Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (41)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Koomen, M.
Right arrow Articles by Arwert, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Koomen, M.
Right arrow Articles by Arwert, F.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2002, Vol. 11, No. 3 273-281
© 2002 Oxford University Press

Reduced fertility and hypersensitivity to mitomycin C characterize Fancg/Xrcc9 null mice

Mireille Koomen1, Ngan C. Cheng1,3, Henri J. van de Vrugt1, Barbara C. Godthelp2, Martin A. van der Valk4, Anneke B. Oostra1, Malgorzata Z. Zdzienicka2,5, Hans Joenje1 and Fré Arwert1,+

1Department of Clinical Genetics and Human Genetics, VU University Medical Center, Van der Boechorststraat 7, 1081 BT Amsterdam, The Netherlands, 2Department of Radiation Genetics and Chemical Mutagenesis, Leiden University Medical Center, Wassenaarseweg 72, 2333 AL Leiden, The Netherlands, 3Division of Molecular Genetics and Center of Biomedical Genetics, 4Department of Experimental Animal Pathology, The Netherlands Cancer Institute, Plesmanlaan 121, 1066 CX Amsterdam, The Netherlands and 5Department of Molecular Cell Genetics, The Ludwik Rydgier University of Medical Science, Bydgoszcz, Poland

Received October 8, 2001; Revised and Accepted December 3, 2001.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Fanconi anemia (FA) is a heterogeneous autosomal recessive chromosomal instability syndrome associated with diverse developmental abnormalities, progressive bone marrow failure and a predisposition to cancer. Spontaneous chromosomal breakage and hypersensitivity to DNA cross-linking agents characterize the cellular FA phenotype. The gene affected in FA complementation group G patients was initially identified as XRCC9, for its ability to partially correct the cellular phenotype of the Chinese hamster ovary (CHO) cell mutant UV40. By targeted disruption we generated Fancg/Xrcc9 null mice. Fancg knock-out (KO) mice were born at expected Mendelian frequencies and showed normal viability. In mice, functional loss of Fancg did not result in developmental abnormalities or a pronounced incidence of malignancies. During a 1 year follow-up, blood cell parameters of Fancg KO mice remained within normal values, revealing no signs of anemia. Male and female mice deficient in Fancg showed hypogonadism and impaired fertility, consistent with the phenotype of FA patients. Mouse embryonic fibroblasts (MEFs) from the KO animals exhibited the FA characteristic cellular response in showing enhanced spontaneous chromosomal instability and a hyper-responsiveness to the clastogenic and antiproliferative effects of the cross-linking agent mitomycin C (MMC). The sensitivity to UV, X-rays and methyl methanesulfonate, reported for the CHO mutant cell line UV40, was not observed in Fancg–/– MEFs. Despite a lack of hematopoietic failure in the KO mice, clonogenic survival of bone marrow cells in vitro was strongly reduced in the presence of MMC. The characteristics of the Fancg–/– mice closely resemble those reported for Fancc and Fanca null mice, supporting a tight interdependence of the corresponding gene products in a common pathway.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Fanconi anemia (FA) is an autosomal recessive disorder clinically characterized by developmental abnormalities of the skeleton, skin, kidney and heart. FA patients show growth retardation, hypogonadism and aplastic anemia due to a progressive failure of the bone marrow. The aplastic anemia usually develops between 5 and 10 years of age and typically starts with thrombocytopenia, followed by neutropenia and finally anemia. In addition, FA patients are strongly predisposed to cancer, especially acute myeloid leukemia and squamous cell carcinomas (1,2). FA cells display a high level of spontaneous chromatid-type aberrations and a hypersensitivity to cross-linking agents like mitomycin C (MMC), cisplatin and diepoxybutane. An arrest in the late-S/G2 phase of the cell cycle of FA cells is seen, especially after treatment with low doses of MMC (3,4).

Functional complementation studies have implicated at least eight distinct FA genes (2,5,6), six of which have been cloned to date; FANCA, FANCC, FANCD2, FANCE, FANCF and FANCG (713). The complementation group G gene FANCG, identified by complementation cloning (13) appeared to be identical with XRCC9. The XRCC9 gene was previously cloned on the basis of its ability to partially complement the cellular phenotype of a Chinese hamster cell mutant UV40. These UV40 mutant cells display hypersensitivity to UV, X-rays, MMC and methyl methanesulfonate (MMS), as well as chromosomal instability (14,15). The FA gene products do not share homologous sequences with each other nor with any other protein in the databases, and little is known about their molecular functions. Recently, interaction studies have indicated that FA proteins form a nuclear core complex. The interaction of FANCA and FANCG in the cytoplasm seems to be the starting point for the formation of this nuclear multiprotein FA core complex (16,17). This FA core complex is essential for the modification of FANCD2 to a monoubiquitinylated isoform, which co-localizes with the breast cancer susceptibility protein BRCA1 in DNA damage-inducible nuclear foci (18). The latter study suggests a role for FA proteins in the cellular DNA damage response.

In this paper, we report the generation of mice with a targeted disruption of the Fancg gene and document characteristics of these animals.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Generation of Fancg–/– mice
The mouse Fancg gene consists of 14 exons. In the targeting construct, exons 1–4 are replaced by a PGK-hygromycin cassette (Fig. 1A). The targeting construct was electroporated into embryonic stem (ES) cells derived from mouse strain 129OLA. Screening of ES cells for homologous recombination was performed by Southern blot analysis (Fig. 1B). Two mouse lines were generated from independent ES cell clones. Chimeric males with germ line transmission of the targeted allele were crossed with FVB females and the resulting heterozygous F1 animals were intercrossed to generate Fancg knock-out (KO) animals. Genotyping was performed by PCR analysis (Fig. 1C). The absence of Fancg protein in tissue (Fig. 1D) and mouse embryonic fibroblasts (MEFs) (data not shown) of the mutant mice was confirmed by immunoblotting. The Fancg KO mice were born at the expected frequency and appeared normal, without showing any signs of retarded growth. X-ray analysis failed to reveal any skeletal abnormalities (data not shown).




