Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (76)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Morgan, D.
Right arrow Articles by Goodship, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Morgan, D.
Right arrow Articles by Goodship, J. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2002, Vol. 11, No. 26 3345-3350
© 2002 Oxford University Press

Expression analyses and interaction with the anaphase promoting complex protein Apc2 suggest a role for inversin in primary cilia and involvement in the cell cycle

David Morgan1,{dagger}, Lorraine Eley1,{dagger}, John Sayer2, Tom Strachan1,*, Laura M. Yates1, A. Scott Craighead1 and Judith A. Goodship1

1Institute of Human Genetics, University of Newcastle, International Centre for Life, Central Parkway, Newcastle upon Tyne. NE1 3BZ and 2Department of Physiological Sciences, University of Newcastle, Medical School, Framlington Place, University of Newcastle upon Tyne, Newcastle upon Tyne. NE2 4HH

Received September 5, 2002; Accepted October 15, 2002


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS AND DISCUSSION
 METHODS
 REFERENCES
 
Homozygous inv mice lack a functional inversin protein and exhibit situs inversus plus severe cystic changes in the kidney and pancreas. Although the inversin sequence has provided few clues to its function, we and others have previously identified calmodulin as a binding partner. We now provide evidence that inversin interacts with the anaphase promoting complex protein Apc2. As expected of an Apc2 target, inversin possesses D-boxes and site-directed mutagenesis of the well-conserved D-box residues abrogates inversin–Apc2 interaction. An inversin-specific antibody reveals a dynamic expression pattern throughout the cell cycle and strong expression in the primary cilia of renal epithelium. Our data support a role for inversin in primary cilia and involvement in the cell cycle. Mutations of the proteins polaris, cystin and polycystin-2 which are expressed in renal epithelium primary cilia, lead to renal cystic changes. Aberrant cell proliferation is also involved in cyst development. The data reported here suggest that inversin may provide a link between these two mechanisms.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS AND DISCUSSION
 METHODS
 REFERENCES
 
The inv (inversion of embryo turning) mouse is an insertional mutant with a complex phenotype: homozygotes exhibit consistent situs abnormalities (unlike other mouse models of laterality defects where situs is randomized) and also severe cystic changes of the kidney and pancreas (1). Of the various mouse mutants displaying laterality disturbance or polycystic kidneys, only two other mutants, orpk (2) and pkd2 (3) have been reported with the same type of complex phenotype as seen in the inv mouse.

Primary cilia provide a common link between these two phenotypic aspects. Various mouse laterality mutants have been shown to display nodal cilia with aberrant morphology or motility (2,47) and the primary cilia of the embryonic node have been envisaged to play a major role in left–right axis determination (8,9). Primary cilia of renal tubule principal cells, which project into the lumen, have also been implicated in renal cyst formation: in each of the orpk (10), pkd2 (11) and cpk (12) mutants the normal products of the mutated loci (polaris, polycystin-2 and cystin, respectively) localize to renal primary cilia. Polaris has been shown to be a component of the intraflagellar transport system that is essential for ciliogenesis and as a result, polaris-deficient mutants lack cilia, both in the kidney and at the embryonic node (2,13).

Of the mechanisms implicated in cyst development, abnormal proliferation of renal tubular cells is a consistent characteristic finding in both humans and animal models with polycystic kidneys (1416). The link between cilia and aberrant cell proliferation has, however, not been clear.

Invs, the gene mutated in the inv mouse, specifies a 1062 amino acid protein, inversin, whose precise function remains unclear (17,18). At the N-terminal end are 16 ankyrin repeats spanning amino acids 13–557 and putative nuclear-localization sequences have been reported at positions 589–604 and 782–798 (18). Evolutionary analyses have shown strong conservation of the ankyrin repeat region and also of a lysine-rich central domain spanning amino acids 558–604 (19). A highly conserved IQ calmodulin binding domain was identified in the lysine-rich central domain and another such domain in the otherwise poorly conserved C-terminal region and yeast two-hybrid screens, plus confirmatory co-immunoprecipitation and mutagenesis studies have identified calmodulin as an inversin binding partner (19,20).

In the present study we report evidence for another binding partner for inversin: Apc2, a subunit of the anaphase promoting complex. We also report that in dividing MDCK-II renal cells inversin has a dynamic pattern of expression through the cell cycle and although not essential for ciliogenesis, it is strongly expressed in the primary cilia of renal inner medullary collecting duct cells. Our data lead us to speculate on how an involvement in the cell cycle could explain the link between inversin and cystic kidneys.


