Human Molecular Genetics, 2002, Vol. 11, No. 5 547-558
© 2002 Oxford University Press
Identification of an IMPDH1 mutation in autosomal dominant retinitis pigmentosa (RP10) revealed following comparative microarray analysis of transcripts derived from retinas of wild-type and Rho/ mice
1The Ocular Genetics Unit, Department of Genetics, Trinity College, Dublin 2, Ireland, 2University of Szeged, Szeged, Hungary, 3Department of Ophthalmology, The Queens University of Belfast, Belfast, UK, 4Molecular Diagnostic Laboratory, Department of Clinical Biochemistry, Aarhus University Hospital, Brendstrupgaardsvej, DK-8200 Aarhus N/Skejby, Denmark and 5Fundacion Jimenez Diaz, Clinica de Nuestra Senora de la Concepcion, Avda de los Reyes Catolicos 2 (Ciudad Universitaria), 28040 Madrid, Spain
Received November 12, 2001; Revised December 20, 2001; Accepted January 3, 2002.
| ABSTRACT |
|---|
|
|
|---|
Comparative analysis of the transcriptional profiles of approximately 6000 genes in the retinas of wild-type mice with those carrying a targeted disruption of the rhodopsin gene was undertaken by microarray analysis. This revealed a series of transcripts, of which some were derived from genes known to map at retinopathy loci, levels of which were reduced or elevated in the retinas of Rho/ mice lacking functional photoreceptors. The human homologue of one of these genes, encoding inosine monophosphate dehydrogenase type 1 (IMPDH1), maps to the region of 7q to which an adRP gene (RP10) had previously been localized. Mutational screening of DNA from the Spanish adRP family, originally used to localize the RP10 gene, revealed an Arg224Pro substitution co-segregating with the disease phenotype. The amino acid at position 224 of the IMPDH1 protein is conserved among species and the substitution is not present in healthy, unrelated individuals of European origin. These data provide strong evidence that mutations within the IMPDH1 gene cause adRP, and validate approaches to mutation detection involving comparative analysis of global transcription profiles in normal and degenerating retinal tissues. Other genes showing significant alterations in expression include some with anti-apoptotic functions and many encoding components of the extracellular matrix or cytoskeleton, a possible reflection of a response by Muller cells to preserve the remaining outer nuclear layer of the retina. We suggest that those genes identified are prime candidates for etiological involvement in degenerative retinal disease.
| INTRODUCTION |
|---|
|
|
|---|
The human retina consists of approximately 100 million photoreceptors linked via a series of secondary retinal neurones (horizontal, bipolar, amacrine and interplexiform cells) to approximately 3 million output neurones, or ganglion cells, the axons of which constitute the optic nerve (1). Hereditary neuroretinopathies involving death of photoreceptor cells (rod, cone, rodcone or conerod dystrophies) and of ganglion cells (optic atrophies) cause visual handicap in young and middle aged people, probably affecting about 2 million people globally (2).
In retinopathies primarily involving degeneration of rod photoreceptors, including retinitis pigmentosa (RP), syndromes incorporating RP (Usher syndrome and BardetBiedl syndrome) and Leber congenital amaurosis (a congenital form of retinal degeneration), up to 30 genes have been implicated in disease pathology (http://www.sph.uth.tmc.edu/Retnet/). Such proteins include components of the visual transduction cycle, structural components of the rod and/or cone photoreceptor outer segment disc membranes, components of the retinoid cycle, transcription factors (including CRX and NRL), components of the cytoskeleton and extracellular matrices, splicing factors and, in one instance, a protein involved in circadian shedding of the outer segment discs of the photoreceptors into the pigmented epithelial layer (http://www.retina-international.com).