View larger version (40K):
[in this window]
[in a new window]
 
Figure 1. Generation of Fancg-deficient mice by gene targeting. (A) Map of the genomic locus of the murine Fancg gene, the gene-targeting construct and the targeting allele. Gene targeting results in the deletion of exons 1–4 and insertion of a PGK hygromycin cassette. The positions of the 5' and 3' flanking probes are indicated. Restriction enzymes are: Xb, XbaI; RI, EcoRI. (B) Southern blot analysis of Fancg targeting in ES cells. Genomic DNA was digested with XbaI and hybridized to the 5' or 3' flanking probes. Het, ES clone with one affected allele. The 3' probe shows a 15 kb band derived from the targeted allele and an 8.9 kb band from the wild-type allele. The 5' probe shows a 15 kb band from the targeted allele and a 3.5 kb band from the wild-type allele. WT, wild-type ES cells. The 3' probe shows an 8.9 kb band, and a 3.5 kb band is observed with the 5' probe. Both fragments are derived from the wild-type allele. (C) PCR genotyping of mouse ear DNA. –/–, homozygous KO; +/+, wild-type; +/–, heterozygote. (D) Western blot of immunoprecipitated Fancg protein from mouse spleens. The 68.5 kDa Fancg band is indicated, present in wild-type but absent in both KO spleen lysates. Positive control is 293EBNA cells transfected with mouse Fancg.

 
Fancg–/– mice have a reduced fertility
To assess fertility of the KO animals, 10–12-week-old Fancg–/– mice were bred with Fancg+/– mice and followed over time. Both male and female Fancg–/– animals appeared to be less fertile than control animals (Fig. 2A), the deficiency being more pronounced in the female mice (Fig. 2A). Female mice stopped breeding around 21 weeks of age, whereas the males stopped around 29 weeks of age, in contrast to control animals which did not stop breeding during the observation period, but only showed a decline in the number of litters (Fig. 2A). The numbers of pups per litter were smaller in both male and female KO mice when compared to the heterozygous control mice (Fig. 2B).



View larger version (15K):
[in this window]
[in a new window]
 
Figure 2. Fancg–/– mice have an impaired fertility. Reproductive performance of four pairs of mice per group was followed over time. Fancg–/– mice were crossed with mice heterozygous for the targeted allele. Controls were heterozygous x heterozygous crosses. (A) The number of litters as a function of age. Knock-out male and female mice produced less litters over time compared to the control animals and ceased breeding before 36 weeks of age. (B) The number of pups per litter (with SDs per litter) for each group. Female KO mice produced less pups per litter over time than control animals. Male KO mice produced approximately the same numbers of pups over time and seemed less infertile than female KO mice but clearly affected compared to control animals. Error bars represent SDs.

 
Fancg–/– mice have gonadal abnormalities
To investigate the possible cause of the reduced fertility we examined the gonads from 10–12-and 36-week-old mice by histological analysis. The ovaries from 36-week-old Fancg–/– female mice appeared to contain many interstitial cells (Fig. 3B). Few developing and some degenerated follicles were present. In some Fancg–/– animals traces of previous ovulations were observed (picture not shown). In the cortex of 10–12-week-old females very few primary follicles are present (Fig. 3C). The results of histological examination of testes derived from 10–12-week-old Fancg–/– mice are similar, only the defects are less pronounced as compared to 36-week-old Fancg–/– mice. In the testis of young male mice some ‘bodies’ are seen in which sperm-heads stick together and are not able to develop into individual spermatozoa (3F). Many seminiferous tubules in 36-week-old Fancg–/– males were atrophic and contained vacuolized Sertoli cells. The remaining tubules showed normal to incomplete spermatogenesis and contained normal or little semen (Fig. 3E). Mutant testes showed hyperplasia of Leydig cells as compared to the controls (Fig. 3D and E). The epididymis of Fancg–/– male mice contains hardly any normal spermatozoa and debris is present as well as degraded spermatozoa (Fig. 3H). The epididymis of control animals on the other hand contains normal functional spermatozoa (Fig. 3G).



View larger version (143K):
[in this window]
[in a new window]
 
Figure 3. Gonadal abnormalities of Fancg–/– mice. Histological sections of testis and ovary of 10–12-week-old and 6-month-old mice. (A) Control ovary, 6 months old (magnification 25x). (B) Fancg–/– ovary, 6 months old (magnification 25x). (C) Fancg–/–- ovary, 10–12 weeks old (magnification 100x). (D) Control testis, 6 months old (magnification 25x). (E) Fancg–/–- testis, 6 months old (magnification 25x). (F) Fancg–/–- testis, 10–12 weeks old (magnification 100x). (G) Control epididymis, 6 months old (magnification 25x). (H) Fancg–/– epididymis, 6 months old (magnification 25x). The ovary of the control animal (A) contains numerous developing Graafian follicles, whereas Fancg–/– ovary (B) consists predominantly of interstitial cells. Some degenerated follicles can be seen (B, arrow). In the cortex of Fancg–/– ovary of 10–12-week-old mice (C) no primary follicles were seen. A part of the corpus luteum (indicated by three arrows) is present. The control testis (D) shows all stages of normal spermatogenesis, whereas in Fancg–/– testis (E) normal spermatogenesis is only detected in some seminiferous tubuli. In some tubuli, vacuolized Sertoli cells are present (E, arrowhead) and Leydig cell hyperplasia is seen (E, arrow). In the testis of 10–12-week-old mice (F) ‘bodies’/sperm head are seen (red arrow). The control epididymis contains many functional spermatozoa (G). The epididymal duct of Fancg–/– contains degenerated spermatozoa and hardly any sperm (H).

