| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Human Molecular Genetics, 2002, Vol. 11, No. 3 337-345
© 2002 Oxford University Press
Genetic and biophysical basis of sudden unexplained nocturnal death syndrome (SUNDS), a disease allelic to Brugada syndrome
1Department of Pediatrics (Cardiology), 2Department of Medicine (Cardiology) and 3Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX, USA, 4Masonic Medical Research Laboratory, Utica, NY, USA, 5Department of Internal Medicine (Cardiology), National Cardiovascular Center, Osaka, Japan, 6Department of Medicine (Cardiology), University of Southern California, Los Angeles, CA, USA, 7Cardiovascular Institute, Hospital Clinic, University of Barcelona, Spain, 8Cardiovascular Center, OLV Hospital, Aalst, Belgium and 9Department of Cardiology, Bhumibol Adulyadej Hospital, RTAF, Bangkok, Thailand
Received November 20, 2001; Accepted November 28, 2001.
| ABSTRACT |
|---|
|
|
|---|
Sudden unexplained nocturnal death syndrome (SUNDS), a disorder found in southeast Asia, is characterized by an abnormal electrocardiogram with ST-segment elevation in leads V1V3 and sudden death due to ventricular fibrillation, identical to that seen in Brugada syndrome. We screened patients with SUNDS for mutations in SCN5A, the gene known to cause Brugada syndrome, as well as genes encoding ion channels associated with the long-QT syndrome. Ten families were enrolled, and screened for mutations using single-strand DNA conformation polymorphism analysis, denaturing high-performance liquid chromatography and DNA sequencing. Mutations were identified in SCN5A in three families. One mutation, R367H, lies in the first P segment of the pore-lining region between the DIS5 and DIS6 transmembrane segments of SCN5A. A second mutation, A735V, lies in the first transmembrane segment of domain II (DIIS1) close to the first extracellular loop between DIIS1 and DIIS2, whereas the third mutation, R1192Q, lies in domain III. Analysis of these mutations in Xenopus oocytes showed that the R367H mutant channel did not express any current and the likely effect of this mutation is to depress peak current due to the loss of one functional allele. The A735V mutant expressed currents with steady state activation voltage shifted to more positive potentials. The R1192Q mutation accelerated the inactivation of the sodium channel current. Both mutations resulted in reduced sodium channel current (INa) at a time corresponding to the end of phase 1 of the action potential, as described previously in the Brugada syndrome. Based upon these observations we suggest that SUNDS and Brugada syndrome are phenotypically, genetically and functionally the same disorder.
| INTRODUCTION |
|---|
|
|
|---|
Sudden unexplained nocturnal death syndrome (SUNDS) is a disorder found in southeast Asia, particularly Thailand, Japan, Philippines and Cambodia, which causes sudden cardiac death (usually in males) during sleep (13). This disorder, which is the most common cause of natural death in the young, healthy Asian population, is called by many descriptive terms in the various countries, including pokkuri (sudden unexplained death at night) in Japan, lai-tai (died during sleep) in Thailand, and bangungut (moaning and dying during sleep) in the Philippines.
The clinical features of SUNDS include ST-segment elevation in the right precordial leads (V1V3), inconsistently associated with right bundle branch block (RBBB) (Fig. 1) (2,3) and ventricular tachycardia and fibrillation (VF) on surface electrocardiogram (ECG). These clinical characteristics are similar to those of the Brugada syndrome, a disorder diagnosed in individuals of European descent (46).
|
The genetic cause of the Brugada syndrome was initially described by our group and shown to be due to mutations in the cardiac sodium channel gene, SCN5A. This has now been confirmed by others (7,8). In previous publications, we and others demonstrated that mutant sodium channels have a reduced sodium channel current (INa) due to rapid inactivation of the current or failure of the channel to express currents (9,10). Due to the apparent clinical similarities between Brugada syndrome and SUNDS, we speculated that these could be allelic disorders (or even the same disease). In this report, we describe the molecular analysis of patients with SUNDS and identify mutations in SCN5A, confirming this disorder to be genotypically, phenotypically and functionally identical to Brugada syndrome.
| RESULTS |
|---|
|
|
|---|
Mutation analysis
Ten probands with clinical evidence of SUNDS were screened for mutations in KVLQT1 (11), HERG (11), SCN5A (9,11), minK (12) and MiRP1 (13) using single-strand DNA conformation polymorphism (SSCP) analysis, denaturing high-performance liquid chromatography (DHPLC) and DNA sequencing. In three patients (M030, M032, M033), SCN5A mutations were identified. No mutations were identified in any of the other genes screened. Patient M030 is a sporadic case, whereas the other two cases were probands of families. One of these was a family with multiple affected individuals (family M032), and apparent autosomal dominant inheritance. The second family (M033) included a pair of affected Japanese dizygotic twins. One twin died unexpectedly during sleep at 4 months of age. The other twin had frequent VF episodes at 6 months of age and has been discussed previously (14). This living child and other family members were studied.