With respect to adRP specifically, the majority of mutations identified to date occur in genes encoding proteins expressed in photoreceptor cells. These include rhodopsin (3), peripherin/RDS (4,5), ROM1 (6), conerod homeo box-containing (CRX) gene (7), NRL (8), RP1 (9) and the retinal fascin gene (FSCN2) (10). In addition, mutations within two genes, PRPC8 and PRPF31, encoding mRNA splicing factors have also been implicated in adRP (11,12). This is of particular significance in the context of the current report, in that PRPC8 and PRPF31 are expressed systemically, as opposed to other adRP genes, the expression of which is confined to photoreceptor cells.
Previous genetic linkage studies performed at this laboratory resulted in the mapping of an autosomal dominant RP (adRP) gene to the long arm of chromosome 7 (RP10) (13). The investigation involved a genome-wide search using DNA from 45 members of a large Spanish family, FA84, segregating classic adRP. RP has been traced through five generations of this kindred and the mean age of onset of the disease within the family is
13 years with a range in onset from 5 to 28 years of age. Patients initially experience nyctalopia (night blindness) and subsequently suffer from a severe constriction of visual fields. All affected individuals show the classic clinical symptoms of RP, including optic disc pallor, bone spicule pattern pigmentary deposits and retinal vascular attenuation. They also exhibit either diminished or extinguished cone and rod electroretinograms (ERGs) (for a detailed clinical description of this family see 13).
The disease gene in an unrelated American adRP family, UTAD045, exhibiting a later onset and a slower progression of symptoms, was subsequently shown also to map to 7q31.3 (14). Data from both families have been combined in an attempt to map the disease locus with greater precision and critical recombinants in both families have placed the disease gene in an interval of 4.7 Mb between the proximal marker D7S2471 and the distal maker D7S530 on 7q31.3. A number of additional smaller RP10 families have now been identified, suggesting that this locus may be responsible for a significant proportion of all adRP (15,16).
The interval containing the RP10 gene is large and also relatively gene rich. It contains 23 known genes and a considerable number of sequences with predicted coding function (http://www.ensembl.org; http://genome.ucsc.edu). Methods enabling prioritization of disease candidates for this study, and other similar studies, were therefore of potential value.
Animal models of retinal degeneration provide useful systems in which to undertake such explorations. Mice carrying a targeted disruption of the rhodopsin gene lose their photoreceptors over a period of
3 months, although the severity of degeneration is influenced by the nature of the genetic background upon which the mutation is expressed, retinas from Rho/129Sv mice degenerating structurally and functionally more rapidly than those of Rho/C57/BL6 mice (1719). In the Rho/129Sv strain all rod photoreceptors are lost at 4 months of age, and while residual cell bodies of cones persist, these cells are non-functional (19,20).
The Rho/ mouse provides a model that enables comparison of transcriptional profiles in mouse retinas with and without functional photoreceptors. Elevations or reductions in expression of transcripts from Rho/ retinas are likely to be a reflection of the destruction of primary retinal neurones, and/or of a response by remaining retinal cells toward the degenerative processes taking place. Genes thus identified may rationally represent candidates for involvement in degenerative retinal disease processes. The studies reported here directly validate this hypothesis.
| RESULTS |
|---|
|
|
|---|
Microarray-based transcriptional analysis of wild-type and rho/ retinas
Microarray studies were performed on RNA extracted from the retinas of wild-type 129Sv mice and Rho/129Sv mice at 4 months of age. The ERG of Rho/ mice on the original mixed genetic background and on pure C57BL/6J and 129Sv genetic backgrounds has previously been studied in detail, cone function being less well preserved on the latter background (19,20). At 4 months of age, cone ERG signals from Rho/129Sv mice are virtually undetectable, indicative of essentially complete loss of cone function (in contrast, at this age in Rho/C57s, cone function is still appreciably preserved indicating persistence of cone cell function on that particular background).
