biol. Chem., 260, 22582264.
10 Weinberg, R.B. (2002) Apolipoprotein A-IV polymorphisms and diet-gene interactions. Curr. Opin. Lipidol., 13, 125134.[Medline]
11 Tso, P., Chen, Q., Fujimoto, K., Fukagawa, K. and Sakata, T. (1995) Apolipoprotein A-IV: a circulating satiety signal produced by the small intestine. Obes. Res., 3(Suppl. 5), 689S695S.
12
Surguchov, A.P., Page, G.P., Smith, L., Patsch, W. and Boerwinkle, E. (1996) Polymorphic markers in apolipoprotein C-III gene flanking regions and hypertriglyceridemia. Arterioscler. Thromb. Vasc. Biol., 16, 941947.
13
Waterworth, D.M., Ribalta, J., Nicaud, V., Dallongeville, J., Humphries, S.E. and Talmud, P. (1999) ApoCIII gene variants modulate postprandial response to both glucose and fat tolerance tests. Circulation, 99, 18721877.
14
Waterworth, D.M., Talmud, P.J., Bujac, S.R., Fisher, R.M., Miller, G.J. and Humphries, S.E. (2000) The contribution of apoCIII gene variants to the determination of triglyceride levels and interaction with smoking in middle-aged men. Arterioscler. Thromb. Vasc. Biol., 20, 26632669.
15 Waterworth, D.M., Talmud, P.J., Humphries, S.E., Wicks, P.D., Sagnella, G.A., Strazullo, P., Alberti, K.G.M.M., Cook, D.G. and Cappuchio, F.P. (2001) Variable effecrs of the apoCIII C-482T variant on insulin, glucose and triglyceride levels in different ehtnic groups: GenderBMIGenotype interaction. Diabetalogia, 44, 245248.[ISI][Medline]
16 Peacock, R.E., Hamsten, A., Johansson, J., Nilsson Ehle, P. and Humphries, S.E. (1994) Associations of genotypes at the apolipoprotein AI-CIII-AIV, apolipoprotein B and lipoprotein lipase gene loci with coronary atherosclerosis and high density lipoprotein subclasses. Clin. Genet., 46, 273282.[ISI][Medline]
17 Ordovas, J.M., Civeira, F., Genest, J., Jr., Craig, S., Robbins, A.H., Meade, T., Pocovi, M., Frossard, P.M., Masharani, U., Wilson, P.W. et al. (1991) Restriction fragment length polymorphisms of the apolipoprotein A-I, C-III, A-IV gene locus. Relationships with lipids, apolipoproteins, and premature coronary artery disease. Atherosclerosis, 87, 7586.[ISI][Medline]
18
Der Vliet, H.N., Sammels, M.G., Leegwater, A.C., Levels, J.H., Reitsma, P.H., Boers, W. and Chamuleau, R.A. (2001) Apolipoprotein A-V. A novel apolipoprotein associated with an early phase of liver regeneration. J. Biol. Chem., 276, 4451244520.
19
Pennacchio, L.A., Olivier, M., Hubacek, J.A., Krauss, R.M., Rubin, E.M. and Cohen, J.C. (2002) Two independent apolipoprotein A5 haplotypes influence human plasma triglyceride levels. Hum. Mol. Genet., 11, 30313038.
20 Daly, M.J., Rioux, J.D., Schaffner, S.F., Hudson, T.J. and Lander, E.S. (2001) High-resolution haplotype structure in the human genome. Nat. Genet., 29, 229232.[ISI][Medline]
21 Jeffreys, A.J., Kauppi, L. and Neumann, R. (2001) Intensely punctate meiotic recombination in the class II region of the major histocompatibility complex. Nat. Genet., 29, 217222.[ISI][Medline]
22 Li, W.W., Dammerman, M.M., Smith, J.D., Metzger, S., Breslow, J.L. and Leff, T. (1995) Common genetic variation in the promoter of the human apo CIII gene abolishes regulation by insulin and may contribute to hypertriglyceridemia. J. Clin. Invest., 96, 26012605.[ISI][Medline]
23 Benhizia, F., Ginsberg, H.N., Humphries, S.E. and Talmud, P.J. (2001) Variation in the human ApoB signal peptide modulates ApoB17 translocation. Biochem. Biophys. Res. Commun., 283, 149157.[ISI][Medline]
24 Humphries, S.E. and Talmud, P.J. (1995) Hyperlipidaemia associated with genetic variation in the apolipoprotein B gene. Curr. Opin. Lipidol., 6, 215222.[ISI][Medline]
25 Miller, G.J., Bauer, K.A., Barzegar, S., Cooper, J.A. and Rosenberg, R.D. (1996) Increased activation of the haemostatic system in men at high risk of fatal coronary heart disease. Thromb. Haemost., 75, 767771.[ISI][Medline]
26 Humphries, S.E., Talmud, P.J., Hawe, E., Bolla, M., Day, I.N. and Miller, G.J. (2001) Apolipoprotein E4 and coronary heart disease in middle-aged men who smoke: a prospective study. Lancet, 358, 115119.[ISI][Medline]
27
Nanjee, M.N., Cooke, C.J., Wong, J.S., Hamilton, R.L., Olszewski, W.L. and Miller, N.E. (2001) Composition and ultrastructure of size subclasses of normal human peripheral lymph lipoproteins. Quantification of cholesterol uptake by hdl in tissue fluids. J. Lipid Res., 42, 639648.
