Human Molecular Genetics, 2002, Vol. 11, No. 5 477-486
© 2002 Oxford University Press
Human deafness dystonia syndrome is caused by a defect in assembly of the DDP1/TIMM8aTIMM13 complex
Department of Chemistry and Biochemistry and the Molecular Biology Institute, University of California, Los Angeles, CA 90095-1569, USA and 1Department of Medical Genetics, IMBG, The Panum Institute, University of Copenhagen, Blegdamsvej 3, 2200 Copenhagen, Denmark
Received September 28, 2001; Revised and Accepted January 8, 2002.
| ABSTRACT |
|---|
|
|
|---|
MohrTranebjaerg syndrome (MTS/DFN-1) or deafness/dystonia syndrome results from a mutation in deafness/dystonia protein 1/translocase of mitochondrial inner membrane 8a (DDP1/TIMM8a). DDP1/TIMM8a is similar to a family of yeast proteins in the mitochondrial intermembrane space which mediate the import and insertion of inner membrane proteins. We now show that TIMM8a assembles in a 70 kDa complex in the intermembrane space with TIMM13. DDP1/TIMM8a is not detectable in fibroblasts derived from a patient with a missense mutation in the DDP1/TIMM8a gene; the point mutation results in cysteine-66 being changed to tryptophan-66 in the conserved twin CX3C motif. The corresponding mutation in yeast translocase of inner membrane 8p (Tim8p) yields an unstable protein that does not assemble with yeast Tim13p. DDP1/TIMM8a, when expressed with TIMM13 in yeast mitochondria lacking the Tim8pTim13p complex, restores Tim23p import, and TIMM8a and TIMM13 can be cross-linked to the hTim23 import intermediate in rat and yeast mitochondria. In a similar manner to Tim8p, TIMM8a seemingly mediates the import of hTim23. Deafness/dystonia syndrome thus may be caused by decreased levels of Tim23 in the mitochondrial inner membrane in affected tissues.
| INTRODUCTION |
|---|
|
|
|---|
The mitochondrion has an elaborate set of translocons on the outer and inner membranes to mediate the import of proteins from the cytosol (14). Most mitochondrial proteins are synthesized as cytosolic precursors containing a cleavable N-terminal presequence. The precursor is escorted to the outer membrane by chaperones and then the hetero-oligomeric translocase of the outer membrane (TOM) mediates translocation. Several components function as receptors, while others form the translocation pore. After passage through the outer membrane, the translocase of inner membrane (Tim)17pTim23p complex of the inner membrane together with the ATP-dependent import motor mHsp70, Tim44p and mGrpE mediates translocation across the inner membrane. Finally, a number of soluble proteins in the matrix involved in the proteolytic maturation and folding of the imported proteins may be required to complete assembly (14).
In addition to the Tim23 complex, the mitochondrial inner membrane contains the Tim22 complex, which mediates the import of inner membrane proteins (46). Proteins destined for the inner membrane are escorted by cytosolic chaperones and then pass through the TOM complex to the intermembrane space. The intermembrane space complexes, Tim9pTim10p and Tim8pTim13p, function as putative chaperones to transfer the hydrophobic precursors across the intermembrane space to an inner membrane machinery specialized for the insertion of membrane proteins (710). The inner membrane complex consists of Tim12p, Tim18p, Tim22p, Tim54p, and a small fraction of Tim9p and Tim10p, which together form a 300 kDa complex (713). Components Tim9p, Tim10p, Tim12p, Tim22p and Tim54p are essential for viability (713).
A typical protein imported by this pathway is the ADP/ATP carrier (AAC), which contains six membrane-spanning regions (14). AAC lacks a cleavable N-terminal targeting sequence, carrying instead targeting information in discrete regions throughout the polypeptide chain (14,15). Yeast has about three dozen members of the mitochondrial metabolite carrier family (16). The Tim22 pathway probably imports all of these as well as many other integral proteins of the mitochondrial inner membrane including the import components Tim22p and Tim23p (15,17,18).
The small Tim proteins (Tim8p, Tim9p, Tim10p, Tim12p and Tim13p) are
25% identical and 4050% similar, yet Tim9p partners exclusively with Tim10p and Tim8p with Tim13p in soluble intermembrane space complexes (8,10,18,19). The small Tim proteins contain the twin CX3C motif in which two cysteine residues are separated by three amino acids (5,6). Recombinant Tim10 and Tim12 fusion proteins bind zinc, and interaction between Tim10p and AAC is inhibited by zinc chelators (9), suggesting that the small Tim proteins bind zinc and that zinc binding is required for their function in vivo. Tim9p and Tim10p bind to translocation intermediates of the mitochondrial carrier family, Tim17p and Tim22p, whereas Tim8p and Tim13p bind to Tim23p (15,17,18), suggesting that the battery of small Tim proteins may have different substrate specificities.
The small Tim proteins belong to an evolutionarily conserved protein family (5,20,21). Six members of this protein family have been identified in humansdeafness/dystonia protein 1/translocase of mitochondrial inner membrane 8a (DDP1/TIMM8a), DDP2/TIMM8b, TIMM10, TIMM9a, TIMM9b and TIMM13 (1921). Mutations in DDP1/TIMM8a cause MohrTranebjaerg syndrome/deafness-dystonia syndrome (MTS/DFN-1), a recessive, X-linked neurodegenerative disorder characterized by progressive sensorineural deafness, cortical blindness, dystonia, dysphagia and paranoia (22,23).
In this report, we show that DDP1/TIMM8a and TIMM13 assemble in a 70 kDa complex, which is identical to the partnering of Tim8p and Tim13p in yeast. The DDP1/TIMM8aTIMM13 complex restores the import of Tim23p in isolated yeast mitochondria that lack the yeast Tim8pTim13p complex and can be cross-linked to a human Tim23p translocation intermediate. In cells derived from a patient with a de novo mutation in DDP1(C66W), the DDP1/TIMM8aTIMM13 complex does not assemble. Deafness/dystonia syndrome therefore may be caused by a decrease in Tim23p import, which in turn may lead to a decreased import of other mitochondrial proteins such as proteins involved in oxidative phosphorylation.
| RESULTS |
|---|
|
|
|---|
MTS or deafness/dystonia syndrome is a recessive, X-linked neurodegenerative disorder caused by truncations or deletion in DDP1/TIMM8a (22,23). The yeast homolog, Tim8p, partners with Tim13p in a 70 kDa complex and mediates the import of Tim23p (17,18,24). Because deafness/dystonia syndrome has been identified as the first mitochondrial disease that may arise from a defective protein import machinery (19), we characterized the TIMM8a protein with respect to expression and function in liver mitochondria, fibroblasts derived from patients with deafness/dystonia syndrome, and in the heterologous model Saccharomyces cerevisiae.