Patient M030. An abnormal conformer was identified in exon 9 of SCN5A in this sporadic case (Fig. 2A) and confirmed by DHPLC analysis (Fig. 2C). DNA sequence analysis revealed a G
A base substitution (G1100A) in exon 9 (Fig. 2B) leading to the substitution of an arginine by a histidine at codon 367 (R367H), which lies in the first P segment belonging to the pore-lining region between the DIS5 and DIS6 transmembrane segments of the cardiac sodium channel (Fig. 3). The P segment is a conserved region within the Na+-channel family (15). This mutation was not found in other family members (including the parents) nor in 100 control individuals (200 chromosomes) of Asian descent (data not shown).
|
|
Family M032. A point mutation was identified in the proband of family M032. SSCP (Fig. 4A) and DHPLC analysis (Fig. 4C) identified an abnormality in exon 14, due to a C
T substitution (C2204T) (Fig. 4B) leading to a substitution of alanine by valine at codon 735 (A735V). This mutation lies in the first transmembrane segment of domain II (DIIS1) at the border with the first extracellular loop between DIIS1 and DIIS2 (Fig. 3). Screening of other family members identified the same mutation in the father and the son of the proband, both of whom had ECG abnormalities consistent with SUNDS. The unaffected family members and 100 control patients did not carry this mutation.
|
Family M033. A point mutation was identified in the proband of family M033, the surviving dizygotic twin. DHPLC analysis (Fig. 5A) identified an abnormality in exon 20, due to a G
A substitution (G3575A) (Fig. 5B) leading to a substitution of arginine by glutamine at codon 1192 (R1192Q). This mutation lies in the intracellular loop connecting the DIIS6 to DIIIS1 (Fig. 3). Screening of other family members identified the same mutation in the affected family members (data not shown). The unaffected family members and 100 control patients did not carry this mutation.
|
Biophysical analysis
To study the mechanism by which these mutations may contribute to the syndrome, heterologous expression in Xenopus oocytes was performed. The mutant channel R367H did not express any current and the likely effect of this mutation is to depress INa due to the loss of one functional allele (Fig. 6A and C).
|
In contrast, expression of the A735V mutant appeared normal (Fig. 6B). Although visual inspection of the current traces suggested faster decay of A735V current, statistical analysis of the current decay fit to the sum of two exponential failed to show a significant increase of inactivation kinetics (Z-test for mean or ANOVA). However, the time to peak of the maximum current was significantly briefer for A735V (1.8 ± 0.1 ms) versus wild-type (WT) (2.2 ± 0.1 ms) (Fig. 7). The average maximum current was measured at 10 and 5 mV for WT and A735V, respectively. The shorter time to peak and shift of the voltage of maximum current for A735V was due to a 7 mV shift of the steady state activation curve towards more positive potentials (Fig. 7B).
|
Figure 8 shows that the shift in steady state activation leads to a significant reduction in A735V current at a time (3 ms) and over a range of potentials (30 to 0 mV) corresponding to phase 1 of the epicardial right ventricular action potential.
|
The R1192Q mutation had no effects on steady state activation (not shown) but significantly accelerated decay of the sodium current over a wide range of activation potentials (Fig. 9AC). Steady state inactivation of A735V was unchanged compared to WT, displaying a V1/2 of 68.5 ± 0.2 and 68.4 ± 0.1 mV, respectively. The R1192Q mutation produced a small but significant positive shift of steady state inactivation (P < 0.05) yielding a V1/2 of 64.5 ± 0.2 mV. The protocol consisted of 500 ms conditioning pulses ranging from 140 to 60 mV in 5 mV increments followed by a test pulse to 10 mV. The holding potential was 90 mV.
|
Recovery from inactivation was significantly slower for A735V channels than for WT (Fig. 10), an effect similar to that described previously for other Brugada syndrome-related mutations (9,10) but was not changed by the R1192Q mutation (data not shown).
|
| DISCUSSION |
|---|
|
|
|---|
Sudden cardiac death commonly results from ventricular arrhythmias, but the underlying mechanisms responsible for these tragic events are only now being unravelled. Over the past decade, two disorders in which ventricular arrhythmias play a central role in patient outcome, the long-QT (LQTS) and Brugada syndromes, have been characterized at the genetic level (16). In both instances, surface ECG abnormalities which could be explained by the genetic defects and resultant physiologic derangements, are notable. In LQTS, seven genetic loci have been identified (1113,17) and the genes for six of these, all ion-channel-encoding genes, have been described (14). Five of these genes (LQT1, LQT2, LQT5, LQT6 and LQT7) encode potassium channel proteins (KVLQT1, minK, HERG, MiRP1 and Kir2.1, respectively) whereas one, LQT3, encodes the cardiac sodium channel gene SCN5A (16). Similarly, Brugada syndrome has been shown to result from mutations in SCN5A, but the biophysical properties of mutant sodium channels differ in patients with LQTS (LQT3) (16,18,19) versus those with Brugada syndrome (9,10). Because SUNDS is characterized by ventricular tachyarrhythmias (VT/VF), has surface ECG abnormalities similar to those seen in Brugada syndrome, and is associated with nocturnal sudden death (14) like that described in some LQT3 patients (20), we screened patients and their families for SCN5A abnormalities. In two families with autosomal dominant inheritance, and one sporadic case, mutations were identified, all in the N-terminal portion of the SCN5A protein. Although we screened all families for mutations in the other ion channel candidate genes described above, no mutations other than in SCN5A were identified. In addition to LQTS, Brugada syndrome, and now SUNDS, mutations in SCN5A have also been found to cause progressive conduction system disease (Lev-Lenegre syndrome) (21), isolated conduction system disease (22), and sudden infant death syndrome (SIDS) (9,21,23,24). Interestingly, death most commonly occurs during sleep in all of these disorders, suggesting a common mechanism. Furthermore, mutations in SCN5A have been observed in patients with features of both LQTS and Brugada syndrome suggesting variable clinical presentations with mutations in the same gene (7,25). In family M033, the dizygotic twins presented during infancy, with one child dying of apparent SIDS, while his brother survived due to resuscitation of his ventricular tachyarrhythmias. Of note, previously reported Brugada mutations have been shown to cause the sodium channel to enter an intermediate inactivation state from which it recovers more slowly (26). Whereas this would lead to a reduction in INa at relatively rapid rates, it is not clear how this mechanism could contribute to the Brugada phenotype and arrhythmogenic substrate, both of which are bradycardia-dependent.