 
None of the other organs studied: spleen, mammary glands, lymph nodes, brain, heart, thymus and kidney, showed evidence of consistent abnormalities.

Hematological parameters
Hematological assays on Fancg–/– and control mice were performed to see whether KO mice develop anemia during their life span. Several hematological parameters were measured during a period from 8 weeks to 1 year after birth. Red and white blood cell counts were similar in KO and wild-type animals. There was also no significant difference between the levels of hemoglobin, hematocrit and the mean red cell volume (MCV) of Fancg–/– and Fancg+/+ mice. The platelet count of Fancg–/– male mice seemed somewhat reduced between 8 and 11 weeks of age. For Fancg–/– female mice this phenomenon was only seen around 36 weeks of age (data not shown). Although these reductions were statistically significant, they were relatively small and not consistently observed in all animals over the course of time and therefore were not considered as evidence of a hematopoietic phenotype.

Flow cytometric analysis of spleen and total blood was performed to assess a possible difference in numbers of specific cell types between Fancg–/– and Fancg+/+ mice. No consistent differences could be demonstrated in T- and B-lymphocyte, macrophage and granulocyte cell populations (data not shown).

In addition, we examined May–Gruenwald–Giemsa-stained blood smears for numbers and morphology of the various types of leukocytes. The number of white blood cells was similar in the different genotypes and no abnormal morphology was seen (data not shown).

Altogether, these data indicated that Fancg–/– mice have a normal hematopoietic proficiency, at least within the first year of life.

Sensitivity of Fancg–/– mouse embryonic fibroblasts to DNA-damaging agents
Mouse embryonic fibroblasts (MEFs) were obtained from Fancg–/– and Fancg+/+ embryonic mice and tested for their chromosomal sensitivity to the cross-linking agent MMC. As illustrated in Figure 4A, KO MEFs showed an elevated level of spontaneous chromosomal breakage compared to the wild-type MEFs: whereas 16% of the wild-type MEFs showed one or two aberrations per cell, 72% of the KO MEFs had aberrations, with 10% having multiple (up to eight) aberrations per cell. Exposure to 50 nM MMC dramatically increased the aberration rate in KO MEFs, whereas such treatment hardly affected wild-type MEFs (Fig. 4B).



View larger version (10K):
[in this window]
[in a new window]
 
Figure 4. Chromosome breakage test in MEFs from Fancg–/– mice. The numbers of chromosomal aberrations per metaphase spread were scored. White bars are Fancg+/+ MEFs and black bars are Fancg–/– MEFs. Spontaneous (A) and MMC-induced (B) chromosomal breaks in MEFs from Fancg–/– and Fancg+/+ mice, respectively.

 
Clonogenic survival assays were used to determine the antiproliferative effect of MMC. As shown in Figure 5A, MMC has a more toxic effect on the survival of Fancg–/– MEFs than that of Fancg+/+ MEFs, which is consistent with the known hypersensitivity of FA cells to the clastogenic effect of this compound.



View larger version (12K):
[in this window]
[in a new window]
 
Figure 5. Colony survival assays of Fancg–/– MEFs with different DNA-damaging agents: (A) MMC; (B) MMS; (C) X-rays; (D) UV light. KO, homozygous mutant; WT, wild-type. Each survival curve is the mean of three independent experiments; error bars represent the SEM.

 
Given the cellular phenotype described for the Chinese hamster-derived Fancg/Xrcc9–/– mutant cell line UV40, which shows a hypersensitivity to X-rays, UV, MMC and MMS, the sensitivity of Fancg–/– MEFs to these agents was also evaluated. The results indicated that the Fancg–/– MEFs were not hypersensitive to MMS (Fig. 5B), X-rays (Fig. 5C) or UV radiation (Fig. 5D) compared to the control cells.

Fancg–/– hematopoietic cells are hypersensitive to MMC
The aplastic anemia seen in FA patients is thought to be due to a proliferative defect of bone marrow progenitor cells. Since the Fancg–/– mice did not develop anemia, we tested bone marrow cells for their sensitivity to MMC. Bone marrow cells isolated from Fancg–/– and Fancg+/+ mice were seeded in the presence of increasing concentrations of MMC. As shown in Figure 6, the average numbers of hematopoietic colony forming units (c.f.u.), from Fancg–/– and Fancg+/+ mice were similar in the absence of MMC. After incubation with MMC the colony forming capacity from bone marrow derived from Fancg–/– mice was significantly more affected than that of bone marrow derived from control animals. These results show that, even though the bone marrow is not detectably malfunctioning in Fancg–/– mice considering blood counts, bone marrow progenitor cells clearly express the cellular FA defect upon treatment with a cross-linking agent.