Mutations previously reported in the DDP1/TIMM8a locus have been frameshift/nonsense mutations or deletions resulting in a truncated or absent protein (23). As expected, results from immunoblot analysis showed that the DDP1/TIMM8a protein was not present in fibroblasts derived from such patients (data not shown). However, the first de novo mutation in DDP1/TIMM8a, C66W, was identified in which a missense mutation changed cysteine-66 to tryptophan-66, designated TIMM8aC66W (25). This mutation occurs in the fourth cysteine of the twin CX3C motif, which is conserved among all members of the small Tim family (5,6). In contrast to the previously identified mutations, TIMM8aC66W should be a full-length protein containing the C66W mutation.
DDP1/TIMM8a and TIMM13 are partner proteins
To determine whether DDP1/TIMM8a and TIMM13 are partner proteins and assemble in a 70 kDa complex, we characterized the proteins in human fibroblasts and rat liver mitochondria. Polyclonal antibodies were generated against recombinant DDP1/TIMM8a and TIMM13. Because of the high homology between rodents and humans, the antibodies detected DDP1/TIMM8a and TIMM13, respectively, in human, rat and mouse (data not shown). Rat liver mitochondria and a human fibroblast cell line that does not contain a mutation in DDP1/TIMM8a were solubilized and subjected to immunoprecipitation with antisera monospecific for DDP1/TIMM8a and TIMM13 (Fig. 1A). The immunoprecipitate was then analyzed for TIMM8a by sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDSPAGE) and immunoblotting. In the rat liver mitochondria and fibroblasts, DDP1/TIMM8a immunoprecipitated as expected with anti-DDP1/TIMM8a and also co-immunoprecipitated with anti-TIMM13. Because entire fibroblast cells were solubilized, the signal from the fibroblast lysate was weaker than that obtained with rat liver mitochondria.
|
Fibroblast cell lines containing the C66W mutation in DDP1/TIMM8a were also analyzed to determine if DDP1/TIMM8a protein was detectable and formed a complex with TIMM13 (Fig. 1B and C). Fibroblasts cell lines derived from the patient with the TIMM8C66W as well as from a non-affected control (WT) and rat liver mitochondria were solubilized and subjected to immunoprecipitation as in Figure 1A. As expected, DDP1/TIMM8a and TIMM13 co-immunoprecipitated. TIMM8C66W and TIMM13 were not detectable in the fibroblast cell line containing the C66W mutation in contrast to the control fibroblasts. Even when over-exposed for several days, DDP1/TIMM8a and TIMM13 were not observed in the immunoprecipitate samples from C66W fibroblasts.
We also expressed DDP1/TIMM8a and TIMM13 in a yeast strain that was deleted for TIM8 and TIM13 to determine if they assembled in the mitochondrial intermembrane space as did the Tim8pTim13p complex (Fig. 1D and E). Both proteins localized to the intermembrane space (19). Upon solubilization of mitochondria and immunoprecipitation, DDP1/TIMM8a and TIMM13 co-immunoprecipitated with antibodies against either DDP1/TIMM8a or TIMM13. Taken together, DDP1/TIMM8a and TIMM13 are partner proteins. In the fibroblast cell line derived from the patient with the C66W mutation, neither DDP1/TIMM8a nor TIMM13 accumulate to levels that can be detected by immunoprecipitation experiments. A similar observation has been made in yeast mitochondria: deletion of TIM8 leads to loss of Tim13p and vice versa (19). In addition, DDP1/TIMM8a and TIMM13 assemble in a 70 kDa complex like the yeast homologs (data not shown).
That DDP1/TIMM8a and TIMM13 proteins were not detected in fibroblast cell line C66W suggested that the transcripts coding for the respective proteins might not be present. With primers to specifically amplify regions of DDP1/TIMM8a, DDP2/TIMM8b and TIMM13 as well as the control citrate synthase, the transcripts were amplified using the reverse transcriptasepolymerase chain reaction (RTPCR) technique and separated by agarose-gel electrophoresis (Fig. 2). Indeed, the mRNAs coding for DDP1/TIMM8a, DDP2/TIMM8b, TIMM13 and citrate synthase were detected in both the control and C66W fibroblast cell lines. To confirm that the putative DDP1/TIMM8a transcript was correct and not the DDP1 pseudogene (23), which also is located on the X chromosome, the PCR product was directly sequenced and identified as DDP1/TIMM8a. The transcripts coding for DDP1/TIMM8a and TIMM13 thus were present in the C66W cell line, indicating that the DDP1/TIMM8a and TIMM13 proteins may not accumulate because they do not assemble in a stable complex.
|
Yeast Tim8pC68W and Tim13p do not assemble in a 70 kDa complex
Because of the similarities between yeast and mammalian mitochondria, we made the same mutation in yeast Tim8p and characterized the mutant protein in yeast mitochondria to understand why DDP1/TIMM8a and TIMM13 proteins were not detectable in fibroblast cell line C66W. This alternative approach was used in contrast to expressing the human DDP1 and TIMM13 proteins from yeast promoters, because the yeast promoters potentially cause problems with overexpression, which may lead to mislocalization of proteins. In Tim8p, the fourth cysteine residue, cysteine-68, was mutated to tryptophan-68 and the resulting protein was designated Tim8pC68W, which replaced the wild-type protein. As with the strain deleted for TIM8 (designated
tim8), no obvious growth defects or mitochondrial dysfunction were observed (data not shown). Mitochondria were purified from the strain expressing Tim8pC68W and the parental strain and analyzed by blue native gel electrophoresis (Fig. 3A). Tim8pC68W was not detected in a 70 kDa complex, which is present in the parental strain. Further, Tim8pC68W as well as Tim13p were not detected by SDSPAGE (Fig. 3B), even when the gel was overloaded with 400 µg of mitochondrial protein. Other mitochondrial import components, Tim9p, Tim12p and Tim54p, were detected at the same level as those in wild-type mitochondria.
|
A potential reason why Tim8pC68W and Tim13p may not accumulate may be that the mutation leads to a defect in protein import, suggesting that Tim8pC68W and Tim13p are degraded in the cytosol. We therefore compared the import of radiolabeled Tim8pC68W with Tim8p into isolated mitochondria from wild-type cells (Fig. 3C). After incubation of the radiolabeled precursor with mitochondria, protease was added to remove non-imported products and the imported protein was analyzed by SDSPAGE and fluorography. As expected, the import of Tim8p and Tim8pC68W were similar. We have shown previously that the import of the small Tim proteins does not depend on the presence of a membrane potential because the Tim23 and Tim22 inner membrane complexes are not required to mediate protein import (8,19). In a control reaction, the import of the fusion protein Su9DHFR also was dependent upon a membrane potential (data not shown).