Biophysical analysis of the R367H mutation demonstrated non-functional channels with no expression of inward currents. To confirm that this was not due to a secondary mutation, the entire cDNA cassette was sequenced (data not shown) and the integrity of the RNA injected was assessed on a denaturing gel (data not shown). The A735V mutation resulted in the expression of robust INa, with steady state activation shifted towards more positive potentials, similar to that described previously for the Brugada syndrome at physiologic temperature (10). These channels displayed a slower recovery from inactivation than WT, again similar to that described previously for T1620M (9,10,27,28). The shift in A735V steady state activation leads to a shorter time to peak current as well as to reduced INa during a time and voltage corresponding to phase 1 of the right ventricular action potential. These two effects would be expected to reduce the contribution of INa during phase 1, leaving the transient outward current (Ito) unopposed.
The R1192Q mutation similarly shifts the balance of current towards Ito by accelerating the decay of INa. This effect is similar to that observed for two other Brugada mutations: T1620M (10) and L567Q (29,30).
Although different mechanisms are involved in A735V and R1192Q, the reduced density of INa present during activation of Ito (phases 0 and 1 of the action potential) can lead to an accentuation of the action potential notch and loss of the action potential dome. This rebalancing of net current present during phase 1 of the action potential can lead to loss of the action potential dome in cells possessing a prominent Ito (e.g. right ventricular epicardium) but not those largely devoid of an Ito (e.g. endocardium or left ventricular epicardium). Transmural or transepicardial dispersion is likely to develop as a consequence, leading to the ST-segment elevation in the right precordial leads (V1V3) on surface ECG recordings and VT/VF, the hallmarks of both Brugada syndrome and SUNDS (31).
We conclude that Brugada syndrome and SUNDS represent the same autosomal dominant familial disorder, suggesting this disorder occurs worldwide. Both SUNDS and Brugada syndrome can result from mutations in the cardiac sodium channel SCN5A that cause loss of channel function but, like Brugada syndrome, mutations have only been identified in a proportion of the probands studied. Furthermore, this work suggests that SUNDS, Brugada syndrome, SIDS, LQTS and conduction system disease are allelic disorders, if not the same disease with variable penetrance and variable modifiers. The methods used to study these patients (PCR, SSCP and DHPLC), which are sensitive for the detection of point mutations or small deletions, could miss large gene deletions. Furthermore, promoter mutations resulting in aberrant gene expression cannot be discounted in patients testing negative for mutations. However, it appears likely that there is genetic heterogeneity in both of these disorders, with mutations in other ion channel genes or proteins involved in phase 1 repolarization of the ventricular action potential either directly or through modulation of ion channel function. Incomplete penetrance of these mutations could result in asymptomatic carriers. It is likely that provocation studies using ajmaline, flecainide or procainamide could be useful in evaluation of asymptomatic SUNDS family members, as has been shown for Brugada syndrome (32,33). Finally, similar therapeutic options should be considered for both disorders; currently, implantation of an automatic implantable cardioverter defibrillator is an option to consider in these patients (2).
| MATERIALS AND METHODS |
|---|
|
|
|---|
Clinical evaluation
Kindreds and sporadic cases with clinical evidence of SUNDS were enrolled from medical clinics in Japan and Thailand. The phenotype of each family member was characterized by a previous history of sudden death in probands or in a family member, no demonstrable structural heart defects on echocardiogram or prolonged QT interval on surface ECG, and an ECG pattern of ST-segment elevation in leads V1V3, with or without RBBB. Detailed family history was obtained from all probands and their families, along with the history of all clinical events. All enrolled individuals underwent evaluation by surface ECG and Holter monitor. When clinically indicated, an electrophysiology study was performed. In all instances, written informed consent was obtained.
DNA mutation analysis
Genomic DNA was extracted directly from blood or from lymphoblastoid cell lines established from blood, using standard protocols (34). Genomic DNA samples were amplified by PCR using primers designed to amplify across the entire sequence of all known LQTS and Brugada syndrome genes (KvLQT1, HERG, SCN5A, minK, MiRP1) in an exon-by-exon manner (1113). PCR products were analyzed by SSCP analysis (9,34) or by DHPLC using a WAVE DNA Fragment Analysis System (Transgenomic, Omaha, NE) (35). Normal and aberrant SSCP conformers were cut directly from dried gels and eluted in distilled water (65°C for 30 min) and then re-amplified. For samples giving abnormal DHPLC peaks, the genomic DNA was re-amplified directly. PCR products were sequenced, using Big Dye Terminator chemistry and an ABI-310 automated sequencer (PE Biosystems, Foster City, CA), according to the manufacturers instructions. 100 control patients of Asian descent were used to exclude the likelihood of the abnormalities being benign polymorphisms.