    RESULTS AND DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS AND DISCUSSION
 METHODS
 REFERENCES
 
Inversin binds to the Apc2 subunit of the anaphase promoting complex and inversin–Apc2 interaction is dependent on a conserved D-box motif
We previously reported that calmodulin was a binding partner for inversin in a yeast two-hybrid screen (19). This screen also provided evidence for interaction between inversin and the Apc2 subunit of the anaphase promoting complex (APC; also called cyclosome). The APC, which consists of at least 10 subunits in vertebrates, is responsible for the ubiquitination of cell regulators at the metaphase–anaphase and mitosis–G1 transitions (21). A conserved destruction box (D-box) is important for the ubiquitination-mediated destruction of most APC targets and has a consensus sequence of RxxLxxxxN/D/E (21,22).

Inspection of the available inversin sequences revealed the presence of two conserved D-boxes: an N-terminal D-box at amino acids 490–498, within the ankyrin repeat domain (D-box #1); and a C-terminal D-box spanning amino acids 907–915 (D-box #2; see Fig. 1). We tested the importance of the D-boxes for inversin–Apc2 interaction by using a directed yeast two-hybrid assay with an activation domain-linked Apc2 prey and baits of normal or D-box-modified inversin linked to a Gal4 binding domain. Modification of individual D-boxes involved sequential site-directed mutagenesis to convert both end residues of the D-box to alanine, a strategy known to abrogate the functions of D-boxes in other proteins (2325). The net effect of modifying D-box #1 was to disrupt inversin–Apc2 interaction but the equivalent modification in D-box #2 did not abolish the interaction (Table 1). The differential D-box effects may relate to their respective amino acid environments: the sequence encompassing D-box #1 has been extremely highly conserved during evolution, whereas that of D-box #2 is much less conserved (Fig. 1).



View larger version (24K):
[in this window]
[in a new window]
 
Figure 1. Inversin structure and D-box conservation. (A) Principal features of the inversin sequence (see (19) for further details of positions of ankyrin repeats, IQ domains and alternative isoforms). Numbers indicate amino acid position. (B) Sequence conservation of inversin D-box regions. Dashes indicate identity to the reference mouse amino acid sequence. Sequences of the inversin orthologues were as reported in (19), except for the pufferfish sequence which has very recently been released (36). Sequences corresponding to the C-terminal of listed inversin orthologues have not yet been identified in pufferfish and xenopus. The three key conserved amino acid positions in the consensus D-box sequence (RxxLxxxxN where x= any amino acid—see Ref. 22) are shown by bold and shading. Asterisks indicate the residues that were selected for mutagenesis to alanine.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Effect of inversin D-box modification on Apc2–inversin interaction in a directed yeast two hybrid assay
 
Additional verification of the inversin–Apc2 interaction was obtained by co-immunoprecipitation studies. Specific polyclonal antiserum to inversin (19) and human APC2 were used to immunoprecipitate protein complexes from 14.5 day post coitum wild-type mouse embryo extracts. Western blotting of the immunoprecipitates with the reciprocal antibody resulted in bands of the expected molecular size (Fig. 2).



View larger version (45K):
[in this window]
[in a new window]
 
Figure 2. Co-immunoprecipitation of inversin and APC2. Specific polyclonal antisera to inversin (panel A, lane 2) and APC2 (panel B, lane 2) were used to immunoprecipitate protein complexes from 14.5 dpc wild-type mouse embryo extracts as described previously (19). Proteins precipitated by the inversin or APC2 antibodies were analysed by western blotting with the reciprocal APC2 or inversin antibody. Indicated size markers shown by arrows were obtained using the prestained protein marker preparation from New England Biolabs Inc. The bands indicated by arrowheads correspond to the expected molecular weights of APC2 (A) at 85 kDa and inversin (B) at 165 kDa. The other band at ~60 kDa in panel A is due to cross reaction of the anti inversin IgG used for the immunoprecipitation with the secondary antibody used for western blotting. Lane 1 in panels A and B are controls where the immunoprecipitation reactions were performed in the absence of the respective polyclonal antisera.

 
Inversin displays a dynamic expression pattern through the cell cycle and is strongly expressed in primary cilia but is not essential for ciliogenesis
The interaction with Apc2 suggested that inversin may have some involvement in the cell cycle. To investigate this further we sought to determine the intracellular localization of inversin at different stages in the cell cycle. Using a rabbit polyclonal anti-inversin antibody (19), we examined inversin expression by immunofluorescence staining of cultured MDCK-II cells, a canine kidney cell line. A generalized nuclear staining was evident prior to nuclear envelope breakdown, whereupon a dynamic pattern of expression was clear at different cell cycle stages (Fig. 3). Cells in early prophase showed strong expression at the centrosomes (Fig. 3A) but in metaphase and anaphase inversin localized to the spindle poles (Fig. 3B and C). In cells at late telophase undergoing cytokinesis (Fig. 3D) expression was observed at the midbody, a region of microtubule overlap. The observed dynamic expression of inversin during the cell cycle lends further credence to the interaction between inversin and Apc2 which has also been reported to be specifically expressed in the centrosome (26).