A second reason that Tim8pC68W and Tim13p may not accumulate in mitochondria is that the C68W mutation may affect the transcription of the TIM8 gene. The abundance of the Tim8C68W and Tim13 RNAs were investigated by northern analysis (Fig. 3D). Total RNA was isolated from the strain expressing Tim8pC68W, the
tim8 strain in which TIM8 was deleted, and the parental strain followed by hybridization with radiolabeled TIM8 and TIM13. The RNA transcripts coding for Tim8pC68W and Tim13p were detected in the strain expressing Tim8pC68W and the parental strain. The expression of the RNA coding for Tim8pC68W was greater than that of the endogenous Tim8p because Tim8pC68W expression was under control of the glyceraldehyde-3 dehydrogenase promoter. As expected, the TIM13 transcript but not the TIM8 transcript was detected in the
tim8 strain, which is deleted for TIM8. These results suggest that Tim8pC68W is translated and imported into yeast mitochondria but does not assemble into a stable 70 kDa complex.
The turnover rates of Tim8pC68W and TIMM8aC66W were investigated in yeast and fibroblast cells, respectively. Yeast cells expressing Tim8pC68W and the parental strain were pulsed with radiolabeled cysteine and methionine, followed by a chase (Fig. 4A). After 40 min, only 20% of the Tim8pC68W was immunoprecipitated, in contrast to Tim8p, which was stable during the entire chase time. In mutant fibroblast cell lines expressing TIMM8aC66W, a 30 min pulse with radiolabeled cysteine and methionine was followed immediately by lysis and immunoprecipitation with antibodies against TIMM8a. TIMM8aC66W was not detected in the mutant fibroblast line, whereas DDP1/TIMM8a was labeled in the control cell line (Fig. 4B). Because TIMM8aC66W was not detectable, a chase was not included; these experiments required many cells, and given that these are primary fibroblast lines, the growth time is quite slow. The mutation in the fourth cysteine residue thus yields a protein that has an increased turnover rate in both yeast and fibroblast cells.
|
DDP1/TIMM8a and TIMM13 mediate the import of hTim23p into isolated mitochondria
Yeast Tim8p and Tim13p enhance the import of yeast Tim23p and both can be cross-linked to a Tim23p translocation intermediate (17,18,24). Given the similarity between yeast and mammalian mitochondria, DDP1/TIMM8a and TIMM13 may mediate the import of Tim23p. We therefore investigated the import of yeast Tim23p into yeast mitochondria expressing the human DDP1/TIMM8aTIMM13 complex instead of the yeast Tim8pTim13p complex (Fig. 5). Import assays were completed with protease treatment to remove non-imported Tim23p and carbonate extraction to confirm that the imported Tim23p was inserted into the inner membrane (Fig. 5A). The import of the yeast Tim23p precursor was decreased by 74% into mitochondria that lacked the Tim8pTim13p complex as shown previously (17). However, import in mitochondria with the DDP1/TIMM8aTIMM13 complex was restored to 70% of import in wild-type mitochondria. Inhibition of Tim23p import in the absence of a membrane potential was difficult as reported previously (17,18,24). In addition, we also confirmed that Tim23p was inserted into the inner membrane by converting isolated mitochondria into mitoplasts by disruption of the outer membrane with osmotic shock (Fig. 5B). In the presence of protease in mitoplasts, a 14 kDa fragment of Tim23p is protected from degradation by the inner membrane. The abundance of the protease-resistant Tim23p fragment was quantitated by scanning laser densitometry; the levels were identical for wild-type mitochondria and mitochondria expressing DDP1/TIMM8aTIMM13 and decreased by 75% in mitochondria lacking the Tim8pTim13p complex.
|
The abundance of hTim23p and the matrix heat shock protein 60 (Hsp60) was analyzed by immunoprecipitation from detergent-solubilized C66W fibroblasts and a control (Fig. 5C). The abundance of hTim23p and control Hsp60 was identical in both fibroblast lines. This result is not surprising because deafness/dystonia syndrome affects neural tissue and the fibroblasts contain the DDP2 transcript and thus may express the DDP2 protein, which may mediate the import of hTim23p.
When radiolabeled Tim23p is imported into isolated uncoupled mitochondria, it accumulates in the intermembrane space in association with the Tim8pTim13p complex and can be cross-linked to Tim8p and Tim13p with a bifunctional cross-linking reagent (17,18,24). We used this approach to investigate if the DDP1/TIMM8aTIMM13 complex bound directly to the human Tim23 precursor during import in yeast and rat liver mitochondria (Fig. 6). We imported the hTim23p precursor into uncoupled mitochondria containing the DDP1/TIMM8aTIMM13 complex, treated the mitochondria with the cross-linker m-maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), solubilized the mitochondria with SDS, subjected the extract to immunoprecipitation with antibodies against DDP1/TIMM8a, TIMM13, or yeast Tim10p and analyzed the immunoprecipitates by SDSPAGE and fluorography (Fig. 6A). Antibodies against DDP1/TIMM8a and TIMM13 precipitated radiolabeled cross-linked hTim23p products. Antibodies against Tim10p also precipitated hTim23p in these mitochondria. Davis et al. (18) previously reported cross-links between yeast Tim23p and Tim10p. In rat liver mitochondria, antibodies against DDP1/TIMM8a and TIMM13 also precipitated radiolabeled cross-linked hTim23p products (Fig. 6B). DDP1/TIMM8a and TIMM13 thus mediate the import of hTim23p.