28 Day, I.N., Humphries, S.E., Richards, S., Norton, D. and Reid, M. (1995) High-throughput genotyping using horizontal polyacrylamide gels with wells arranged for microplate array diagonal gel electrophoresis (MADGE). Biotechniques, 19, 830835.[ISI][Medline]
29
Fisher, R.M., Burke, H., Nicaud, V., Ehnholm, C. and Humphries, S.E. on behalf of the EARS Group. (1999) Effect of variation in the apo A-IV gene on body mass index and fasting and postprandial lipids in the European Atherosclerosis Research Study II. J. Lipid Res., 40, 287294.
30 Nei, M. (1987) In Molecular Evolutionary Genetics. Columbia University Press, New York.
31 Tiret, L., Amouyel, P., Rakotovao, R., Cambien, F. and Ducimetiere, P. (1991) Testing for association between disease and linked marker loci: a log- linear-model analysis. Am. J. Hum. Genet., 48, 926934.[ISI][Medline]
32 Stephens, M., Smith, N.J. and Donnelly, P. (2001) A new statistical method for haplotype reconstruction from population data. Am. J. Hum. Genet., 68, 978989.[ISI][Medline]
33 Rothman, K.J. (1990) No adjustments are needed for multiple comparisons. Epidemiology, 1, 4346.[Medline]
34
Perneger, T.V. (1998) What's wrong with Bonferroni adjustments. Br. Med. J., 316, 12361238.
35 Perneger, T.V. (1999) Adjusting for multiple testing in studies is less important than other concerns. Br. Med. J., 318, 1288.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
C. S. Gangabadage, J. Zdunek, M. Tessari, S. Nilsson, G. Olivecrona, and S. S. Wijmenga Structure and Dynamics of Human Apolipoprotein CIII J. Biol. Chem., June 20, 2008; 283(25): 17416 - 17427. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Olano-Martin, E. C. Abraham, R. Gill-Garrison, A. M. Valdes, K. Grimaldi, F. Tang, K. G. Jackson, C. M. Williams, and A. M. Minihane Influence of apoA-V gene variants on postprandial triglyceride metabolism: impact of gender J. Lipid Res., May 1, 2008; 49(5): 945 - 953. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Nelbach, X. Shu, R. J. Konrad, R. O. Ryan, and T. M. Forte Effect of apolipoprotein A-V on plasma triglyceride, lipoprotein size, and composition in genetically engineered mice J. Lipid Res., March 1, 2008; 49(3): 572 - 580. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Grallert, E.-M. Sedlmeier, C. Huth, M. Kolz, I. M. Heid, C. Meisinger, C. Herder, K. Strassburger, A. Gehringer, M. Haak, et al. APOA5 variants and metabolic syndrome in Caucasians J. Lipid Res., December 1, 2007; 48(12): 2614 - 2621. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wang, H. Cao, M. R. Ban, B. A. Kennedy, S. Zhu, S. Anand, S. Yusuf, R. L. Pollex, and R. A. Hegele Resequencing Genomic DNA of Patients With Severe Hypertriglyceridemia (MIM 144650) Arterioscler. Thromb. Vasc. Biol., November 1, 2007; 27(11): 2450 - 2455. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Qu, G. Perdomo, D. Su, F. M. D'Souza, N. S. Shachter, and H. H. Dong Effects of apoA-V on HDL and VLDL metabolism in APOC3 transgenic mice J. Lipid Res., July 1, 2007; 48(7): 1476 - 1487. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Hegele and R. L. Pollex Apolipoprotein A-V Genetic Variation and Plasma Lipoprotein Response to Fibrates Arterioscler. Thromb. Vasc. Biol., June 1, 2007; 27(6): 1224 - 1227. [Full Text] [PDF] |
||||
![]() |
R. Moreno-Luna, F. Perez-Jimenez, C. Marin, P. Perez-Martinez, P. Gomez, Y. Jimenez-Gomez, J. Delgado-Lista, J. A. Moreno, T. Tanaka, J. M. Ordovas, et al. Two Independent Apolipoprotein A5 Haplotypes Modulate Postprandial Lipoprotein Metabolism in a Healthy Caucasian Population J. Clin. Endocrinol. Metab., June 1, 2007; 92(6): 2280 - 2285. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-Q. Lai, D. K. Arnett, D. Corella, R. J. Straka, M. Y. Tsai, J. M. Peacock, X. Adiconis, L. D. Parnell, J. E. Hixson, M. A. Province, et al. Fenofibrate Effect on Triglyceride and Postprandial Response of Apolipoprotein A5 Variants: The GOLDN Study Arterioscler. Thromb. Vasc. Biol., June 1, 2007; 27(6): 1417 - 1425. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. G. Schaap, M. C. Nierman, J. F. P. Berbee, H. Hattori, P. J. Talmud, S. F. C. Vaessen, P. C. N. Rensen, R. A. F. M. Chamuleau, J. A. Kuivenhoven, and A. K. Groen Evidence for a complex relationship between apoA-V and apoC-III in patients with severe hypertriglyceridemia J. Lipid Res., October 1, 2006; 47(10): 2333 - 2339. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. F. C. Vaessen, F. G. Schaap, J.-A. Kuivenhoven, A. K. Groen, B. A. Hutten, S. M. Boekholdt, H. Hattori, M. S. Sandhu, S. A. Bingham, R. Luben, et al. Apolipoprotein A-V, triglycerides and risk of coronary artery disease: the prospective Epic-Norfolk Population Study J. Lipid Res., September 1, 2006; 47(9): 2064 - 2070. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Reue and L. Vergnes Thematic review series: Systems Biology Approaches to Metabolic and Cardiovascular Disorders. Approaches to lipid metabolism gene identification and characterization in the postgenomic era J. Lipid Res., September 1, 2006; 47(9): 1891 - 1907. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-Q. Lai, D. Corella, S. Demissie, L. A. Cupples, X. Adiconis, Y. Zhu, L. D. Parnell, K. L. Tucker, and J. M. Ordovas Dietary Intake of n-6 Fatty Acids Modulates Effect of Apolipoprotein A5 Gene on Plasma Fasting Triglycerides, Remnant Lipoprotein Concentrations, and Lipoprotein Particle Size: The Framingham Heart Study Circulation, May 2, 2006; 113(17): 2062 - 2070. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Elosua, J. M. Ordovas, L. A. Cupples, C.-Q. Lai, S. Demissie, C. S. Fox, J. F. Polak, P. A. Wolf, R. B. D'Agostino Sr., and C. J. O'Donnell Variants at the APOA5 locus, association with carotid atherosclerosis, and modification by obesity: the Framingham Study J. Lipid Res., May 1, 2006; 47(5): 990 - 996. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Hodoglugil, S. Tanyolac, D. W. Williamson, Y. Huang, and R. W. Mahley Apolipoprotein A-V: a potential modulator of plasma triglyceride levels in Turks J. Lipid Res., January 1, 2006; 47(1): 144 - 153. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Ruiz-Narvaez, Y. Yang, Y. Nakanishi, J. Kirchdorfer, and H. Campos APOC3/A5 haplotypes, lipid levels, and risk of myocardial infarction in the Central Valley of Costa Rica J. Lipid Res., December 1, 2005; 46(12): 2605 - 2613. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ishihara, T. Kujiraoka, T. Iwasaki, M. Nagano, M. Takano, J. Ishii, M. Tsuji, H. Ide, I. P. Miller, N. E. Miller, et al. A sandwich enzyme-linked immunosorbent assay for human plasma apolipoprotein A-V concentration J. Lipid Res., September 1, 2005; 46(9): 2015 - 2022. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Talmud, J. Palmen, W. Putt, L. Lins, and S. E. Humphries Determination of the Functionality of Common APOA5 Polymorphisms J. Biol. Chem., August 5, 2005; 280(31): 28215 - 28220. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Lookene, J. A. Beckstead, S. Nilsson, G. Olivecrona, and R. O. Ryan Apolipoprotein A-V-heparin Interactions: IMPLICATIONS FOR PLASMA LIPOPROTEIN METABOLISM J. Biol. Chem., July 8, 2005; 280(27): 25383 - 25387. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Gerritsen, P. C. N. Rensen, K. E. Kypreos, V. I. Zannis, L. M. Havekes, and K. Willems van Dijk ApoC-III deficiency prevents hyperlipidemia induced by apoE overexpression J. Lipid Res., July 1, 2005; 46(7): 1466 - 1473. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Frances, D. Corella, J. V. Sorli, M. Guillen, J. I. Gonzalez, and O. Portoles Validating a Rapid Method for Detecting Common Polymorphisms in the APOA5 Gene by Melting Curve Analysis Using LightTyper Clin. Chem., July 1, 2005; 51(7): 1279 - 1282. [Full Text] [PDF] |
||||
![]() |
A. C.M. Jansen, E. S. van Aalst-Cohen, M. W.T. Tanck, S. Cheng, M. R. Fontecha, J. Li, J. C. Defesche, and J. J.P. Kastelein Genetic Determinants of Cardiovascular Disease Risk in Familial Hypercholesterolemia Arterioscler. Thromb. Vasc. Biol., July 1, 2005; 25(7): 1475 - 1481. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Hubacek, A. |