View larger version (80K):
[in this window]
[in a new window]
 
Figure 3. Dynamic expression of inversin in cultured kidney cells. Immunofluorescence staining of MDCK-II cells with rabbit polyclonal anti-inversin antibody (green) shows a dynamic expression throughout the cell cycle. Cells in early prophase (A) show inversin expression at the centrosomes whereas in metaphase (B) and anaphase (C) cells inversin localizes to the spindle poles. In cells undergoing cytokinesis (D) expression was observed at the midbody, a region of microtubule overlap. Throughout these stages general nuclear expression is also observed, which becomes ubiquitous upon breakdown of the nuclear envelope. The plasma membranes were counterstained with TRITC-wheat germ agglutinin (red).

 
Given that primary cilia provide a link between left–right axis specification and cystic kidneys (see Introduction) we also sought evidence for expression of inversin in the primary cilia of renal cells. When cultured at high cell densities, the mouse inner medullary collecting duct cell line (mIMCD-3) produces primary cilia. Using an inversin-specific antibody we were able to show strong inversin expression in these cilia (Fig. 4A and D). Double staining experiments using an acetylated tubulin antibody as a reference marker for primary cilia (Fig. 4A–H) showed that all cilia expressed the inversin protein. Despite extensive co-localization of inversin and acetylated tubulin (yellow signal in Fig. 4C and F–H), inversin staining appeared to be more pronounced in the varicosities, swellings observed in the cilia. Videomicroscopic studies have shown that these ciliary swellings move along the cilium shaft (27).



View larger version (58K):
[in this window]
[in a new window]
 
Figure 4. Inversin localizes to the primary cilia of kidney cells, but is not essential for ciliogenesis. Immunofluorescence staining of mIMCD-3 cells with rabbit polyclonal anti-inversin antibody (A and D) and anti-acetylated tubulin (B and E), a marker of primary cilia, demonstrate the expression of inversin in the primary cilia of kidney cells. Composite images of inversin and acetylated tubulin (C, F, G and H) show that co-localization of signal (yellow) occurs. Expression of inversin appears to be more pronounced in varicosities (D and F; see arrows). A, B and C are at low magnification and show several cilia; D, E, F, G and H show single cilia at higher magnification. Scanning electron micrographs of renal cilia in the 5 day inversin homozygote (I) knockout appear normal when compared to a wild-type litter mate (J).

 
Although inversin is strongly expressed in renal primary cilia varicosities, our scanning electron microscopy studies have shown that the length and gross morphology of renal cilia from homozygous inv mice appear normal (Fig. 4I and J). Inversin does not therefore appear to be required for structural assembly of the cilia. Instead, it may play a role in the recently proposed function of primary cilia as sensory organelles (28).

The link between inversin, the cell cycle and cyst formation
There are a number of factors in cyst formation including increased proliferation and hypersecretion. Increased proliferation is an early event in the process as the proliferative index is increased in non-cystic portions of renal tubules taken from patients with both autosomal dominant and autosomal recessive polycystic kidney disease (29). Although 95% of patients with ADPKD have a dominant germline mutation in either PKD1 or PKD2, cyst formation appears to be recessive at the cellular level (15,16). The observation that loss of heterozygosity for PKD1 or PKD2 is evident in 30–40% of cysts, has raised the possibility of mutations in a number of other genes encoding proteins which interact with polycystin 1 and 2 (16,30,31).

The possibility that inversin acts in the polycystin pathway has been strengthened by the recent finding that a Pkd2 knockout mouse shows randomized laterality as well as polycystic kidneys (3) and that polycystin 2, a calcium permeable ion channel, localizes to the primary cilia of MDCK cells (11). Our finding that inversin, like the proteins of other polycystic mouse models, also localizes to renal primary cilia raises the possibility that these cilia serve to regulate renal tubular cell proliferation.

Having long been dismissed as rudimentary structures, primary cilia are now the focus of much interest. These rod-like structures arise from centrosomes and are resorbed during mitosis, to be reassembled through interphase. Given the pivotal role of centrosomes in cell spindle formation, the cilia–centrosome link has been postulated to offer an ideal system in which cell division occurs in response to the external environment (32,33). Praetorius and Spring (28) have found that bending of primary cilia (by increased flow rate or suction) results in an influx of extracellular calcium followed by calcium release from inositol-1,4,5-triphosphate stores and subsequent spreading of the calcium signal to neighbouring cells. This culminates in profound hyperpolarization of the cell, and on the basis of these observations primary cilia have been proposed to act as sensors (28).