|
Fibroblasts derived from patients with deafness/dystonia syndrome are not energetically compromised
Metabolic activity and mitochondrial morphology of fibroblasts cell lines derived from patients with mutations in the DDP1/TIMM8a locus were characterized. Results from general enzymatic assays (26) to characterize the activity of complexes IIV did not differ significantly between patients and control cell lines (data not shown). In addition, mitochondrial morphology was not significantly different when investigated by electron microscopy (data not shown). It has been shown that Tim23p import into mitochondria is affected by differences in the mitochondrial electrochemical gradient (24). We measured the mitochondrial membrane potential in digitonin-permeabilized fibroblasts by quantitating the accumulation of the radiolabeled lipophilic cation methyltriphenylphosphonium (TPMP) (27). Once again, significant differences in mitochondrial membrane potential were not observed in fibroblast cell lines derived from deafness/dystonia patients in comparison with cell lines derived from unaffected individuals (data not shown). Attempts to identify a difference in mitochondrial function thus were not successful, but this may be reflected by the fact that fibroblast cell lines are a quiescent cell type in contrast to muscular and neural tissue (26,27) or alternatively, the DDP2 protein may substitute for DDP1 in fibroblasts.
| DISCUSSION |
|---|
|
|
|---|
To characterize the function of DDP1/TIMM8a and TIMM13, we have used the model system S.cerevisiae as well as mammalian mitochondria, and fibroblast cell lines derived from patients with deafness/dystonia syndrome, which contain mutations in the DDP1/TIMM8a locus. The following similarities exist between mammalian DDP1/TIMM8a and TIMM13 and yeast Tim8p and Tim13p. Tim8 and Tim13 are partner proteins and assemble in a 70 kDa complex. Both proteins require each other for stability. In fibroblast cell lines with the C66W mutation, the DDP1/TIMM8aTIMM13 complex was not detectable, even in metabolic labeling experiments, although transcripts for both proteins were detected. A similar mutation in yeast Tim8p, Tim8pC68W, resulted in a mutant protein that could be imported into mitochondria but was not able to assemble in a 70 kDa complex (Fig. 3). Instead, mitochondrial proteases most likely degraded the unassembled polypeptides (28).
The DDP1/TIMM8aTIMM13 complex mediates the import of Tim23p as shown by in vitro protein import assays and cross-linking experiments. The import of Tim23p was decreased by
75% in mitochondria lacking the Tim8pTim13p complex. Yet when the DDP1/TIMM8aTIMM13 replaced the yeast complex, the import of Tim23p was restored to levels near wild-type. Similar observations were reported with the yeast Tim8pTim13p complex (17). Lowering the membrane potential enough to inhibit import of Tim23p was difficult. Paschen et al. (24) have shown that the import of yeast Tim23p is only decreased 2-fold in the presence of a low membrane potential.
Further, DDP1/TIMM8a and TIMM13 were cross-linked specifically to human Tim23p in rat liver and yeast mitochondria, indicating that both proteins bind to the arrested Tim23p translocation intermediate. It also is interesting that yTim10p was cross-linked to human Tim23p. In previous studies with wild-type mitochondria and mitochondria deleted for the Tim8pTim13p complex, we have shown that yeast Tim23p translocation intermediate cross-linked to Tim10p is barely detectable (17). However, Davis et al. (18) have also reported abundant cross-links between yeast Tim23p and Tim9p and Tim10p. The observed differences between Tim23p cross-linking to Tim10p could result from differences in the relative positions of the residues involved in forming the cross-link. Tim23p from human and yeast have different sequences; the position and the numbers of the lysine and cysteine residues may favor increased cross-linking with human Tim23p. Alternatively, the abundance of the Tim9pTim10p complex may be increased in mitochondria containing the DDP1/TIMM8aTIMM13 complex, which might result in an increased efficiency in cross-linking.
Results from our study agree with those recently published by Rothbauer et al. (29). In addition, results from their experiments show that DDP1/TIMM8a and TIMM13 coordinate zinc and that the additional small Tim proteins are located to the intermembrane space of HeLa cells.
Deafness/dystonia syndrome is caused by an unassembled DDP1/TIMM8aTIMM13 complex and is the first example of a defect in protein import leading to a disease. A decreased rate of Tim23p import may be the underlying mechanism (24). Because Tim23p mediates the import of proteins to the matrix, a decrease in Tim23p could lead indirectly to a decrease in oxidative phosphorylation and energy production. However, it also is plausible that other unidentified substrates may be present at decreased levels. Given that Tim23p is an essential protein for viability in yeast, it is surprising that deafness/dystonia syndrome only affects neural tissues, particularly the basal ganglia, optic nerve and hair cells of the ear (22,23).
In the medical field, advances have been made with the diagnosis of deafness/dystonia syndrome. New cases have been identified recently (30,31), all of which are caused by small deletions or frameshifts, most likely leading to loss-of-function mutations. In addition, females show symptoms of deafness/dystonia syndrome later in life, with a de novo case recently being identified (31). Studies by Plenge et al. (32) report that the expression pattern of DDP1 is altered by skewed X chromosome inactivation. In a patient with a loss-of-function mutation in DDP1, analysis of the temporal bone histopathology revealed that there was near complete loss of spiral ganglion cells and loss of nearly all peripheral and central processes (33). However, the organ of Corti, hair cells, stria vascularis and spiral ligament were preserved.
Deafness/dystonia syndrome is unlike many mitochondrial diseases that have pleiotropic affects on both neural and muscular tissues (34). However, neural, muscle and fibroblast mitochondria may contain different small Tim complexes such as DDP2/TIMM13 that mediate the import of Tim23p or other inner membrane substrates. Given the recent identification of new deafness/dystonia cases, diseases linked with additional mitochondrial import components also may be identified.