View larger version (10K):
[in this window]
[in a new window]
 
Figure 6. Clonogenic survival assay of bone marrow cells derived from Fancg–/– mice. Bone marrow cells were grown in the presence of increasing concentrations of MMC. After 7 days the numbers of colonies from the Fancg–/–-derived bone marrow were compared with numbers of colonies from the wild-type derived bone marrow. KO, homozygous mutant; WT, wild-type. Values are means of four independent experiments per genotype. Error bars represent SDs.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
We report the generation and characterization of Fancg KO mice, which were made by targeted recombination resulting in the deletion of exons 1–4 of the mouse Fancg gene. The absence of the Fancg protein was verified by immunoblotting of extracts from tissues and MEFs derived from the KO animals. At the cellular level, that is embryonic fibroblasts and hematopoietic colony forming cells, Fancg–/– mice did show the FA phenotype in terms of MMC hypersensitivity.

Unlike FA patients, growth retardation or skeletal abnormalities were not found in Fancg–/– mice.

FA patients, including FA-G, typically develop aplastic anemia at an early age, which is thought to be due to depletion of bone marrow stem cells. In contrast, Fancg–/– mice did not develop spontaneous anemia in the first year of life. These results are similar to what has been observed in Fancc–/– and Fanca–/– mice (1921). In spite of their apparent normal hematopoietic potential, progenitors from Fancg–/– mice exhibited the FA phenotype in terms of MMC sensitivity, comparable to what has been reported for Fancc–/– mice (22), in which aplastic anemia can be provoked by treatment with a DNA cross-linking agent (23).

Lymphocyte cultures from FA patients show spontaneous chromosomal aberrations and these are drastically increased when incubated with cross-linking agents (24). MEFs derived from our Fancg–/– mice also show increased spontaneous chromosomal aberrations. After incubation with MMC a significant increase of chromosomal aberrations is seen. This same feature was also seen in MEFs derived from Fanca–/– (21) and Fancc–/– mice (19).

FA patients rarely produce offspring. In male patients this is associated with hypogonadism and reduced sperm count, whereas in female patients premature menopause has been described (25). Reduced fertility was also reported for Fanca–/– and Fancc–/– mice, with females being more severely affected than males (1921). Fancg–/– mice have a similar reduction in fertility and females are more affected as well. Histological examination showed almost no ovarian follicles in 36-week-old Fancg–/– female mice, whereas in some KO animals there were signs of previous ovulations. Although histological data are not available from FA patients these observations would seem to be compatible with the premature menopause seen in FA patients. In 36-week-old Fancg–/– male mice a reduced spermatogenesis was observed and vacuolization of Sertoli cells, although tubules with normal spermatogenesis were present as well. Severe Leydig cell hyperplasia was observed in mutant testes. The epididymis of Fancg–/– male mice was almost empty or contained debris presumably from degenerated sperm cells. The histological examination of gonads derived from 10–12-week-old mice is similar to that of 36-week-old mice. Only the defects are less pronounced in the young animals. These gonadal abnormalities were also observed in Fancc–/– and Fanca–/– mice (19,21) as well as in Atm-deficient male mice (26), although the vacuolization of Sertoli cells was not observed in Atm-deficient male mice (26). At birth, all germinal cells in normal females are already developed into oocytes. Most of these oocytes degenerate during life. A small pool of stem cells survives and a few of these mature (Graafian follicle) (27). On the other hand, male testis contains more stem cells that divide over a long period of time (28). If there is a defect in the development of germ cells, females are probably earlier and more severely affected than males because of the fewer stem cells present. This might be an explanation of the more severe affected phenotype seen in Fancg–/– female mice compared to males.

The Chinese hamster ovary cell line (UV40) is mutated in the Fancg/Xrcc9 gene and shows sensitivity to a wide spectrum of DNA-damaging agents, like UV, X-rays, ethyl methanesulfonate, MMS and MMC (15). The FANCG/XRCC9 gene has been shown to correct the chromosomal instability of the UV40 mutant and partially corrects MMC, EMS and UV sensitivity (14). In contrast, MEFs derived from Fancg–/– mice were not sensitive to UV, X-rays and MMS, and in that respect more closely resemble human FA-G lymphoblasts (13). The cellular phenotype of the human FA-G cell line EUFA316-L is complemented by mouse Fancg cDNA (H.J.Van de Vrugt, M.Koomen, M.A.D.Berns, Y.de Vries, M.A.Rooimans, L.van der Weel, E.Blom, J.de Groot, R.J.Schlepers, S.Stone, M.E.Hoatlin, N.C.Cheng, H.Joenje and F.Arwert manuscript submitted for publication). These results indicate that the Fancg–/– mouse may serve as a valid model for the cellular phenotype seen in FA patients, where mutation of FANCG results in a specific hypersensitivity to cross-linking agents only. The similar degree of conservation of the FANCG/XRCC9 gene amongst man, mouse and hamster in combination with cross-complementation suggests a functional identity of these three Fancg proteins (H.J.Van de Vrugt et al., manuscript submitted for publication). Therefore, the cross-sensitivity for UV, X-rays and MMS reported for the UV40 mutant cell line is probably due to the presence of additional mutations, as suggested before (14). In summary, the cellular phenotype documented for our mouse model is similar to human FA cells, whereas at the level of the whole organism, reduced fertility associated with gonadal defects mimic the human phenotype. The characteristics described here for the Fancg–/– mice also closely resemble those reported for Fanca–/– (21) and Fancc–/– mice (19,20).