Site-directed mutagenesis
Mutant SCN5A channel cDNAs were prepared by site-directed mutagenesis of the plasmid pcDNASCN5A which contains SCN5A cDNA cloned into pcDNA3.1+ (Invitrogen, Carlsbad, CA). To create the R367H mutant, the Megaprimer method of mutagenesis was used. In brief, a 100 bp fragment containing the mutated sequence was amplified from pcDNASCN5A using the primers SCN5AAgeI (AGGGCTACCGGTGCCTAAAGGCAG) and SCN5AR367H (CGTCATCAGGTGGAACACTG). After gel purification this was used as a megaprimer along with SCN5ANheI (CCGAGTCGTTCTTGCCAAAGAGCTG), to amplify a product of 1587 bp from pcDNASCN5A. This fragment was cloned back into pcDNASCN5A by substitution of the AgeINheI fragment (nucleotides 10172536 of SCN5A cDNA).
A similar approach was used for constructing the A735V mutant. To create the megaprimer, pcDNASCN5A was amplified using the primers SCN5AA735V (CACTCTTCATGGTGCTGGAG) and SCN5ANheI. The 408 bp PCR megaprimer was then used with SCN5AAgeI to amplify the 1587 bp product, which was cloned in pcDNASCN5A as above. Mutant clones were identified and characterized by DNA sequencing with SCN5AAgeI or SCN5ANheI primers, as described above.
Oocyte preparation, RNA injection and electrophysiology
Xenopus laevis were anesthetized and an incision was made in the lower abdomen of the frogs to remove the ovarian lobes. The oocytes were freed from the lobes and digested for 12 h with 2 mg/ml collagenase (201 U/mg; Gibco BRL, Gaithersburg, MD) to remove the follicular membrane. Healthy stage IV and V oocytes were selected for RNA injection on the next day.
In vitro transcription of WT and mutant SCN5A cDNAs was performed using an mMessage mMachine kit (Ambion, Austin, TX). The RNA solution was diluted to the desired concentration (250 or 500 ng/µl) in sterile 100 mM KCl and 46 nl of the cRNA solution was injected in each oocyte using a Nanojet automatic oocyte injector (Drummond Instruments, Broomall, PA). Once injected, the eggs were stored at 17°C in SOS solution containing 100 mM NaCl, 2 mM KCl, 1.8 mM CaCl2·2H2O, 1 mM MgCl2·6H2O, 5 mM HEPES, 2.5 mM pyruvic acid, pH 7.6, supplemented with 100 µg gentamicin, 100 U/ml penicillin + 100 µg/ml streptomycin, under slow shaking.
Whole-cell currents were recorded from Xenopus oocytes using the conventional two-microelectrode voltage-clamp technique (10). Briefly, bevelled microelectrodes were plugged with a 1.5% agarose solution containing 3 M KCl, 10 mM HEPES and 10 mM EGTA, pH 7.4 and back-filled with 3 M KCl to give a resistance of 0.20.5 M
. Oocytes were placed in a chamber and perfused with an external solution containing 5 mM KCl, 2 mM CaCl2, 1 mM MgCl2, 140 mM NaOH, 10 mM HEPES, 10 mM glucose, pH 7.4. Currents were amplified by a Warner oocytes clamp (OC-725A), low-pass filtered at 3 kHz (3 dB, 4 pole Bessel filter, Wavetech, Model 432). Data acquisition and analysis was performed with pCLAMP 6 (Axon Instruments, Foster City, CA). Currents were recorded at room temperature, and experiments in which the holding current was >200 nA at a holding potential of 90 mV were excluded from analysis.
| ACKNOWLEDGEMENTS |
|---|
The authors are grateful to Melba Koegele, Yue-Sheng Wu, Stacy Scicchitano and Elena Burashnikov for expert technical assistance. This work was funded by NIH grants RO1 HL62570 (J.A.T.), HL 47678 (C.A.) and HL 59449 (R.D.) and by the Masons of the states of New York and Florida. Jeffrey A.Towbin, MD is supported by the Texas Childrens Hospital Foundation Chair in Pediatric Cardiovascular Research. Neil E.Bowles, PhD is supported by grants from the American Heart Association (Texas Affiliate and National).
| FOOTNOTES |
|---|
+ To whom correspondence should be addressed at: Pediatric Cardiology, Baylor College of Medicine, One Baylor Plaza, Room 333E, Houston, TX 77030, USA. Tel: +1 713 798 7342; Fax: +1 713 798 8085; Email: jtowbin@bcm.tmc.edu
| REFERENCES |
|---|
|
|
|---|
1 Baron,R.C., Thacker,S.B., Gorelkin,L., Vernon,A.A., Taylor,W.R. and Choi,K. (1983) Sudden death among Southeast Asian refugees. An unexplained nocturnal phenomenon. J. Am. Med. Assoc., 250, 29472951.
2
Nademanee,K., Veerakul,G., Nimmannit,S., Chaowakul,V., Bhuripanyo,K., Likittanasombat,K., Tunsanga,K., Kuasirikul,S., Malasit,P., Tansupasawadikul,S. et al. (1997) Arrhythmogenic marker for the sudden unexplained death syndrome in Thai men. Circulation, 96, 25952600.