Four GeneChips" were used in total; two were hybridized with wild-type (Wt) retinal cRNA and two with Rho/ cRNA. RNA from the retinas of 10 mice was pooled for each of the four RNAs used for analysis. Pooled samples were used to minimize the effects of variability that may occur between individual animals. Four different comparisons were made between the different cRNA samples; Wt1/Rho/1, Wt2/Rho/2, Wt1/Rho/2 and Wt2/Rho/1. 420 genes showed increased or decreased expression in at least two of four comparisons. While each comparison is not statistically independent of the others, this criterion allowed an initial selection of genes highly likely to show real differential expression between wild-type and Rho/ mice.
Photoreceptors are essentially absent from the Rho/ retina at 4 months and therefore there is less RNA present in a single mutant retina than in the wild-type. As mRNA levels were compared between the same concentrations of retinal RNA it was predicted that, as a result of compensation for the lack of photoreceptor RNA, non-photoreceptor layers would be over-represented in the Rho/ sample. This prediction was borne out by the 107 genes showing a moderate increase in expression (1.72.5-fold) between wild-type and Rho/ retinas, compared to only 38 with an equivalent decrease. The transcripts that showed an average increase or decrease of >1.5-fold in at least two of four comparisons were classified into categories of average fold change in expression levels between wild-type and Rho/ retinas, illustrating the greater numbers of moderately increased genes and dramatically decreased genes (Fig. 1).
|
Of the 420 transcripts which showed increased or decreased expression in at least two of four comparisons, only those that had an average change of
3-fold in three or four comparisons were selected for further analysis. This selection process identified a total of 74 different candidates, 44 of which showed decreased expression in the Rho/ retinas and 30 of which showed increased expression. By choosing these parameters, the large number of moderately increased genes are not included in the analysis. An average fold change was calculated for each gene with altered expression. The fact that the hybridization was performed in duplicate and that in cases where a gene was represented by more than one probe set, a very close correlation was observed between the expression levels reported, indicates a high level of reliability of data within these levels of change. In order to validate the transcriptional variation observed in the microarray results, a number of genes showing either up- or down-regulation at the transcriptional level were analysed using relative quantitative RTPCR on the RNA samples used for the chip experiments (it should be noted that the terms up- and down-regulation, as used in this script, refer to the relative transcript levels in equal amounts of RNA from wild-type and Rho/ retinas). The genes chosen for further analysis were the ß-subunit of rod cGMP phosphodiesterase (PDE6B), peripherin/RDS, hexokinase II, high mobility group 2 (HMG2), testican, cathepsin S (CTSS) and a gene homologous to myosin regulatory light chain 2 (LC2). The change in expression levels observed for these genes in the chip results spanned a range of fold change values, allowing the reliability of both large and moderate fold changes seen in the chip data to be tested. The fold changes calculated from the quantitative RTPCR experiments, while not matching the array results in terms of precise calculations, showed agreement for the direction of the change in all cases (Table 1).
|
Genes showing significant changes in transcription level in Rho/ retinas
Predictably, seven genes involved in the visual transduction cycle are among the 44 genes most significantly down-regulated in Rho/ retinas in comparison with wild-type. These genes encode the photoreceptor-specific
and
subunits of rod transducin, the
, ß and
subunits of rod cGMP phosphodiesterase, peripherin/rds and recoverin. It is of interest to note that five of these genes have previously been implicated in some form of retinal degeneration (http://www.sph.uth.tmc.edu/Retnet/). Just two other retinal degeneration genes, those encoding blue cone opsin and retinal-specific guanylate cyclase (retGC), were present on the microarrays. The blue cone opsin gene is among the 420 genes showing decreased expression in at least two of four comparisons. The retGC gene shows decreased expression in the Rho/ retinas but the values obtained for it are not in the range considered to be significant. A recent report using a cDNA microarray with 960 genes to analyse expression in the Crx/ mouse retina also showed down-regulation of a number of photoreceptor specific genes (21). The locations of genes encoding transcripts significantly up- or down-regulated in degenerating Rho/ retinas were compared with the known locations of retinopathy-causing genes. Nine of the genes identified in this study map at the locations of retinopathy loci and therefore may arguably represent disease candidates (Table 2). All genes showing elevations or reductions of >3-fold in expression levels in microarray comparisons of wild-type and Rho/ retinas are listed in Table 3 and proteins encoded by such genes have been placed into functional groups in Table 4. It is of interest to note that a number of proteins with anti-apoptotic functions are shown to be down-regulated in the degenerating retinas of Rho/ mice. Evidence accrued to date suggests that apoptosis may be a general mechanism of photoreceptor cell death in mutation-induced retinopathies. In addition, a surprisingly large number of those genes shown to be transcriptionally activated in degenerating retinas encode proteins either of the extracellular matrix (ECM) or the cytoskeleton. The significance of these findings is discussed below.