Disruption of the multiprotein complex in all FA cell lines except FA-D2 and the close similarity of the three mouse models reported so far suggest an absence of redundancy between these FA proteins within the pathway. This hypothesis could be tested by examining the phenotype of cells or animals in which two different FA proteins are disrupted simultaneously. Thus, the generation of double KO animals might provide additional information on the ‘tightness’ of the FA pathway.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Construction of the Fancg gene-targeting vector
The complete mice Fancg gene (exons 1–14) was cloned from E14 ES cells. This fragment was subcloned into pBRMG, a modified pBR322 vector. Partially blunt XbaI digestion was performed to delete exons 1–4 from the Fancg gene. A PHA58 vector containing a hygromycin cassette and a PGK promotor was digested with BglII. This hygromycin cassette was ligated upstream of exon 5 within the Fancg-targeting construct (Fig. 1A).

ES cell targeting and generation of Fancg–/– mice
The Hyg-Fancg-targeting construct was isolated from the vector and electroporated into E14 ES cells derived from the 129OLA strain. Genomic DNA from clones surviving hygromycin selection was isolated, digested with XbaI and analyzed using 5' and 3' probes on Southern blots. The same blots were hybridized with internal probes for the PGK-hygromycin cassette to see whether homologous recombination had occurred. Two independent selected ES clones with an apparently normal karyotype were injected into blastocysts from the C57Bl/6 strain and placed in pseudo-pregnant 129OLA foster mothers. The resulting chimeric males were bred with FVB females and germline transmission was obtained. Heterozygous F1 mice were intercrossed to produce homozygous mutant mice. The genotype of the mice was determined by PCR analysis on mouse ear DNA. Primer sets were used for the endogenous exon 1–4 allele (primers CTTGTAGAGTGAGGAGGAGTTCCCTAAGCC and GGCGACAATGTCCAGCCAGGTCATTCCAGC, ~400 bp) and for the recombinant hygromycin allele (primers GCATCATCGAAATTGCCGTCAACCAAGCTC and TCGTGCACGCGGATTTCGGCTCCAACAATG, ~227 bp).

FANCG protein expression was analyzed in cell lysate from mouse tissues by immunoprecipitation and western blot with antiserum, raised in guinea-pigs and rabbits, directed against the GST N-terminal FANCG fusion protein (amino acids 87–355) (unpublished data).

Hematological analysis
Peripheral blood was collected by orbita punction, with EDTA as an anticoagulant. The blood was diluted 3.33 times with 1x PBS pH 7.4. Measurements of erythrocyte, leukocyte, platelets, hemoglobin and hematocrit levels and the derived mean cell volume, mean cell hemoglobin and mean cell hemoglobin concentration values were performed on a sysmex K-4500 machine (Goffin-Meyvis).

Flow cytometry analysis of spleen and blood was performed using a standard protocol. Samples were measured on a facsscan (Becton Dickinson). Applied antibodies used were: T lymphocytes, KT3 (supernatant from hybridoma cells), 1:200; B lymphocytes, 6B2 KT3 (supernatant from hybridoma cells), 1:50; macrophages, Mac1 biotinilated (Pharmingen), 1:200; and RB6-8C5 (supernatant from hybridoma cells), 1:200.

Histological analysis
Mice were killed and isolated organs were fixed in 4% paraformaldehyde in 1x PBS pH 7.8. The testes and ovary of mutant and wild-type mice were fixed in Harrison fixative (ethanol–acetic acid–formol saline). Fixed organs were embedded in paraffin, sectioned and stained with hematoxylin and eosin. Tissues included were testis, ovary, mammary glands, lymph nodes, brain, heart, spleen, thymus and kidney.

MMC-induced chromosome breakage analysis
Immortalized and primary MEFs were incubated for 48 h in the absence or presence of 50 nM MMC. For each cell culture, 50 metaphases were analyzed for chromosomal abnormalities, which included both chromosome and chromatid-type aberrations. To quantify chromosomal abnormalities the exchange aberrations were converted into breaks.

Cell survival and mutagenic treatment
MEFs were derived from 14-day-old embryos. After spontaneous immortalization, cells were analyzed for their sensitivity to various DNA-damaging agents. MEFs were seeded in Petri dishes (TC dish 92 x 17, Nunclon dishes; Life Technologies) at different densities (KO, 2500 cells/plate; wild-type, 10 000 cells/plate) in Dulbecco’s modified Eagle’s medium with glutamate (Gibco BRL) containing 10% fetal bovine serum (Gibco BRL) and supplemented with sodium pyruvate. MMC was added in a dilution series of 0–240 nM. Cells were incubated at 37°C, 5% CO2 for 10 days. Cells were fixed with 90% ethanol and stained with 10% Giemsa (Sigma), and colonies (>50 cells) were counted.

For the assessment of X-ray, UV light and MMS sensitivity, exponential growing cells were trypsinized and 700–1500 cells were plated in P94 dishes (Greiner) in duplicate (controls in triplicate) in Dulbecco’s modified Eagle medium with glutamate (Gibco BRL) containing 10% fetal bovine serum (Gibco BRL) and supplemented with sodium pyruvate, and left to attach for 4 h. For all survival experiments, 10 times more cells were plated at the highest dose used. Prior to UV irradiation, cells were washed once with PBS and irradiated with UV light of 254 nm (0–12 J/m2) (Philips TUV germicidal lamp; fluence rate of 0.19 W/m2, measured with the IL/770 germicidal radiometer) and thereafter culture medium was added. For all other treatments, cells were maintained in culture medium and either irradiated with X-rays (0–8 Gy) (dose rate 2.8 Gy/min, 200 kV, 4 mA, 0.78 mm Al) or treated with MMS for 1 h (0–2.4 mM). After treatment with MMS the cells were rinsed twice with PBS and culture medium was added. Following these mutagenic treatments, cells were incubated at 37°C, 5% CO2 in a humidified incubator for 8–10 days. Then, the dishes were rinsed with 0.9% NaCl, air-dried, stained with methylene blue and visible colonies were counted. Each survival curve represents the mean of at least three independent experiments. Error bars represent the SEM.