Although studies with yeast mitochondria and fibroblast cell lines have answered fundamental questions about the mechanism of protein translocation and present a foundation to base future experiments, there are obvious shortcomings. Questions such as why the symptoms are primarily deafness, dystonia and blindness in contrast to the symptoms of other mitochondrial diseases that affect both muscular and nervous tissue (34) and what inner membrane substrates might be present at decreased levels in affected tissues in deafness/dystonia syndrome patients cannot be answered with single-cell models.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Tissue culture and fibroblast cell lines
Human fibroblast cells were grown at 37°C in Medium 199 with Earles Salts supplemented with 10% heat-inactivated fetal bovine serum (Life Technologies), 100 U/ml penicillin (Life Technologies) and 100 µg/ml streptomycin (Life Technologies) with 5% CO2. The fibroblast cell line C66W was derived from a patient with a de novo mutation in the DDP1/TIMM8a locus that resulted in cysteine-66 being changed to tryptophan-66 (25). Control fibroblast cell lines were derived from non-affected individuals. Cell lines were matched as closely as possible for age and passage. Five to seven independent control fibroblast cell lines were examined.
Plasmids and strains
For in vitro transcription/translation, the DNA fragment coding Tim23p (35) was subcloned into pGEM3Z (Promega). The hTim23 gene was amplified by PCR using the 5' primer GGGGATTTAGGTGACACTATAGAAGAGCTATGGAAGGAGGCGGGGGA and the 3' primer GCTAGTTATTGCTCAGCGG. The 5' primer introduced a SP6 promoter region upstream of the Tim23 start codon. The PCR product was gel purified and used directly for in vitro transcription. The gene coding for yeast Tim8pC68W was amplified by PCR from plasmid yTim8(C68W)-pET28a using the 5' primer prSP6-TIM8, 5'-GGGGATTTAGGTGACACTATAGAAGAGCTATGTCTTCTCGAGCAACGT-3' and the 3' primer prDDP1-4, 5'-GCCCGTCGACACTAGACAGTATATAAACAA-3'. The 5' primer introduced a SP6 promoter region upstream of the Tim8pC68W start codon. DDP1/TIMM8a and TIMM13 were subcloned as BamHI/SalI fragments into yeast expression vectors pRS424GPD (2 µl TRP1) and pRS425GPD (2 µl LEU2), respectively, between the glyceraldehyde-3-P dehydrogenase promoter and the phosphoglycerate kinase terminator (36). The resulting plasmids were transformed into a yeast strain deleted for TIM8 and TIM13.
The fourth cysteine, cysteine-68, of the twin CX3C motif in yeast Tim8p was mutated to tryptophan-68 and designated Tim8pC68W; this mutation was identical to the C66W mutation in DDP1/TIMM8a in the fibroblast cell line derived from a patient with deafness/dystonia syndrome. Site-directed mutagenesis was performed using QuickChange (Stratagene) according to the manufacturers protocol. Specifically, the primers for substitution C68W were: 5' primer prTim8(C68W)-1, 5'-GAGCAATGTTTGTCTAACTGGGTGAATCGGTTTTTGGAT-3' and 3' primer prTim8(C68W)-2, 5'-ATCCAAAAACCGATTCACCCAGTTAGACAAACATTGCTC-3'. The mutation was confirmed by sequencing. The mutated TIM8 gene coding for Tim8pC68W was subcloned into a yeast integrative plasmid pRS305GPD-PGK (36). The plasmid was linearized with DraIII (New England Biolabs) and transformed into strain yCK54 (
tim8::HIS3) to create strain ySC2. Strain ySC2 expressed Tim8pC68W instead of Tim8p. Standard conditions were used for the growth, manipulation and transformation of yeast strains (37,38).
Measurement of DDP1/TIMM8a, DDP2 and TIMM13 transcript levels
Total RNA was isolated from human fibroblast cell lines derived from the patient containing the C66W mutation and from control cell lines using TRIZOL reagent (Life Technologies) according to the manufacturers protocol. Expression of DDP1/TIMM8a, DDP2/TIMM8b and TIMM13 transcripts was measured by coupled reverse transcription and PCR amplification (RTPCR) using the Access RTPCR kit (Promega). The 5' primers used were 5'-CTCCTCTTCCTCCGCGGC-3', 5'-ATGGCGGAGCTGGGCGAA-3' and 5'-ATGGAGGGCGGCTTCGG-3'; and the 3' primers were 5'-TTCATCTTGAATCGACTGGAA-3', 5'-CTACTGCCCTCCTTTCTGTA-3' and 5'-TCACATGTTGGCTCGTTCC-3' for the amplification of DDP1/TIMM8a, DDP2/TIMM8b and TIMM13, respectively. As a control, human citrate synthase was amplified from human fibroblast cells using the 5' primer, 5'-ATGGCTTTACTTACTGCGGC-3' and the 3' primer , 5'-TGTTGGGATATGTCCAGTTAC-3'. The amplification gave single products with the correct sizes (235 bp for the DDP1/TIMM8a fragment, 252 bp for DDP2/TIMM8b, 288 bp for TIMM13, and 391 bp for human citrate synthase). An RTPCR reaction with a positive control RNA and 5'- and 3'-control primers generated a 324 bp product.
Metabolic labeling studies
For the analysis of yeast Tim8pC66W, log-phase cultures were concentrated to 2 x 107 cells/ml and labeled with 50 µCi of [35S]methionine and [35S]cysteine Trans 35S-label (NEN Life Sciences Products, Inc.) per 1 x 107 cells for 10 min in synthetic dextrose media supplemented with all amino acids except methionine and cysteine. Cells were then incubated with 5 mM methionine, 5 mM cysteine and 0.2% yeast extract for a chase time of up to 40 min. Cells were lysed with glass beads and radioactive lysates were immunoprecipitated (8) with antisera against Tim8p. Bound proteins were separated by SDSPAGE and analyzed by fluorography.
For analysis of DDP1/Timm8a in primary fibroblast cultures, adherent cells from the control and cell line C68W were grown to 80% confluency. Approximately 2 x 107 cells were incubated with DMEM containing 100 µCi/ml [35S]methionine and [35S]cysteine, Trans 35S-label for 30 min at 37°C, 5% CO2. After labeling, cells were washed with phosphate-buffered saline and lysed in 0.2 M sucrose, 100 mM NaCl, 1 mM EDTA, 1 mM PMSF, 20 mM HEPES pH 7.4, 0.16% n-dodecyl maltoside. Radioactive lysates were immunoprecipitated with antisera against DDP1. Bound proteins were separated by SDSPAGE and analyzed by fluorography.