|
|
|
Mutation in IMPDH1 in adRP
The gene encoding inosine monophosphate dehydrogenase type 1 (IMPDH1), which showed an average down-regulation of 5.8-fold in the Rho/ retina, maps to the precise location of the RP10 locus. There were no other genes in the disease interval which showed a similar down-regulation. While this gene is known to be expressed in many tissues the result nevertheless suggests that it may, within the retina, be preferentially expressed in photoreceptor cells as opposed to secondary retinal neurones. Relative quantitative RTPCR analysis confirmed down-regulation of the IMPDH1 gene, with an average fold change of 4 in Rho/ retinas. The IMPDH1 gene was thus considered a strong candidate for the adRP gene mapping to chromosome 7q31.3.
DNA from members of FA84, in which linkage to the RP10 locus was first established, was subjected to direct sequence analysis using primers specific for amplification of the fourteen IMPDH1 coding exons. This revealed a CGC
CCC change within exon 7 of the gene (Fig. 2). The mutation was shown to segregate in all affected members of the FA84. It was not present in an analysis of 200 chromosomes from non-related people of European origin and 50 Spanish chromosomes of unaffected and married members of FA84. The mutation is predicted to bring about an arginine
proline substitution at codon 224 of the IMPDH1 gene. It is of note that arginine at codon 224 of the IMPDH1 protein is conserved in all four eukaryotic species for which sequence was available, human, mouse, Drosophila and chinese hamster, suggesting that this amino acid is important in retaining the functionality of the IMPDH1 protein. These data therefore provide strong evidence that the Arg224 mutation in the IMPDH1 gene is the cause of the retinal degeneration in adRP family FA84.
|
| DISCUSSION |
|---|
|
|
|---|
Subsequent to the localization of RP10, initial efforts to identify the disease gene were hampered by the large size of the disease interval and the lack of obvious candidate genes. The global approach described here to analyse a large number of genes for differential expression in the Rho/ mouse, lacking functional photoreceptors, has been of direct value in the identification of the RP10 geneIMPDH1. Notably the same approach may aid in highlighting other mapped or unmapped retinopathy-causing genes.
The IMPDH1 gene is comprised of 17 exons, the first three of which are non-coding. The 14 coding exons span
18 kb of genomic sequence and encode a protein subunit of 514 amino acid residues, with the active IMPDH1 enzyme consisting of a homotetramer of these subunits (22) (GenBank accession no. J05272). The reaction carried out by the IMPDH1 protein is the rate-limiting step in guanine nucleotide biosynthesis. It catalyses the conversion of inosine monophosphate (IMP) to xanthosine monophosphate (XMP) with the concomitant reduction of NAD to NADH. XMP is subsequently converted to GMP which gives rise to one of the building blocks of DNA (dGTP) and also plays an essential role in intracellular signalling pathways. Guanine nucleotides are therefore essential for normal cell proliferation and function.