An increase in the rate of cell proliferation is a key event in the cystic process. Inversin interacts with Apc2, a component of the anaphase promoting complex and shows a dynamic expression pattern in mitotic cells. Inversin also interacts with calmodulin in a calcium-regulated manner and both inversin and polycystin 2, a calcium channel protein, localize to the primary cilium of renal tubular cells. We speculate that the link between inversin, polycystins 1 and 2, the cell cycle and calcium is that primary cilia serve as an environmental sensor for the centrosome, thereby regulating the cell cycle.


    METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS AND DISCUSSION
 METHODS
 REFERENCES
 
Yeast two-hybrid assays and site-directed mutagenesis
As detailed in (19), a yeast two-hybrid screen was conducted using an inversin cDNA-containing bait plasmid to identify interacting proteins from a 7 day post coitum (dpc) mouse cDNA library. After identifying positive interaction with Apc2, follow-up yeast two-hybrid assays involved directed screening for interaction between an activation domain-linked Apc2 prey and various Gal4 binding domain-linked inversin baits, some of which had been subject to site-directed mutagenesis of one or both D-boxes.

The same inversin bait plasmid as in the initial yeast two-hybrid screen was subjected to sequential rounds of mutagenesis using the Quick-Change mutagenesis kit (Stratagene) to create double mutations in the sequences specifying individual D-boxes. The mutagenesis design was to change the N-terminal conserved arginine and C-terminal conserved asparagine of each D-box to alanine in both cases, as has been described previously for other D-boxes (2325). The oligonucleotides used to create the mutants are listed with the mutated bases shown in italics and by underlining:

  • D-box #1 (R->A): GACAAAGAGGGAGCCACAGCTTTGCAC
  • D-box #1 (N->A): GCACTGGTCCTGCGCCAATGGCTACCT
  • D-box #2 (R->A): AGGGAACGAAGCGCGAAAGAGCTGTTT
  • D-box #2 (N->A): TTTCGACGGAAAGCCAAGGCAGCGGCG

To generate a plasmid with both D-boxes mutated a clone containing mutated D-box #2 was digested with NheI and SalI and the 750 bp fragment released was ligated into a plasmid containing mutated D-box #1.

Immunoprecipitation
Soluble protein extracts were prepared by homogenizing a single 14.5 dpc mouse embryo in 1 ml IP buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 1 mM EGTA, 1% NP-40 and 1x protease inhibitor cocktail). The soluble cell extracts were obtained by centrifugation at 15 000 g for 10 min at 4°C and the protein concentration was determined by the Bio-Rad DC protein colorimetric assay using bovine serum albumin as standard. Co-immunoprecipitation was performed as described previously (19). Two co-immunoprecipitation reactions were performed separately using an inversin antibody (19) and a commercially available rabbit polyclonal anti-Apc2 antibody (34,35). Western blotting was then performed with the corresponding antibody.

Immunofluorescence
mIMCD-3 cells were grown to confluence on Lab-Tek® chamber slidesTM (Nalge Nunc International). Cells were fixed in 3% PFA for 10 minutes, permeabilized with 0.5% Triton X-100 for 10 minutes and then blocked with 5% BSA in PBS for 5 minutes. Blocked cells were incubated with rabbit polyclonal anti-inversin (1 : 100) and mouse monoclonal anti-acetylated tubulin (1 : 1000) (Sigma) diluted in blocking buffer overnight at room temperature. Cells were washed 3 times with PBS and then incubated with fluorescein conjugated goat anti-rabbit IgG (Vector Laboratories) and TRITC conjugated rabbit anti-mouse (Dako) diluted 1 : 100 in blocking buffer overnight at room temperature. Cells were washed 3 times in PBS and mounted using Vectashield® (Vector laboratories). The images were captured with a Zeiss LSM 510 confocal microscope using FITC and TRITC filter sets with sequential scanning. MDCK-II cells were grown on flat bottomed microplates for two weeks then fixed with 3% PFA for 10 minutes. Cells were permeabilized with 0.1% Triton X-100 for 15 minutes and then blocked with 3% horse serum in PBS for 15 minutes. Blocked cells were incubated with rabbit polyclonal anti-inversin (1 : 100) for 2 hours at room temperature then overnight at 4°C. Cells were washed with PBS, blocked for 15 minutes with 3% goat serum and then incubated with goat anti-rabbit IgG FITC (Sigma) (1 : 50) for 1 hour at room temperature. Cells were washed with PBS then incubated for 2 minutes only with TRITC conjugated wheat germ agglutinin (Vector Laboratories) (1 : 10) for use as a plasma membrane marker. Images were captured with a Leica TCS-NT confocal microscope using FITC and TRITC filter sets with sequential scanning.