3 Gilbert,J., Gold,R.L., Haffajee,C.I. and Alpert,J.S. (1986) Sudden cardiac death in a southeast Asian immigrant: clinical, electrophysiologic and biopsy characteristics. Pacing Clin. Electrophysiol., 9, 912914.[Medline]
4 Brugada,P. and Brugada,J. (1992) Right bundle branch block, persistent ST segment elevation and sudden cardiac death: a distinct clinical and electrocardiographic syndrome. A multicenter report. J. Am. Coll. Cardiol., 20, 13911396.[Abstract]
5 Brugada,J. and Brugada,P. (1997) Further characterization of the syndrome of right bundle branch block, ST segment elevation and sudden cardiac death. J. Cardiovasc. Electrophysiol., 8, 325331.[Web of Science][Medline]
6 Kobayashi,T., Shintani,U., Yamamoto,T., Shida,S., Isshiki,N., Tanaka,T., Ohmoto,Y., Kitamura,M., Kato,S. and Misaki,M. (1996) Familial occurrence of electrocardiographic abnormalities of the Brugada-type. Intern. Med., 35, 637640.[Web of Science][Medline]
7
Bezzina,C., Veldkamp,M.W., van Den Berg,M.P., Postma,A.V., Rook,M.B., Viersma,J.W., van Langen,I.M., Tan-Sindhunata,G., Bink-Boelkens,M.T., van Der Hout,A.H. et al. (1999) A single Na(+) channel mutation causing both long-QT and Brugada syndromes. Circ. Res., 85, 12061213.
8
Rook,M.B., Alshinawi,C.B., Groenewegen,W.A., van Gelder,I.C., van Ginneken,A.C., Jongsma,H.J., Mannens,M.M. and Wilde,A.A. (1999) Human SCN5A gene mutations alter cardiac sodium channel kinetics and are associated with the Brugada syndrome. Cardiovasc. Res., 44, 507517.
9 Chen,Q., Kirsch,G.E., Zhang,D., Brugada,R., Brugada,J., Brugada,P., Potenza,D., Moya,A., Borggrefe,M., Breithardt,G. et al. (1998) Genetic basis and molecular mechanism for idiopathic ventricular fibrillation. Nature, 392, 293296.[Medline]
10
Dumaine,R., Towbin,J.A., Brugada,P., Vatta,M., Nesterenko,D.V., Nesterenko,V.V., Brugada,J., Brugada,R. and Antzelevitch,C. (1999) Ionic mechanisms responsible for the electrocardiographic phenotype of the Brugada syndrome are temperature dependent. Circ. Res., 85, 803809.
11 Splawski,I., Shen,J., Timothy,K.W., Vincent,G.M., Lehmann,M.H. and Keating,M.T. (1998) Genomic structure of three long QT syndrome genes: KVLQT1, HERG and KCNE1. Genomics, 51, 8697.[Web of Science][Medline]
12 Schulze-Bahr,E., Wang,Q., Wedekind,H., Haverkamp,W., Chen,Q., Sun,Y., Rubie,C., Hordt,M., Towbin,J.A., Borggrefe,M. et al. (1997) KCNE1 mutations cause Jervell and Lange-Nielsen syndrome. Nat. Genet., 17, 267268.[Web of Science][Medline]
13 Abbott,G.W., Sesti,F., Splawski,I., Buck,M.E., Lehmann,M.H., Timothy,K.W., Keating,M.T. and Goldstein,S.A. (1999) MiRP1 forms IKr potassium channels with HERG and is associated with cardiac arrhythmia. Cell, 97, 175187.[Web of Science][Medline]
14 Suzuki, H., Torigoe, K, Numata, O. and Yazaki, S. (2000) Infant case with a malignant form of Brugada syndrome. J. Cardiovasc. Electrophysiol., 11, 12771280.[Web of Science][Medline]
15
Marban,E., Yamagishi,T. and Tomaselli,G.F. (1998) Structure and function of voltage-gated sodium channels. J. Physiol. (Lond.), 508, 647657.
16 Vatta,M., Li,H. and Towbin,J.A. (2000) Molecular biology of arrhythmic syndromes. Curr. Opin. Cardiol., 15, 1222.[Web of Science][Medline]
17 Plaster,N.M., Tawil,R., Tristani-Firouzi,M., Canun,S., Bendahhou,S., Tsunoda,A., Donaldson,M.R., Iannaccone,S.T., Brunt,E., Barohn,R. et al. (2001) Mutations in Kir2.1 cause the developmental and episodic electrical phenotypes of Andersens syndrome. Cell, 105, 511519.[Web of Science][Medline]
18
Dumaine,R., Wang,Q., Keating,M.T., Hartmann,H.A., Schwartz,P.J., Brown,A.M. and Kirsch,G.E. (1996) Multiple mechanisms of Na+ channel-linked long-QT syndrome. Circ. Res., 78, 916924.
19 Bennett,P.B., Yazawa,K., Makita,N. and George,A.L.,Jr (1995) Molecular mechanism for an inherited cardiac arrhythmia. Nature, 376, 683685.[Medline]
20
Zareba,W., Moss,A.J., Schwartz,P.J., Vincent,G.M., Robinson,J.L., Priori,S.G., Benhorin,J., Locati,E.H., Towbin,J.A., Keating,M.T. et al. (1998) Influence of genotype on the clinical course of the long-QT syndrome. International Long-QT Syndrome Registry Research Group. New Engl. J. Med., 339, 960965.