Bone marrow sensitivity assay
Bone marrow cells were derived from the femurs of wild-type and Fancg KO mice aged between 4 months and 1 year. Bones were prepared free and flushed with Isocove’s MDM with 2% fetal ovine serum (Stemcell Technologies Inc.). Cells were seeded in 35 mm culture dishes (Stemcell Technologies Inc.) at a density of 1.8 x 105 cells/dish in Methocult GF M3434 (Stemcell Technologies Inc.). MMC was added in a dilution series of 0–1000 nM. Tests were done in triplicate. Cells were incubated at 37°C, 5% CO2 for 7 days, after which colonies were counted.


    ACKNOWLEDGEMENTS
 
We thank E.Gelderop and I.de Greeuw for mice care, and W.Jansen for help with the FACs analysis. Special thanks to Dr A.Berns (Dutch Cancer Institute, Amsterdam) for critical reading of the manuscript. This work was supported by a grant from the Netherlands Organization for Scientific Research (NWO) project no. 901-01-190 and the Dutch Cancer Society (KWF) project VU97-1642.


    FOOTNOTES
 
+ To whom correspondence should be addressed. Tel: +31 20 4448270; Fax: +31 20 4448285; Email: f.arwert.humgen@med.vu.nl Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
1 Auerbach,A.D., Buchwald,M. and Joenje,H. (1998) Fanconi anemia. In Vogelstein,B. and Kinzler,K.W. (eds), The Genetic Basis of Human Cancer. McGraw-Hill, New York, pp. 317–322

2 Joenje,H. and Patel,K.J. (2001) The emerging genetic and molecular basis of Fanconi anaemia. Nat. Rev. Genet., 2, 446–457.[Web of Science][Medline]

3 Dutrillaux,B., Aurias,A., Dutrillaux,A.M., Buriot,D. and Prieur,M. (1982) The cell cycle of lymphocytes in Fanconi anemia. Hum. Genet., 62, 327–332.[Web of Science][Medline]

4 Kaiser,T.N., Lojewski,A., Dougherty,C., Juergens,L., Sahar,E. and Latt,S.A. (1982) Flow cytometric characterization of the response of Fanconi’s anemia cells to mitomycin C treatment. Cytometry, 2, 291–297.[Web of Science][Medline]

5 Joenje,H., Oostra,A.B., Wijker,M., di Summa,F.M., van Berkel,C.G.M., Rooimans,M.A., Ebell,W., van Weel,M., Pronk,J.C. and Buchwald,M. (1997) Evidence for at least eight Fanconi Anemia genes. Am. J. Hum. Genet., 61, 940–944.[Web of Science][Medline]

6 Joenje,H., Levitus,M., Waisfisz,Q., D’Andrea,A.D., Garcia-Higuera,I., Pearson,T., van Berkel,C.G.M., Rooimans,M.A., Morgan,N. and Mathew,C.G. (2000) Complementation analysis in Fanconi anemia: assignment of the reference FA-H patient to group A. Am. J. Hum. Genet., 67, 759–762.[Web of Science][Medline]

7 Lo ten Foe,J.R., Rooimans,M.A., Bosnoyan-Collins,L., Alon,N., Wijker,M., Parker,L., Lightfoot,J., Carreau,M., Callen,D.F. and Savoia,A. (1996) Expression cloning of a cDNA for the major Fanconi anemia gene, FAA. Nat. Genet., 14, 320–323.[Web of Science][Medline]

8 The Fanconi Anemia/Breast Cancer Consortium (1996) Positional cloning of Fanconi anemia group A gene. Nat. Genet., 14, 324–328.[Web of Science][Medline]

9 Strathdee,C.A., Gavish,H., Shannon,W.R. and Buchwald,M. (1992) Cloning of cDNAs for Fanconi’s anemia by functional complementation. Nature, 356, 763–767.[Medline]

10 Timmers,C., Taniguchi,T., Hejna,J., Reifsteck,C., Lucas,L., Bruun,D., Thayer,M., Cox,B., Olson,S. and D’Andrea,A. (2001) Positional cloning of a novel Fanconi anemia gene, FANCD2. Mol. Cell, 7, 241–248.[Web of Science][Medline]

11 De Winter, J.P., Leveille,F., van Berkel,C.G.M., Rooimans,M.A., van der Weel,L., Steltenpool,J., Demuth,I., Morgan,N.V., Alon,N., Bosnoyan-Collins,L., Lightfoot,J. et al. (2000) Isolation of a cDNA representing the Fanconi anemia complementation group E gene. Am. J. Hum. Genet., 67, 1306–1308.[Web of Science][Medline]

12 De Winter,J.P., Rooimans,M.A., van der Weel,L., van Berkel,C.G.M., Alon,N., Bosnoyan-Collins,L., de Groot,J., Zhi,Y., Waisfisz,Q., Pronk,J.C. et al. (2000) The Fanconi anemia gene FANCF encodes a novel protein with homology to ROM. Nat. Genet., 24, 15–16.[Web of Science][Medline]

13 De Winter,J.P., Waisfisz,Q., Rooimans,M.A. van Berkel,C.G.M., Bosnoyan-Collins,L., Alon,N., Carreau,M., Bender,O., Demuth,I., Schindler,D. et al. (1998) The Fanconi anemia group G gene FANCG is identical with XRCC9. Nat. Genet., 20, 281–283.[Web of Science][Medline]