Scanning electron microscopy
Kidneys were removed from 5 day old inv homozygote mice and wild-type littermates and immediately fixed in 2% glutaraldehyde in Sorenson's buffer pH7 overnight at 4°C. The kidneys were ethanol-dehydrated, placed in liquid nitrogen and then fractured on pre-chilled foil using forceps to expose the cilia. The fractured kidneys were washed sequentially in 90%, 95% and 100% ethanol for 1 hour each. The tissue was air dried using liquid CO2 and covered in gold. Tissue morphology was captured using a Cambridge S240 scanning electron microscope.


    ACKNOWLEDGEMENTS
 
We would like to thank Trevor Booth (University of Newcastle-upon-Tyne) for his help with the scanning EM images. This work was supported by the Biotechnology and Biological Sciences Research Council, the British Heart Foundation, the Lily Ross Fund, the Medical Research Council and the National Kidney Research Fund.


    FOOTNOTES
 
* To whom correspondence should be addressed at: Institute of Human Genetics, University of Newcastle upon Tyne, International Centre for Life, Central Parkway, Newcastle upon Tyne. NE1 3BZ, UK. Tel.: +44 1912418616; Fax: +44 1912418699; Email: tom.strachan{at}ncl.ac.uk Back

{dagger} The authors wish it to be known that, in their opinion, these two authors should be considered as joint First Authors. Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS AND DISCUSSION
 METHODS
 REFERENCES
 
1 Yokoyama, T., Copeland, N.G., Jenkins, N.A., Montgomery, C.A., Elder, F.F. and Overbeek, P.A. (1993) Reversal of left-right asymmetry: a situs inversus mutation. Science, 260, 679–682.[Abstract/Free Full Text]

2 Murcia, N.S., Richards, W.G., Yoder, B.K., Mucenski, M.L., Dunlap, J.R. and Woychik, R.P. (2000) The Oak Ridge Polycystic Kidney (orpk) disease gene is required for left-h;right axis determination. Development, 127, 2347–2355.[Abstract]

3 Pennekamp, P., Karcher, C., Fischer, A., Schweickert, A., Skryabin, B., Horst, J., Blum, M. and Dworniczak, B. (2002) The ion channel polycystin-2 is required for left–right axis determination in mice. Curr. Biol., 12, 938–943.[Web of Science][Medline]

4 Nonaka, S., Tanaka, Y., Okada, Y., Takeda, S., Harada, A., Kanai, Y., Kido, M. and Hirokawa, N. (1998) Randomization of left-right asymmetry due to loss of nodal cilia generating leftward flow of extraembryonic fluid in mice lacking KIF3B motor protein. Cell, 95, 829–837.[Web of Science][Medline]

5 Marszalek, J.R., Ruiz-Lozano, P., Roberts, E., Chien, K.R. and Goldstein, L.S. (1999) Situs inversus and embryonic ciliary morphogenesis defects in mouse mutants lacking the KIF3A subunit of kinesin–II. Proc. Natl Acad. Sci. USA, 96, 5043–5048.[Abstract/Free Full Text]

6 Supp, D.M., Brueckner, M., Kuehn, M.R., Witte, D.P., Lowe, L.A., McGrath, J., Corrales, J. and Potter, S.S. (1999) Targeted deletion of the ATP binding domain of left–right dynein confirms its role in specifying development of left–right asymmetries. Development, 126, 5495–5504.[Abstract]

7 Takeda, S., Yonekawa, Y., Tanaka, Y., Okada, Y., Nonaka, S. and Hirokawa, N. (1999) Left–right asymmetry and kinesin superfamily protein KIF3A: new insights in determination of laterality and mesoderm induction by kif3A-/- mice analysis. J. Cell Biol., 145, 825–836.[Abstract/Free Full Text]

8 Moon, R.T. and Shah, K. (2002) Developmental biology: Signalling polarity. Nature, 417, 239–240.[Medline]

9 Essner, J.J., Vogan, K.J., Wagner, M.K., Tabin, C.J., Yost, H.J. and Brueckner, M. (2002) Conserved function for embryonic nodal cilia. Nature, 418, 37–38.[Medline]

10 Taulman, P.D., Haycraft, C.J., Balkovetz, D.F. and Yoder, B.K. (2001) Polaris, a protein involved in left–right axis patterning, localizes to basal bodies and cilia. Mol. Biol. Cell, 12, 589–599.[Abstract/Free Full Text]