The identified IMPDH1 mutation lies in the cystathionine-ß-synthase 2 (CBS2) domain of the protein. Each IMPDH1 monomer consists of two domains; the larger forming a barrel containing the active site loop and the smaller (residues 110244) comprised of two tandem CBS dimer domains (23). CBS domains, originally identified in the CBS gene, are motifs which code for modules of unknown function. However, studies on these domains have revealed that they can attach to a wide range of other protein domains, suggesting that they may play a regulatory role (24).
IMPDH activity in human tissues involves a second isoenzyme, IMPDH type 2 (IMPDH2), which bears 84% amino acid homology to IMPDH1 and maps to chromosome 3p21 (25). Notably, the amino acid Arg224 appears to be highly conserved in both proteins. The regulation of expression of the two IMPDH genes differs considerably. IMPDH2 appears to exhibit inducible expression, and its level of expression is increased in proliferating and malignant cells (26,27). The IMPDH1 gene is widely expressed (http://www4.ncbi.nlm.nih.gov/UniGene/), but there is variability of expression in different tissues (28). Three major RNA transcripts for IMPDH1, which are differentially expressed from three alternative promoters, have been identified (29) suggesting that IMPDH1 expression may be regulated in a complex cell type-specific manner (29,30). PCR analysis has indicated that the level of expression of IMPDH1 in the wild-type mouse retina is relatively low in comparison to that of other known RP genes (unpublished data). An IMPDH2 knockout mouse model has been generated (31) and in consideration of the newly identified role of IMPDH1 mutations in adRP it would be of interest to observe whether there is a retinal pathology in these animals.
IMPDH1 is the first gene of its kind to be reported in the etiology of RP. It is therefore difficult to speculate at this stage as to how this mutation may bring about the degeneration of retinal photoreceptors. Inhibition of IMPDH causes a cessation of the cell cycle leading to the initiation of apoptosis. Mutation-induced alteration of the activity of IMPDH may be sufficient in photoreceptor cells to stimulate those processes leading to the initiation of apoptosis and hence degeneration of the retina (32,33).
However, the mutation identified in this study results in the synthesis of a protein that produces clinically recognizable disease only in retinal tissues. Photoreceptor cells are amongst the most physiologically active of any cell type in the human body. They require high levels of guanine nucleotides which are fundamentally important in signal transduction mechanisms, for example in the activation of transducin following light activation of the primary photoreactive component of rod cells, rhodopsin. Microarray analysis revealed that IMPDH1 is expressed at a higher level in photoreceptors than other retinal cell types in the mouse. This higher level of expression, together with the high GTP usage of photoreceptors, may go some way toward explaining the tissue-specific nature of the disease.
One possible explanation for the disease phenotype is that the mutation in the CBS2 domain hinders the interaction of an unknown photoreceptor-specific protein with IMPDH1. There is a precedence for such a scenario, with a similar situation being seen in the case of mutations in the RP GTPase regulator (RPGR) gene (34). As yet, the precise effect of the Arg224 mutation in RP10 remains unknown and detailed functional studies will be required to elucidate the mechanisms of disease pathology. It is of interest to note that there are many characterized pharmacological inhibitors of IMPDH (35) but the potential value of such inhibitors will only be established when further knowledge of the disease mechanism has been obtained. It should be noted that all other proteins in the guanine nucleotide synthesis pathway are now key candidates for retinal disease.
Presented here is a list of genes which show differential expression in the Rho/ and wild-type mice. One of these, IMPDH1, has been shown to be implicated in the etiology of adRP, and therefore other members of this group may be regarded as strong disease candidates. While detailed consideration of the possible candidacies of all of these proteins is clearly beyond the scope of the current manuscript, it is nevertheless worth noting that several of those genes showing down-regulation in Rho/ retinas encode proteins with established anti-apoptotic function, including the transcription factor A20 and cerebellar degeneration-related protein 2 (cdr2) (36,37). Data accrued largely from studies of animal models of RP indicate that a final common pathway of photoreceptor cell death is apoptosis, although the molecular mechanisms linking the presence of primary mutations to the initiation of that process remain obscure at the present time. Down-regulation, within photoreceptor cells carrying primary mutations, or in other retinal neurones, of transcripts encoding proteins which have been implicated in apoptotic mechanisms in other cell systems, may contribute to pathological disease mechanisms.