Import of radiolabeled proteins into isolated mitochondria
Mitochondria were purified from lactate-grown yeast cells (39) and assayed for in vitro protein import as described (40) and purified from rat liver mitochondria as described (41). Proteins were synthesized in a rabbit reticulocyte lysate in the presence of [35S]methionine after in vitro transcription of the corresponding gene by SP6- or T7-polymerase. The reticulocyte lysate containing the radiolabeled precursor was incubated with isolated mitochondria at the indicated temperatures in import buffer (1 mg/ml bovine serum albumin, 0.6 M sorbitol, 150 mM KCl, 10 mM MgCl2, 2.5 mM EDTA, 2 mM ATP, 2 mM NADH, 20 mM K+-HEPES pH 7.4). Where indicated, the potential across the mitochondrial inner membrane was dissipated with 1 µM valinomycin. Non-imported radiolabeled proteins were removed by treatment with 100 µg/ml trypsin for 15 to 30 min on ice; trypsin was inhibited with 200 µg/ml soybean trypsin inhibitor. For alkali extraction, mitochondria from an import reaction were sedimented by centrifugation, suspended to 0.1 mg/ml in 100 mM Na2CO3, and incubated for 30 min at 4°C (42). Supernatant and pellet were separated by centrifugation at 100 000 g for 15 min. Osmotic shock experiments were performed as described previously (7).
The hTim23p translocation intermediate was cross-linked to adjacent proteins with 0.1 mM MBS. The cross-linking protocol was as described (7,8). For immunoprecipitation, solubilized mitochondria were incubated with the corresponding monospecific rabbit IgGs coupled to protein ASepharose (43).
Blue native gel electrophoresis
Mitochondria or fibroblast cell lines (2.5 mg/ml) were solubilized in 20 mM K+-HEPES pH 7.4, 50 mM NaCl, 10% glycerol, 2.5 mM MgCl2, 1 mM EDTA, 0.16% n-dodecyl maltoside for 30 min on ice. Insoluble material was removed by centrifugation at 100 000 g for 10 min, and the solubilized proteins were analyzed by blue-native gel electrophoresis on a 616% linear polyacrylamide gradient (8,4446).
Miscellaneous
RNA extraction from yeast and RNA blot analysis with oligonucleotide probes were as described previously (47). To generate polyclonal antibodies, cDNAs for DDP1/TIMM8a and TIMM13 were expressed in Escherichia coli with a hexa-histidine tag. Following purification, tagged proteins were used to raise monospecific antisera in rabbits by standard procedures. Mouse anti-hTim23 was purchased from BD Biosciences. Co-immunoprecipitation assays (8) were done as described previously. Mitochondrial membrane potential was determined by the uptake of the lipophilic cation triphenylmethylphosphonium (TPMP) (48). Enzymatic assays to measure complex IIV activity were done as described previously (26,27). Protein concentration was assayed by the bicinchoninic acid method using bovine serum albumin as the standard.
| ACKNOWLEDGEMENTS |
|---|
We thank Christina Jordan for establishing tissue culture techniques and maintaining cell lines, Danielle Leuenberger for generation of antibodies and database searches, El-Khansa Kaicer for maintaining cell lines and Ann Lu for constructing the DDP1/TIMM8a and TIMM13 plasmids for expression in yeast. We are grateful to Dr Michael Murphy (MRC Dunn Institute of Nutrition, UK), Dr Jan Smeitink and his research group (University of Nijmegen, The Netherlands) and David Hwang, Dr Einhard Schmidt and Dr Peter Hynds for helpful discussions. C.M.K. is a Damon Runyon-Walter Winchell Scholar. This work was supported by funds from the Damon Runyon-Walter Winchell Cancer Research Foundation (DRS18); the Burroughs Wellcome Fund New Investigator Award in the Toxicological Sciences (1001120); the Cancer Research Fund, under Intragency Agreement 97-12013 (University of California, Davis contract 98-0024V) with the Department of Health Services, Cancer Research Section; the Muscular Dystrophy Association (022398) and the Deafness Research Foundation. S.P.C. is supported by the USPHS National Research Service Award (GM07185).
| FOOTNOTES |
|---|
+ To whom correspondence should be addressed. Tel: +1 310 794 4834; Fax: +1 310 206 4038; Email: koehler@chem.ucla.edu
| REFERENCES |
|---|
|
|
|---|
1 Ryan,K.R. and Jensen,R.E. (1995) Protein translocation across mitochondrial membranes: what a long, strange trip it is. Cell, 83, 517519.[ISI][Medline]
2 Schatz,G. and Dobberstein,B. (1996) Common principles of protein translocation across membranes. Science, 271, 15191526.[Abstract]
3 Neupert,W. (1997) Protein import into mitochondria. Annu. Rev. Biochem., 66, 863917.[ISI][Medline]
4 Pfanner,N. (1998) Mitochondrial import: crossing the aqueous intermembrane space. Curr. Biol., 8, R262R265.[ISI][Medline]
5 Koehler,C.M., Merchant,S. and Schatz,G. (1999) How membrane proteins travel across the mitochondrial intermembrane space. Trends Biochem. Sci., 24, 428432.[ISI][Medline]
6 Bauer,M.F., Hofmann,S., Neupert,W. and Brunner,M. (2000) Protein translocation into mitochondria: the role of TIM complexes. Trends Cell Biol., 10, 2531.[ISI][Medline]
7
Koehler,C.M., Jarosch,E., Tokatlidis,K., Schmid,K., Schweyen,R.J. and Schatz,G. (1998) Import of mitochondrial carriers mediated by essential proteins of the intermembrane space. Science, 279, 369373.
8 Koehler,C.M., Merchant,S., Oppliger,W., Schmid,K., Jarosch,E., Dolfini,L., Junne,T., Schatz,G. and Tokatlidis,K. (1998) Tim9p, an essential partner subunit of Tim10p for the import of mitochondrial carrier proteins. EMBO J., 17, 64776486.[ISI][Medline]
9 Sirrenberg,C., Endres,M., Folsch,H., Stuart,R.A., Neupert,W. and Brunner,M. (1998) Carrier protein import into mitochondria mediated by the intermembrane proteins Tim10/Mrs11 and Tim12/Mrs5. Nature, 391, 912915.[Medline]
10 Adam,A., Endres,M., Sirrenberg,C., Lottspeich,F., Neupert,W. and Brunner,M. (1999) Tim9, a new component of the TIM22.54 translocase in mitochondria. EMBO J., 18, 313319.[ISI][Medline]
11
Kerscher,O., Holder,J., Srinivasan,M., Leung,R.S. and Jensen,R.E. (1997) The Tim54p-Tim22p complex mediates insertion of proteins into the mitochondrial inner membrane. J. Cell Biol., 139, 16631675.