14 Lui,N., Lamerdin,J.E., Tucker,J.D., Zhou,Z.Q., Walter,C.A., Albala,J.S., Busch,D.B. and Thompson,L.H. (1997) The human XRCC9 gene corrects chromosomal instability and mutagen sensitivities in CHO UV40 cells. Proc. Natl Acad. Sci. USA, 94, 9232–9237.[Abstract/Free Full Text]

15 Busch,D.B., Zdzienicka,M.Z., Natarajan,A.T., Jones,N.J., Overkamp,W.J.I., Collins,A., Mitchell,D.L., Stefanini,M., Botta,E., Bliss Albert,R. et al. (1996) A CHO mutant, UV40, that is sensitive to diverse mutagens and represents a new complementation group of mitomycin C sensitivity. Mutat. Res., 363, 209–221.[Web of Science][Medline]

16 De Winter,J.P., Weel van der,L., de Groot,J. Stone,S., Waisfisz,Q., Arwert,F., Scheper,R.J., Kruyt,F.A.E., Hoatlin,M.E. and Joenje,H. (2000) The Fanconi anemia protein FANCF forms a nuclear complex with FANCA, FANCC and FANCG. Hum. Mol. Genet., 9, 2665–2674.[Abstract/Free Full Text]

17 Waisfisz,Q., de Winter,J.P., Kruyt,F.A., de Groot,J., van der Weel,L., Dijkmans,L.M., Zhi,Y., Arwert,F., Scheper,R.J., Youssoufian,H., Hoatlin,M.E. and Joenje,H. (1999) A physical complex of the Fanconi anemia proteins FANCG/XRCC9 and FANCA. Proc. Natl Acad. Sci. USA, 96, 10320–10325.[Abstract/Free Full Text]

18 Garcia-Higuera,I., Taniguchi,T., Ganesan,S., Meyn,M.S., Timmers,C., Hejna,J., Grompe,M. and D’Andrea,A.D. (2001) Interaction of the Fanconi anemia proteins and BRCA1 in a common pathway. Mol. Cell, 7, 249–262.[Web of Science][Medline]

19 Chen,M., Tomkins,D.J., Auerbach,W., McKerlie,C., Youssoufian,H., Liu,L., Gan,O., Carreau,M., Auerbach,A. and Groves,T. (1996) Inactivation of Fac in mice produces inducible chromosomal instability and reduces fertility reminiscent of Fanconi anemia. Nat. Genet., 12, 448–451.[Web of Science][Medline]

20 Whitney,M.A., Royle,G., Low,M.J., Kelly,M.A., Axthelm,M.K., Reifsteck,C., Olson,S., Braun,R.E., Heinrich,M.C. and Rathbun,R.K. (1996) Germ cell defects and hematopoietic hypersensitivity to {gamma}-interferon in mice with a targeted disruption of the Fanconi anemia C gene. Blood, 88, 49–58.[Abstract/Free Full Text]

21 Cheng,N.C., Vrugt van de.,H.J., Valk van der.,M.A., Oostra,A.B., Krimpenfort,P., de Vries,Y., Joenje,H., Berns,A. and Arwert,F. (2000) Mice with a targeted disruption of the Fanconi anemia homolog Fanca. Hum. Mol. Genet., 9, 1805–1811.[Abstract/Free Full Text]

22 Haneline,L.S., Gobbett,T.A., Ramani,R., Carreau,M., Buchwald,M., Yoder,M.C. and Clapp,D.W. (1999) Loss of FancC function results in decreased hematopoietic stem cell repopulating ability. Blood, 94, 1–8.[Abstract/Free Full Text]

23 Carreau,M., Gan,O.I., Liu,L., Doedens,M., McKerlie,C., Dick,J.E. and Buchwald,M. (1998) Bone marrow failure in the Fanconi anemia group C mouse model after DNA damage. Blood, 91, 2737–2744.[Abstract/Free Full Text]

24 Sasaki,M.S. and Tonomura,A. (1973) A high susceptibility of Fanconi’s anemia to chromosome breakage by DNA cross-linking agents. Cancer Res., 33, 1829–1836.[Abstract/Free Full Text]

25 Alter,B.P., Frissora,C.L., Halperin,D.S., Freedman,M.H., Chitkara.U., Alvarez,E., Lynch.L., Adler-Brecher,B. and Auerbach,A.D. (1991) Fanconi’s anemia and pregnancy. Br. J. Haematol., 77, 410–418.[Web of Science][Medline]

26 Barlow,C., Hirotsune,S., Paylor,R., Liyanage,M., Eckhaus,M., Collins,F., Shiloh,Y., Crawley,J.N., Ried,T., Tagle,D. and Wynshaw-Boris,A. (1996) Atm-deficient mice: a paradigm of ataxia telangiectasia. Cell, 86, 159–171.[Web of Science][Medline]

27 Stevens,A. and Lowe,J. (1997) The female reproductive system. In Cook,L. (ed.), Human Histology. Mosby, Harcourt Publishers, Barcelona, pp. 338–344.