11 Pazour, G.J., San Agustin, J.T., Follit, J.A., Rosenbaum, J.L. and Witman, G.B. (2002) Polycystin-2 localizes to kidney cilia and the ciliary level is elevated in orpk mice with polycystic kidney disease. Curr. Biol., 12, R378–380.[Web of Science][Medline]

12 Hou, X. (2002) Cystin, a novel cilia-associated protein, is disrupted in the cpk mouse model of polycystic kidey disease. J. Clin. Invest., 109, 533–540.[Web of Science][Medline]

13 Yoder, B.K., Tousson, A., Millican, L., Wu, J.H., Bugg, C.E., Jr., Schafer, J.A. and Balkovetz, D.F. (2002) Polaris, a protein disrupted in orpk mutant mice, is required for assembly of renal cilium. Am. J. Physiol. Renal Physiol., 282, F541–F552.[Abstract/Free Full Text]

14 Sullivan, L.P., Wallace, D.P. and Grantham, J.J. (1998) Epithelial transport in polycystic kidney disease. Physiol. Rev., 78, 1165–1191.[Abstract/Free Full Text]

15 Murcia, N.S., Sweeney, W.E., Jr. and Avner, E.D. (1999) New insights into the molecular pathophysiology of polycystic kidney disease. Kidney Int., 55, 1187–1197.[Web of Science][Medline]

16 Arnaout, M.A. (2001) Molecular genetics and pathogenesis of autosomal dominant polycystic kidney disease. Ann. Rev. Med., 52, 93–123.[Web of Science][Medline]

17 Mochizuki, T., Saijoh, Y., Tsuchiya, K., Shirayoshi, Y., Takai, S., Taya, C., Yonekawa, H., Yamada, K., Nihei, H., Nakatsuji, N. et al. (1998) Cloning of inv, a gene that controls left/right asymmetry and kidney development. Nature, 395, 177–181.[Medline]

18 Morgan, D., Turnpenny, L., Goodship, J., Dai, W., Majumder, K., Matthews, L., Gardner, A., Schuster, G., Vien, L., Harrison, W. et al. (1998) Inversin, a novel gene in the vertebrate left–right axis pathway, is partially deleted in the inv mouse. Nat. Genet., 20, 149–156.[Web of Science][Medline]

19 Morgan, D., Goodship, J., Essner, J.J., Vogan, K.J., Turnpenny, L., Yost, J., Tabin, C.J. and Strachan, T. (2002) The left–right determinant inversin has highly conserved ankyrin repeat and IQ domains and interacts with calmodulin. Hum. Genet., 110, 377–384.[Web of Science][Medline]

20 Yasuhiko, Y., Imai, F., Ookubo, K., Takakuwa, Y., Shiokawa, K. and Yokoyama, T. (2001) Calmodulin binds to inv protein: implication for the regulation of inv function. Dev. Growth Differ., 43, 671–681.[Web of Science][Medline]

21 Zachariae, W. and Nasmyth, K. (1999) Whose end is destruction: cell division and the anaphase-promoting complex. Genes Dev., 13, 2039–2058.[Free Full Text]

22 Glotzer, M., Murray, A.W. and Kirschner, M.W. (1991) Cyclin is degraded by the ubiquitin pathway. Nature, 349, 132–138.[Medline]

23 Amon, A., Irniger, S. and Nasmyth, K. (1994) Closing the cell cycle circle in yeast: G2 cyclin proteolysis initiated at mitosis persists until the activation of G1 cyclins in the next cycle. Cell, 77, 1037–1050.[Web of Science][Medline]

24 Burton, J.L. and Solomon, M.J. (2000) Hsl1p, a Swe1p inhibitor, is degraded via the anaphase-promoting complex. Mol. Cell Biol., 20, 4614–4625.

25 Yamano, H., Tsurumi, C., Gannon, J. and Hunt, T. (1998) The role of the destruction box and its neighbouring lysine residues in cyclin B for anaphase ubiquitin-dependent proteolysis in fission yeast: defining the D-box receptor. EMBO J., 17, 5670–5678.[Web of Science][Medline]

26 Jorgensen, P.-M. (2000) Regulation of mitosis—molecular analysis of the anaphase-promoting complex. PhD thesis, Karolinska Institute, Stockholm (see http://diss.kib.ki.se/2000/91-628-4483-0/thesis.pdf).