12
Koehler,C.M., Murphy,M.P., Bally,N., Leuenberger,D., Oppliger,W., Dolfini,L., Junne,T., Schatz,G. and Or,E. (2000) Tim18p, a novel subunit of the inner membrane complex that mediates protein import into the yeast mitochondrial inner membrane. Mol. Cell. Biol., 20, 11871193.
13
Kerscher,O., Sepuri,N.B. and Jensen,R.E. (2000) Tim18p is a new component of the Tim54p-Tim22p translocon in the mitochondrial inner membrane. Mol. Biol. Cell., 11, 103116.
14
Pfanner,N. and Neupert,W. (1987) Distinct steps in the import of ADP/ATP carrier into mitochondria. J. Biol. Chem., 262, 75287536.
15 Endres,M., Neupert,W. and Brunner,M. (1999) Transport of the ADP/ATP carrier of mitochondria from the TOM complex to the TIM22.54 complex. EMBO J., 18, 32143221.[ISI][Medline]
16 Palmieri,F., Bisaccia,F., Capobianco,L., Dolce,V., Fiermonte,G., Iacobazzi,V., Indiveri,C. and Palmieri,L. (1996) Mitochondrial metabolite transporters. Biochim. Biophys. Acta, 1275, 127132.[Medline]
17 Leuenberger,D., Bally,N.A., Schatz,G. and Koehler,C.M. (1999) Different import pathways through the mitochondrial intermembrane space for inner membrane proteins. EMBO J., 17, 48164822.
18
Davis,A.J., Sepuri,N.B., Holder,J., Johnson,A.E. and Jensen,R.E. (2000) Two intermembrane space TIM complexes interact with different domains of Tim23p during its import into mitochondria. J. Cell Biol., 150, 12711282.
19
Koehler,C.M., Leuenberger,D., Merchant,S., Renold,A., Junne,T. and Schatz,G. (1999) Human deafness dystonia syndrome is a mitochondrial disease. Proc. Natl Acad. Sci. USA, 96, 21412146.
20 Bauer,M.F., Rothbauer,U., Muhlenbein,N., Smith,R.J., Gerbitz,K., Neupert,W., Brunner,M. and Hofmann,S. (1999) The mitochondrial TIM22 preprotein translocase is highly conserved throughout the eukaryotic kingdom. FEBS Lett., 464, 4147.[ISI][Medline]
21 Jin,H., Kendall,E., Freeman,T.C., Roberts,R.G. and Vetrie,D.L.P. (1999) The human family of deafness/dystonia peptide (DDP) related mitochondrial import proteins. Genomics, 61, 259267.[ISI][Medline]
22 Tranebjaerg,L., Schwartz,C., Eriksen,H., Andreasson,S., Ponjavic,V., Dahl,A., Stevenson,R.E., May,M., Arena,F., Barker,D. et al. (1995) A new X linked recessive deafness syndrome with blindness, dystonia, fractures, and mental deficiency is linked to Xq22. J. Med. Genet., 32, 257263.[Abstract]
23 Jin,H., May,M., Tranebjaerg,L., Kendall,E., Fontan,G., Jackson,J., Subramony,S.H., Arena,F., Lubs,H., Smith,S. et al. (1996) A novel X-linked gene, DDP, shows mutations in families with deafness (DFN-1), dystonia, mental deficiency and blindness. Nat. Genet., 14, 177180.[ISI][Medline]
24 Paschen,S.A., Rothbauer,U., Kaldi,K., Bauer,M.F., Neupert,W. and Brunner,M. (2000) The role of the TIM8-13 complex in the import of Tim23 into mitochondria. EMBO J., 19, 63926400.[ISI][Medline]
25 Tranebjaerg,L., Hamel,B.C., Gabreels,F.J., Renier,W.O. and Van Ghelue,M. (2000) A de novo missense mutation in a critical domain of the X-linked DDP gene causes the typical deafness-dystonia-optic atrophy syndrome. Eur. J. Hum. Genet., 8, 464467.[ISI][Medline]
26 James,A.M., Sheard,P.W., Wei,Y.H. and Murphy,M.P. (1999) Decreased ATP synthesis is phenotypically expressed during increased energy demand in fibroblasts containing mitochondrial tRNA mutations. Eur. J. Biochem., 259, 462469.[ISI][Medline]
27 Appleby,R.D., Porteous,W.K., Hughes,G., James,A.M., Shannon,D., Wei,Y.H. and Murphy,M.P. (1999) Quantitation and origin of the mitochondrial membrane potential in human cells lacking mitochondrial DNA. Eur. J. Biochem., 262, 108116.[ISI][Medline]
28 Van Dyck,L. and Langer,T. (1999) ATP-dependent proteases controlling mitochondrial function in the yeast Saccharomyces cerevisiae. Cell. Mol. Life Sci., 56, 825842.
29
Rothbauer,U., Hofmann,S., Muhlenbein,N., Paschen,S.A., Gerbitz,K.D., Neupert,W., Brunner,M. and Bauer,M.F. (2001) Role of the deafness dystonia peptide 1 (DDP1) in import of human Tim23 into the inner membrane of mitochondria. J. Biol. Chem., 276, 3732737334.
30
Ujike,H., Tanabe,Y., Takehisa,Y., Hayabara,T. and Kuroda,S. (2001) A family with X-linked dystonia-deafness syndrome with a novel mutation of the DDP gene. Arch. Neurol., 58, 10041007.
31 Swerdlow,R.H. and Wooten,G.F. (2001) A novel deafness/dystonia peptide gene mutation that causes dystonia in female carriers of MohrTranebjaerg syndrome. Ann. Neurol., 50, 537540.[ISI][Medline]
32 Plenge,R.M., Tranebjaerg,L., Jensen,P.K.A., Schwartz,C. and Willard,H.F. (1999) Evidence that mutation in the X-linked DDP gene cause incompletely penetrant and variable skewed X inactivation. Am. J. Hum. Genet., 64, 759767.[ISI][Medline]
33 Merchant,S.N., McKenna,M.J., Nadol,J.B., Kristiansen,A.G., Tropitzsch,A., Lindal,S. and Tranebjaerg,L. (2001) Temporal bone histopathologic and genetic studies in MohrTranebjaerg syndrome (DFN-1). Otol. Neurotol., 22, 506511.[ISI][Medline]
34
Wallace,D.C. (1999) Mitochondrial diseases in man and mouse. Science, 283, 14821488.