21 Schott,J.J., Alshinawi,C., Kyndt,F., Probst,V., Hoorntje,T.M., Hulsbeek,M., Wilde,A.A., Escande,D., Mannens,M.M. and Le Marec,H. (1999) Cardiac conduction defects associate with mutations in SCN5A. Nat. Genet., 23, 2021.[Web of Science][Medline]
22 Tan,H.L., Bink-Boelkens,M.T., Bezzina,C.R., Viswanathan,P.C., Beaufort-Krol,G.C., van Tintelen,P.J., van den Berg,M.P., Wilde,A.A. and Balser,J.R. (2001) A sodium-channel mutation causes isolated cardiac conduction disease. Nature, 409, 10431047.[Medline]
23
Splawski,I., Shen,J., Timothy,K.W., Lehmann,M.H., Priori,S., Robinson,J.L., Moss,A.J., Schwartz,P.J., Towbin,J.A., Vincent,G.M. et al. (2000) Spectrum of mutations in long-QT syndrome genes. KVLQT1, HERG, SCN5A, KCNE1 and KCNE2. Circulation, 102, 11781185.
24
Schwartz,P.J., Priori,S.G., Dumaine,R., Napolitano,C., Antzelevitch,C., Stramba-Badiale,M., Richard,T.A., Berti,M.R. and Bloise,R. (2000) A molecular link between the sudden infant death syndrome and the long-QT syndrome. New Engl. J. Med., 343, 262267.
25 Deschenes,I., Baroudi,G., Berthet,M., Barde,I., Chalvidan,T., Denjoy,I., Guicheney,P. and Chahine,M. (2000) Electrophysiological characterization of SCN5A mutations causing long QT (E1784K) and Brugada (R1512W and R1432G) syndromes. Cardiovasc. Res., 46, 5565.[Web of Science][Medline]
26 Wang,D.W., Makita,N., Kitabatake,A., Balser,J.R. and George,A.L.,Jr (2000) Enhanced Na(+) channel intermediate inactivation in Brugada syndrome. Circ. Res., 87, E37E43.
27 Baroudi,G., Carbonneau,E., Pouliot,V. and Chahine,M. (2000) SCN5A mutation (T1620M) causing Brugada syndrome exhibits different phenotypes when expressed in Xenopus oocytes and mammalian cells. FEBS Lett., 467, 1216.[Web of Science][Medline]
28
Makita,N., Shirai,N., Wang,D.W., Sasaki,K., George,A.L.,Jr, Kanno,M. and Kitabatake,A. (2000) Cardiac Na(+) channel dysfunction in Brugada syndrome is aggravated by ß(1)-subunit. Circulation, 101, 5460.
29 Antzelevitch,C. (2001) Molecular biology and cellular mechanisms of cardiac arrhythmias and sudden death in infants and young children. J. Electrocardiol., 34, 320.
30
Wan,X., Chen,S., Sadeghpour,A., Wang,Q. and Kirsch,G.E. (2001) Accelerated inactivation in a mutant Na(+) channel associated with idiopathic ventricular fibrillation. Am. J. Physiol. Heart Circ. Physiol., 280, H354H360.
31
Yan,G.X. and Antzelevitch,C. (1999) Cellular basis for the Brugada syndrome and other mechanisms of arrhythmogenesis associated with ST-segment elevation. Circulation, 100, 16601666.
32 Antzelevitch,C., Brugada,P., Brugada,J., Brugada,R., Nademanee,K. and Towbin,J. (1999) The Brugada syndrome. In Camm,A.J. (ed.), Clinical Approaches to Tachyarrhythmias. Futura Publishing Co., Armonk, NY.
33
Brugada,R., Brugada,J., Antzelevitch,C., Kirsch,G.E., Potenza,D., Towbin,J.A. and Brugada,P. (2000) Sodium channel blockers identify risk for sudden death in patients with ST-segment elevation and right bundle branch block but structurally normal hearts. Circulation, 101, 510515.
34
Li,H., Chen,Q., Moss,A.J., Robinson,J., Goytia,V., Perry,J.C., Vincent,G.M., Priori,S.G., Lehmann,M.H., Denfield,S.W. et al. (1998) New mutations in the KVLQT1 potassium channel that cause long-QT syndrome. Circulation, 97, 12641269.