27 Roth, K.E., Rieder, C.L. and Bowser, S.S. (1988) Flexible-substratum technique for viewing cells from the side: some in vivo properties of primary (9+0) cilia in cultured kidney epithelia. J. Cell Sci., 89, 457–466.[Abstract/Free Full Text]

28 Praetorius, H.A. and Spring, K.R. (2001) Bending the MDCK cell primary cilium increases intracellular calcium. J. Membr. Biol., 184, 71–79.[Web of Science][Medline]

29 Nadasdy, T., Laszik, Z., Lajoie, G., Blick, K.E., Wheeler, D.E. and Silva, F.G. (1995) Proliferative activity of cyst epithelium in human renal cystic diseases. J. Am. Soc. Nephrol., 5, 1462–1468.[Abstract]

30 Peters, D.J. and Breuning, M.H. (2001) Autosomal dominant polycystic kidney disease: modification of disease progression. Lancet, 358, 1439–1444.[Web of Science][Medline]

31 Qian, Q., Harris, P.C. and Torres, V.E. (2001) Treatment prospects for autosomal-dominant polycystic kidney disease. Kidney Int., 59, 2005–2022.[Web of Science][Medline]

32 Wheatley, D.N. and Bowser, S.S. (2000) Length control of primary cilia: analysis of monociliate and multiciliate PtK1 cells. Biol. Cell, 92, 573–582.[Web of Science][Medline]

33 Wheatley, D.N., Wang, A.M. and Strugnell, G.E. (1996) Expression of primary cilia in mammalian cells. Cell Biol. Int., 20, 73–81.[Web of Science][Medline]

34 Yu, H., Peters, J.M., King, R.W., Page, A.M., Hieter, P. and Kirschner, M.W. (1998) Identification of a cullin homology region in a subunit of the anaphase-promoting complex. Science, 279, 1219–1222.[Abstract/Free Full Text]

35 Zachariae, W., Shevchenko, A., Andrews, P.D., Ciosk, R., Galova, M., Stark, M.J., Mann, M. and Nasmyth, K. (1998) Mass spectrometric analysis of the anaphase-promoting complex from yeast: identification of a subunit related to cullins. Science, 279, 1216–1219.[Abstract/Free Full Text]