28 Gilbert,S.F. (1997) The saga of the germ line. In Sinauer,A.D. (ed.), Developmental Biology. Sinauer Associates, Sunderland, MA, pp. 853–881.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Hum Mol GenetHome page
S. T. Bakker, H. J. van de Vrugt, M. A. Rooimans, A. B. Oostra, J. Steltenpool, E. Delzenne-Goette, A. van der Wal, M. van der Valk, H. Joenje, H. te Riele, et al.
Fancm-deficient mice reveal unique features of Fanconi anemia complementation group M
Hum. Mol. Genet., September 15, 2009; 18(18): 3484 - 3495.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. Rio, N. W. Meza, A. Gonzalez-Murillo, S. Navarro, L. Alvarez, J. Surralles, M. Castella, G. Guenechea, J. C. Segovia, H. Hanenberg, et al.
In vivo proliferation advantage of genetically corrected hematopoietic stem cells in a mouse model of Fanconi anemia FA-D1
Blood, December 15, 2008; 112(13): 4853 - 4861.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
K. Sugasawa
Xeroderma pigmentosum genes: functions inside and outside DNA repair
Carcinogenesis, March 1, 2008; 29(3): 455 - 465.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
N. Giri, D. L. Batista, B. P. Alter, and C. A. Stratakis
Endocrine Abnormalities in Patients with Fanconi Anemia
J. Clin. Endocrinol. Metab., July 1, 2007; 92(7): 2624 - 2631.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
E. Gallmeier and S. E. Kern
Targeting Fanconi Anemia/BRCA2 Pathway Defects in Cancer: The Significance of Preclinical Pharmacogenomic Models
Clin. Cancer Res., January 1, 2007; 13(1): 4 - 10.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. Larder, D. Karali, N. Nelson, and P. Brown
Fanconi Anemia a Is a Nucleocytoplasmic Shuttling Molecule Required for Gonadotropin-Releasing Hormone (GnRH) Transduction of the GnRH Receptor
Endocrinology, December 1, 2006; 147(12): 5676 - 5689.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
K.R. Barnett, C. Schilling, C.R. Greenfeld, D. Tomic, and J.A. Flaws
Ovarian follicle development and transgenic mouse models
Hum. Reprod. Update, September 1, 2006; 12(5): 537 - 555.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
P. E. Cohen, S. E. Pollack, and J. W. Pollard
Genetic Analysis of Chromosome Pairing, Recombination, and Cell Cycle Control during First Meiotic Prophase in Mammals
Endocr. Rev., June 1, 2006; 27(4): 398 - 426.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
A. L. Y. Pang, W. Johnson, N. Ravindranath, M. Dym, O. M. Rennert, and W.-Y. Chan
Expression profiling of purified male germ cells: stage-specific expression patterns related to meiosis and postmeiotic development
Physiol Genomics, January 12, 2006; 24(2): 75 - 85.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
N. Dendouga, H. Gao, D. Moechars, M. Janicot, J. Vialard, and C. H. McGowan
Disruption of Murine Mus81 Increases Genomic Instability and DNA Damage Sensitivity but Does Not Promote Tumorigenesis
Mol. Cell. Biol., September 1, 2005; 25(17): 7569 - 7579.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. Macleod, P. Mullen, J. Sewell, G. Rabiasz, S. Lawrie, E. Miller, J. F. Smyth, and S. P. Langdon
Altered ErbB Receptor Signaling and Gene Expression in Cisplatin-Resistant Ovarian Cancer
Cancer Res., August 1, 2005; 65(15): 6789 - 6800.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. Yamamoto, S. Hirano, M. Ishiai, K. Morishima, H. Kitao, K. Namikoshi, M. Kimura, N. Matsushita, H. Arakawa, J.-M. Buerstedde, et al.
Fanconi Anemia Protein FANCD2 Promotes Immunoglobulin Gene Conversion and DNA Repair through a Mechanism Related to Homologous Recombination
Mol. Cell. Biol., January 1, 2005; 25(1): 34 - 43.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Houghtaling, L. Granville, Y. Akkari, Y. Torimaru, S. Olson, M. Finegold, and M. Grompe
Heterozygosity for p53 (Trp53+/-) Accelerates Epithelial Tumor Formation in Fanconi Anemia Complementation Group D2 (Fancd2) Knockout Mice
Cancer Res., January 1, 2005; 65(1): 85 - 91.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Franco, H. J. van de Vrugt, P. Fernandez, M. Aracil, F. Arwert, and M. A. Blasco
Telomere dynamics in Fancg-deficient mouse and human cells
Blood, December 15, 2004; 104(13): 3927 - 3935.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
S. Houghtaling, C. Timmers, M. Noll, M. J. Finegold, S. N. Jones, M. S. Meyn, and M. Grompe
Epithelial cancer in Fanconi anemia complementation group D2 (Fancd2) knockout mice
Genes & Dev., August 15, 2003; 17(16): 2021 - 2035.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. Yamamoto, M. Ishiai, N. Matsushita, H. Arakawa, J. E. Lamerdin, J.-M. Buerstedde, M. Tanimoto, M. Harada, L. H. Thompson, and M. Takata
Fanconi Anemia FANCG Protein in Mitigating Radiation- and Enzyme-Induced DNA Double-Strand Breaks by Homologous Recombination in Vertebrate Cells
Mol. Cell. Biol., August 1, 2003; 23(15): 5421 - 5430.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
M D Tischkowitz and S V Hodgson
Fanconi anaemia
J. Med. Genet., January 1, 2003; 40(1): 1 - 10.
[Abstract] [Full Text]


Home page
BloodHome page
P. Rio, J. C. Segovia, H. Hanenberg, J. A. Casado, J. Martinez, K. Gottsche, N. C. Cheng, H. J. Van de Vrugt, F. Arwert, H. Joenje, et al.
In vitro phenotypic correction of hematopoietic progenitors from Fanconi anemia group A knockout mice
Blood, August 28, 2002; 100(6): 2032 - 2039.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (41)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Koomen, M.
Right arrow Articles by Arwert, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Koomen, M.
Right arrow Articles by Arwert, F.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?