35 Bowles,K.R., Abraham,S.E., Brugada,R., Zintz,C., Comeaux,J., Sorajja,D., Tsubata,S., Li,H., Brandon,L., Gibbs,R.A. et al. (2000) Construction of a high-resolution physical map of the chromosome 10q22q23 dilated cardiomyopathy locus and analysis of candidate genes. Genomics, 67, 109127.[Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
R J Sung and N-Y Chan Practice viewpoints: AICD, who and when? Heart Asia, October 15, 2009; 2009(10): 7 - 9. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. P. Sidik, C. N. Quay, F. C. Loh, and L. Y. Chen Prevalence of Brugada sign and syndrome in patients presenting with arrhythmic symptoms at a Heart Rhythm Clinic in Singapore Europace, May 1, 2009; 11(5): 650 - 656. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Benito, A. Sarkozy, L. Mont, S. Henkens, A. Berruezo, D. Tamborero, D. Arzamendi, P. Berne, R. Brugada, P. Brugada, et al. Gender Differences in Clinical Manifestations of Brugada Syndrome J. Am. Coll. Cardiol., November 4, 2008; 52(19): 1567 - 1573. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bebarova, T. O'Hara, J. L. M. C. Geelen, R. J. Jongbloed, C. Timmermans, Y. H. Arens, L.-M. Rodriguez, Y. Rudy, and P. G. A. Volders Subepicardial phase 0 block and discontinuous transmural conduction underlie right precordial ST-segment elevation by a SCN5A loss-of-function mutation Am J Physiol Heart Circ Physiol, July 1, 2008; 295(1): H48 - H58. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Lehnart, M. J. Ackerman, D. W. Benson Jr, R. Brugada, C. E. Clancy, J. K. Donahue, A. L. George Jr, A. O. Grant, S. C. Groft, C. T. January, et al. Inherited Arrhythmias: A National Heart, Lung, and Blood Institute and Office of Rare Diseases Workshop Consensus Report About the Diagnosis, Phenotyping, Molecular Mechanisms, and Therapeutic Approaches for Primary Cardiomyopathies of Gene Mutations Affecting Ion Channel Function Circulation, November 13, 2007; 116(20): 2325 - 2345. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. W. Van Norstrand, C. R. Valdivia, D. J. Tester, K. Ueda, B. London, J. C. Makielski, and M. J. Ackerman Molecular and Functional Characterization of Novel Glycerol-3-Phosphate Dehydrogenase 1-Like Gene (GPD1-L) Mutations in Sudden Infant Death Syndrome Circulation, November 13, 2007; 116(20): 2253 - 2259. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Skinner, S.-K. Chung, C.-A. Nel, A. N. Shelling, J. R. Crawford, N. McKenzie, R. Pinnock, J. K. French, and M. I. Rees Brugada Syndrome Masquerading as Febrile Seizures Pediatrics, May 1, 2007; 119(5): e1206 - e1211. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-S. Wu, C.-T. Wu, L.-A. Hsu, N. Luqman, and C.-T. Kuo Brugada-like electrocardiographic pattern and ventricular fibrillation in a patient with primary hyperparathyroidism Europace, March 1, 2007; 9(3): 172 - 174. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Arnestad, L. Crotti, T. O. Rognum, R. Insolia, M. Pedrazzini, C. Ferrandi, A. Vege, D. W. Wang, T. E. Rhodes, A. L. George Jr, et al. Prevalence of Long-QT Syndrome Gene Variants in Sudden Infant Death Syndrome Circulation, January 23, 2007; 115(3): 361 - 367. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Vatta, M. J. Ackerman, B. Ye, J. C. Makielski, E. E. Ughanze, E. W. Taylor, D. J. Tester, R. C. Balijepalli, J. D. Foell, Z. Li, et al. Mutant Caveolin-3 Induces Persistent Late Sodium Current and Is Associated With Long-QT Syndrome Circulation, November 14, 2006; 114(20): 2104 - 2112. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.-M. Niu, B. Hwang, H.-W. Hwang, N. H Wang, J.-Y. Wu, P.-C. Lee, J.-C. Chien, R.-C. Shieh, and Y.-T. Chen A common SCN5A polymorphism attenuates a severe cardiac phenotype caused by a nonsense SCN5A mutation in a Chinese family with an inherited cardiac conduction defect J. Med. Genet., October 1, 2006; 43(10): 817 - 821. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Poelzing, C. Forleo, M. Samodell, L. Dudash, S. Sorrentino, M. Anaclerio, R. Troccoli, M. Iacoviello, R. Romito, P. Guida, et al. SCN5A Polymorphism Restores Trafficking of a Brugada Syndrome Mutation on a Separate Gene Circulation, August 1, 2006; 114(5): 368 - 376. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Sotoodehnia, D. S. Siscovick, M. Vatta, B. M. Psaty, R. P. Tracy, J. A. Towbin, R. N. Lemaitre, T. D. Rea, J. P. Durda, J. M. Chang, et al. {beta}2-Adrenergic Receptor Genetic Variants and Risk of Sudden Cardiac Death Circulation, April 18, 2006; 113(15): 1842 - 1848. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Bunch and M. J. Ackerman Promoting Arrhythmia Susceptibility Circulation, January 24, 2006; 113(3): 330 - 332. [Full Text] [PDF] |
||||
![]() |
C. R. Bezzina, W. Shimizu, P. Yang, T. T. Koopmann, M. W.T. Tanck, Y. Miyamoto, S. Kamakura, D. M. Roden, and A. A.M. Wilde Common Sodium Channel Promoter Haplotype in Asian Subjects Underlies Variability in Cardiac Conduction Circulation, January 24, 2006; 113(3): 338 - 344. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ogawa, R. Kishi, K. Mihara, H. Takahashi, A. Takagi, N. Matsumoto, K. Masuhara, K. Nakazawa, F. Miyake, S. Kobayashi, et al. Population Pharmacokinetic and Pharmacodynamic Analysis of a Class IC Antiarrhythmic, Pilsicainide, in Patients With Cardiac Arrhythmias J. Clin. Pharmacol., January 1, 2006; 46(1): 59 - 68. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Kinoshita, E. Kinoshita-Kikuta, H. Kojima, Y. Nakano, K. Chayama, and T. Koike Reliable and Cost-Effective Screening of Inherited Heterozygosity by Zn2+-Cyclen Polyacrylamide Gel Electrophoresis Clin. Chem., November 1, 2005; 51(11): 2195 - 2198. [Full Text] [PDF] |