36 Aparicio, S., Chapman, J., Stupka, E., Putnam, N., Chia, J.M., Dehal, P., Christoffels, A., Rash, S., Hoon, S., Smit, A.F. et al. (2002) Whole-genome shotgun assembly and analysis of the genome of Fugu rubripes. Science. 10.1126/science.1072104.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Am. Soc. Nephrol.Home page
F. Hildebrandt, M. Attanasio, and E. Otto
Nephronophthisis: Disease Mechanisms of a Ciliopathy
J. Am. Soc. Nephrol., January 1, 2009; 20(1): 23 - 35.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
C. L. Williams, M. E. Winkelbauer, J. C. Schafer, E. J. Michaud, and B. K. Yoder
Functional Redundancy of the B9 Proteins and Nephrocystins in Caenorhabditis elegans Ciliogenesis
Mol. Biol. Cell, May 1, 2008; 19(5): 2154 - 2168.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
F. Hildebrandt and W. Zhou
Nephronophthisis-Associated Ciliopathies
J. Am. Soc. Nephrol., June 1, 2007; 18(6): 1855 - 1871.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
E. W. Kuehn, G. Walz, and T. Benzing
von Hippel-Lindau: A Tumor Suppressor Links Microtubules to Ciliogenesis and Cancer Development
Cancer Res., May 15, 2007; 67(10): 4537 - 4540.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
Y. Liu, N. Pathak, A. Kramer-Zucker, and I. A. Drummond
Notch signaling controls the differentiation of transporting epithelia and multiciliated cells in the zebrafish pronephros
Development, March 15, 2007; 134(6): 1111 - 1122.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
Y. Wang and J. Nathans
Tissue/planar cell polarity in vertebrates: new insights and new questions
Development, February 15, 2007; 134(4): 647 - 658.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
A. Robert, G. Margall-Ducos, J.-E. Guidotti, O. Bregerie, C. Celati, C. Brechot, and C. Desdouets
The intraflagellar transport component IFT88/polaris is a centrosomal protein regulating G1-S transition in non-ciliated cells
J. Cell Sci., February 15, 2007; 120(4): 628 - 637.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
B. W. Bisgrove and H. J. Yost
The roles of cilia in developmental disorders and disease
Development, November 1, 2006; 133(21): 4131 - 4143.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
N. Sugiyama and T. Yokoyama
Sustained cell proliferation of renal epithelial cells in mice with inv mutation.
Genes Cells, October 1, 2006; 11(10): 1213 - 1224.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
H. Shiratori and H. Hamada
The left-right axis in the mouse: from origin to morphology
Development, June 1, 2006; 133(11): 2095 - 2104.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
J. J. Schrick, P. Vogel, A. Abuin, B. Hampton, and D. S. Rice
ADP-Ribosylation Factor-Like 3 Is Involved in Kidney and Photoreceptor Development
Am. J. Pathol., April 1, 2006; 168(4): 1288 - 1298.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
C. M. Louie and J. G. Gleeson
Genetic basis of Joubert syndrome and related disorders of cerebellar development
Hum. Mol. Genet., October 15, 2005; 14(suppl_2): R235 - R242.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
Q. Li, N. Montalbetti, P. Y. Shen, X.-Q. Dai, C. I. Cheeseman, E. Karpinski, G. Wu, H. F. Cantiello, and X.-Z. Chen
Alpha-actinin associates with polycystin-2 and regulates its channel activity
Hum. Mol. Genet., June 15, 2005; 14(12): 1587 - 1603.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
L. M. Quarmby and J. D.K. Parker
Cilia and the cell cycle?
J. Cell Biol., June 6, 2005; 169(5): 707 - 710.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
M. Mrug, R. Li, X. Cui, T. R. Schoeb, G. A. Churchill, and L. M. Guay-Woodford
Kinesin Family Member 12 Is a Candidate Polycystic Kidney Disease Modifier in the cpk Mouse
J. Am. Soc. Nephrol., April 1, 2005; 16(4): 905 - 916.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
J. J. Essner, J. D. Amack, M. K. Nyholm, E. B. Harris, and H. J. Yost
Kupffer's vesicle is a ciliated organ of asymmetry in the zebrafish embryo that initiates left-right development of the brain, heart and gut
Development, March 15, 2005; 132(6): 1247 - 1260.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
I. A. Drummond
Kidney Development and Disease in the Zebrafish
J. Am. Soc. Nephrol., February 1, 2005; 16(2): 299 - 304.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
G. J. Pazour
Intraflagellar Transport and Cilia-Dependent Renal Disease: The Ciliary Hypothesis of Polycystic Kidney Disease
J. Am. Soc. Nephrol., October 1, 2004; 15(10): 2528 - 2536.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
L. Romio, A. M. Fry, P. J.D. Winyard, S. Malcolm, A. S. Woolf, and S. A. Feather
OFD1 Is a Centrosomal/Basal Body Protein Expressed during Mesenchymal-Epithelial Transition in Human Nephrogenesis
J. Am. Soc. Nephrol., October 1, 2004; 15(10): 2556 - 2568.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
J. Nurnberger, A. Kribben, A. O. Saez, G. Heusch, T. Philipp, and C. L. Phillips
The Invs Gene Encodes a Microtubule-Associated Protein
J. Am. Soc. Nephrol., July 1, 2004; 15(7): 1700 - 1710.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
C. L. Phillips, K. J. Miller, A. J. Filson, J. Nurnberger, J. L. Clendenon, G. W. Cook, K. W. Dunn, P. A. Overbeek, V. H. Gattone II, and R. L. Bacallao
Renal Cysts of inv/inv Mice Resemble Early Infantile Nephronophthisis
J. Am. Soc. Nephrol., July 1, 2004; 15(7): 1744 - 1755.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
H. F. Cantiello
Regulation of calcium signaling by polycystin-2
Am J Physiol Renal Physiol, June 1, 2004; 286(6): F1012 - F1029.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
M. M. Shah, R. V. Sampogna, H. Sakurai, K. T. Bush, and S. K. Nigam
Branching morphogenesis and kidney disease
Development, April 1, 2004; 131(7): 1449 - 1462.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
L. M. Guay-Woodford
Murine models of polycystic kidney disease: molecular and therapeutic insights
Am J Physiol Renal Physiol, December 1, 2003; 285(6): F1034 - F1049.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
C. J. Ward, D. Yuan, T. V. Masyuk, X. Wang, R. Punyashthiti, S. Whelan, R. Bacallao, R. Torra, N. F. LaRusso, V. E. Torres, et al.
Cellular and subcellular localization of the ARPKD protein; fibrocystin is expressed on primary cilia
Hum. Mol. Genet., October 16, 2003; 12(20): 2703 - 2710.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
D. Joly, A. Hummel, A. Ruello, and B. Knebelmann
Ciliary function of polycystins: a new model for cystogenesis
Nephrol. Dial. Transplant., September 1, 2003; 18(9): 1689 - 1692.
[Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
F. Lin, T. Hiesberger, K. Cordes, A. M. Sinclair, L. S. B. Goldstein, S. Somlo, and P. Igarashi
Kidney-specific inactivation of the KIF3A subunit of kinesin-II inhibits renal ciliogenesis and produces polycystic kidney disease
PNAS, April 29, 2003; 100(9): 5286 - 5291.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (76)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Morgan, D.
Right arrow Articles by Goodship, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Morgan, D.
Right arrow Articles by Goodship, J. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?