35 Haucke,V. and Schatz,G. (1997) Reconstitution of the protein insertion machinery of the mitochondrial inner membrane. EMBO J., 16, 45604567.[ISI][Medline]
36 Schena,M., Picard,D. and Yamamoto,K.R. (1991) Vectors for constitutive and inducible gene expression in yeast. Methods Enzymol., 194, 389398.[ISI][Medline]
37 Geitz,R.D. and Schiestl,R.H. (1991) Applications of high efficiency lithium acetate transformation of intact yeast cells using single-stranded nucleic acids as carrier. Yeast, 7, 253263.[ISI][Medline]
38 Guthrie,C. and Fink,G.R. (1991) Guide to Yeast Genetics and Molecular Biology. Academic Press, San Diego, CA.
39 Glick,B.S. and Pon,L. (1995) Isolation of highly purified mitochondria from S.cerevisiae. Methods Enzymol., 260, 213233.[ISI][Medline]
40 Rospert,S. and Schatz,G. (1998) Protein translocation into mitochondria. In Celis,J.E. (ed.), Cell Biology: A Laboratory Handbook, 2nd edn. Academic Press, San Diego, Vol. 2, pp. 277285.
41
Ishihara,N. and Mihara,K. (1998) Identification of the protein import components of the rat mitochondrial inner membrane, rTIM17, rTIM23, and rTIM44. J. Biochem., 123, 722732.
42
Fujiki,Y., Hubbard,A.L., Fowler,S. and Lazarow,P.B. (1982) Isolation of intracellular membranes by means of sodium carbonate treatment: application to endoplasmic reticulum. J. Cell Biol., 93, 97102.
43
Rospert,S., Muller,S., Schatz,G. and Glick,B.S. (1994) Fusion proteins containing the cytochrome b2 presequence are sorted to the mitochondrial intermembrane space independently of hsp60. J. Biol. Chem., 269, 1727917288.
44 Schägger,H. and von Jagow,G. (1991) Blue native electrophoresis for isolation of membrane protein complexes in enzymatically active form. Anal. Biochem., 199, 223231.[ISI][Medline]
45 Schägger,H., Cramer,W.A. and von Jagow,G. (1994) Analysis of molecular masses and oligomeric states of protein complexes by blue native electrophoresis and isolation of membrane protein complexes by two-dimensional native electrophoresis. Anal. Biochem., 217, 220230.[ISI][Medline]
46 Dekker,P.J., Muller,H., Rassow,J. and Pfanner,N. (1996) Characterization of the preprotein translocase of the outer mitochondrial membrane by blue native electrophoresis. Biol. Chem., 377, 535538.[ISI][Medline]
47 Chanfreau,G., Rotondo,G., Legrain,P. and Jacquier,A. (1998) Processing of a dicistronic small nucleolar RNA precursor by the RNA endonuclease Rnt1. EMBO J., 17, 37263737.[ISI][Medline]
48 Renold,A., Koehler,C.M. and Murphy,M.P. (2000) Mitochondrial import of the long and short isoforms of human uncoupling protein 3. FEBS Lett., 465, 135140.[ISI][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
H. K. Anandatheerthavarada and L. Devi Amyloid Precursor Protein and Mitochondrial Dysfunction in Alzheimer's Disease Neuroscientist, December 1, 2007; 13(6): 626 - 638. [Abstract] [PDF] |
||||
![]() |
R. McFarland, P. F. Chinnery, E. L. Blakely, A. M. Schaefer, A.A.M. Morris, S. M. Foster, H. A.L. Tuppen, V. Ramesh, P. J. Dorman, D. M. Turnbull, et al. Homoplasmy, heteroplasmy, and mitochondrial dystonia Neurology, August 28, 2007; 69(9): 911 - 916. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. E. Gentle, A. J. Perry, F. H. Alcock, V. A. Likic, P. Dolezal, E. T. Ng, A. W. Purcell, M. McConnville, T. Naderer, A.-L. Chanez, et al. Conserved Motifs Reveal Details of Ancestry and Structure in the Small TIM Chaperones of the Mitochondrial Intermembrane Space Mol. Biol. Evol., May 1, 2007; 24(5): 1149 - 1160. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Herrmann and R. Kohl Catch me if you can! Oxidative protein trapping in the intermembrane space of mitochondria J. Cell Biol., February 26, 2007; 176(5): 559 - 563. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Satrustegui, B. Pardo, and A. del Arco Mitochondrial Transporters as Novel Targets for Intracellular Calcium Signaling Physiol Rev, January 1, 2007; 87(1): 29 - 67. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-W. Chen, R. N. Rainey, C. E. Balatoni, D. W. Dawson, J. J. Troke, S. Wasiak, J. S. Hong, H. M. McBride, C. M. Koehler, M. A. Teitell, et al. Mammalian Polynucleotide Phosphorylase Is an Intermembrane Space RNase That Maintains Mitochondrial Homeostasis Mol. Cell. Biol., November 15, 2006; 26(22): 8475 - 8487. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Burri, Y. Strahm, C. J. Hawkins, I. E. Gentle, M. A. Puryer, A. Verhagen, B. Callus, D. Vaux, and T. Lithgow Mature DIABLO/Smac Is Produced by the IMP Protease Complex on the Mitochondrial Inner Membrane Mol. Biol. Cell, June 1, 2005; 16(6): 2926 - 2933. [Abstract] [Full Text] |

8) and human TIMM13 (

). After import, samples were treated with trypsin to remove non-imported precursor and stopped with soybean trypsin inhibitor. As a control, Tim8p was imported. Samples were analyzed by SDSPAGE and fluorography. STD (standard) refers to 10% of the radioactive precursor added to each assay. (D) Total RNA was isolated from the strain expressing Tim8pC68W, a strain deleted for TIM8 (