||||
![]() |
P. G. Meregalli, A. A.M. Wilde, and H. L. Tan Pathophysiological mechanisms of Brugada syndrome: Depolarization disorder, repolarization disorder, or more? Cardiovasc Res, August 15, 2005; 67(3): 367 - 378. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Brugada, R. Brugada, J. Brugada, S. G. Priori, C. Napolitano, P. Brugada, R. Brugada, J. Brugada, S. G. Priori, and C. Napolitano Should patients with an asymptomatic Brugada electrocardiogram undergo pharmacological and electrophysiological testing? Circulation, July 12, 2005; 112(2): 279 - 292. [Full Text] [PDF] |
||||
![]() |
J R Skinner Is there a relation between SIDS and long QT syndrome? Arch. Dis. Child., May 1, 2005; 90(5): 445 - 449. [Full Text] [PDF] |
||||
![]() |
J R Skinner, S-K Chung, D Montgomery, C H McCulley, J Crawford, J French, and M I Rees Near-miss SIDS due to Brugada syndrome Arch. Dis. Child., May 1, 2005; 90(5): 528 - 529. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. T. Beery The Genetics of Cardiac Arrhythmias Biol Res Nurs, April 1, 2005; 6(4): 249 - 261. [Abstract] [PDF] |
||||
![]() |
C. Antzelevitch, P. Brugada, M. Borggrefe, J. Brugada, R. Brugada, D. Corrado, I. Gussak, H. LeMarec, K. Nademanee, A. R. Perez Riera, et al. Brugada Syndrome: Report of the Second Consensus Conference: Endorsed by the Heart Rhythm Society and the European Heart Rhythm Association Circulation, February 8, 2005; 111(5): 659 - 670. [Abstract] [Full Text] [PDF] |
||||
![]() |
H W Hwang, J J Chen, Y J Lin, R C Shieh, M T Lee, S I Hung, J Y Wu, Y T Chen, D M Niu, and B T Hwang R1193Q of SCN5A, a Brugada and long QT mutation, is a common polymorphism in Han Chinese J. Med. Genet., February 1, 2005; 42(2): e7 - e7. [Full Text] [PDF] |
||||
![]() |
Q Wang Author's reply: link of SCN5A SNP R1193Q to long QT syndrome J. Med. Genet., February 1, 2005; 42(2): e8 - e8. [Full Text] [PDF] |
||||
![]() |
N. Lowri Thomas, C. H. George, and F. Anthony Lai Functional heterogeneity of ryanodine receptor mutations associated with sudden cardiac death Cardiovasc Res, October 1, 2004; 64(1): 52 - 60. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.A.M Wilde and C Antzelevitch The continuing story: The aetiology of Brugada syndrome: functional or structural basis? Eur. Heart J., November 2, 2003; 24(22): 2073 - 2073. [Full Text] [PDF] |
||||
![]() |
C. Antzelevitch, P. Brugada, J. Brugada, R. Brugada, J. A. Towbin, and K. Nademanee Brugada syndrome: 1992-2002: A historical perspective J. Am. Coll. Cardiol., May 21, 2003; 41(10): 1665 - 1671. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. L Tan, C. R Bezzina, J. P.P Smits, A. O Verkerk, and A. A.M Wilde Genetic control of sodium channel function Cardiovasc Res, March 15, 2003; 57(4): 961 - 973. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Moric, E. Herbert, M. Trusz-Gluza, A. Filipecki, U. Mazurek, and T. Wilczok The implications of genetic mutations in the sodium channel gene (SCN5A) Europace, January 1, 2003; 5(4): 325 - 334. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.F. Starmer, T. J. Colatsky, and A. O. Grant What happens when cardiac Na channels lose their function? 1 - Numerical studies of the vulnerable period in tissue expressing mutant channels Cardiovasc Res, January 1, 2003; 57(1): 82 - 91. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Antzelevitch, P. Brugada, J. Brugada, R. Brugada, W. Shimizu, I. Gussak, and A.R. Perez Riera Brugada Syndrome: A Decade of Progress Circ. Res., December 13, 2002; 91(12): 1114 - 1118. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Antzelevitch Late potentials and the Brugada syndrome J. Am. Coll. Cardiol., June 19, 2002; 39(12): 1996 - 1999. [Full Text] [PDF] |
||||
![]() |
G. A. Papadatos, P. M. R. Wallerstein, C. E. G. Head, R. Ratcliff, P. A. Brady, K. Benndorf, R. C. Saumarez, A. E. O. Trezise, C. L.-H. Huang, J. I. Vandenberg, et al. From the Cover: Slowed conduction and ventricular tachycardia after targeted disruption of the cardiac sodium channel gene Scn5a PNAS, April 30, 2002; 99(9): 6210 - 6215. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Papadatos, P. M. R. Wallerstein, C. E. G. Head, R. Ratcliff, P. A. Brady, K. Benndorf, R. C. Saumarez, A. E. O. Trezise, C. L.-H. Huang, J. I. Vandenberg, et al. From the Cover: Slowed conduction and ventricular tachycardia after targeted disruption of the cardiac sodium channel gene Scn5a PNAS, April 30, 2002; 99(9): 6210 - 6215. [Abstract] [Full Text] [PDF] |
||||








P < 0.05 between the marked values, each corresponding to the location of the maximal peak current as shown in (C).

t) duration as shown for the WT currents. (B) Peak current elicited during the second pulse was normalized to the value obtained during the initial test pulse. The ratio was then plotted as a function of the recovery potential during the inter-pulse. Data ± SEM for WT (squares) and A735V (circles) were fitted to a sum of two exponential functions (solid line) with values of 59 ± 5 (41%) and 21 ± 2 ms (59%), and 40 ± 5 (31%) and 13 ± 2 (69%) ms for the slow and fast recovery components of WT and A735V currents, respectively. Fast (C) and slow (D) components of recovery were slower for A735V at all recovery potentials studied.