Approximately half of those transcripts showing elevations in levels of expression in Rho/ retinas when compared to wild-type, encode proteins of the cytoskeleton or ECM and indeed some of these map to locations of known retinopathy-causing genes. Up-regulation of genes encoding such proteins may represent an attempt by retinal glial cells (Muller cells) to strengthen the interphotoreceptor matrix in an attempt to slow the degenerative process. Proteins showing elevated levels of transcript include laminin, fibulin, entactin, procollagen type 1
2 chain, procollagen C-proteinase enhancer protein, testican, cathepsin S, a protein with homology to myosin light chain 2, peripherin (distinct from peripherin/rds), a protein with homology to the actin binding protein filamin and CD44, a cell surface adhesion molecule specifically localized in the Muller cell microvilli that oppose the interphotoreceptor matrix.
It is worthy of note that a number of cytoskeletal/ECM proteins have already been implicated in hereditary neuroretinal degenerations, including the Usher syndrome type 1B protein, myosin 7A, which is thought to be involved with cell adhesion (38,39). A protein termed usherin, which has a domain involved in laminin network assembly, has been shown to be defective in Usher syndrome type IIA (40). Usherin has fibronectin type III motifs which are frequently observed in proteins comprising components of the ECM and basal lamina and in cell adhesion molecules (41). Mutations in the ECM gene TIMP3 result in Sorsbys fundus dystrophy (42) and, interestingly, the protein has been found to accumulate in retinas with RP not caused by TIMP3 mutations (43). A cadherin protein, cdh23, has been implicated in Usher syndrome type 1D, and may be involved in intercellular adhesion (44). A mutation in the EGF-containing fibulin-like ECM protein 1 (EFEMPI) which, as the name suggests, is very closely related to fibulin, has also been linked to Doyne honeycomb retinal dystrophy (45). In the light of these observations the expression in the Rho/ retina of three of these genes, TIMP3, cdh23 and EFEMP1, was investigated by quantitative RTPCR. All genes were found to be up-regulated: TIMP3 by an average of 260%, cdh23 by 300% and EFEMPI by 310%.
With respect to CD44, it has been found that the inherited retinal degeneration exhibited by the rds mouse, leads to an up-regulation of expression of CD44 in the retina (46). The current study now shows CD44 to be up-regulated in the rhodopsin knockout mouse. Transcripts derived from the genes encoding amyloid precursor protein (APP) and ß-2-microglobulin (B2M) also show increased expression in Rho/ retinas. Increased expression in these genes has been implicated in the death of neurones in Alzheimers disease and amyloidosis, respectively, both of which are characterized by deposition of fibrillar amyloid proteins (47,48).
In conclusion, while immense progress has been made in the identification of genes involved in retinal degenerations, genes at a substantial number of retinopathy loci remain to be characterized in hereditary forms of disease and, with respect to age-related maculopathies, only one gene has been tentatively implicated in disease etiology to date (49). This paper demonstrates the value of studies of global transcriptional profiles of degenerating retinal tissues in the identification of genes which may, rationally, represent candidates for hereditary and multifactorial forms of retinal disease. It should be noted that five of the 35 genes that show a fold change of more than three in all four microarray comparisons, have previously been implicated in the etiology of retinal degenerations.
The study not only highlights a range of potential candidate genes for retinal degeneration but also provides strong evidence that mutations in the IMPDH1 gene play a role in adRP. Further studies will focus on elucidating the functional significance of IMPDH1 mutants and on confirming the candidacy of those genes identified through microarray analysis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
RNA extraction
Mice were initially generated carrying a targeted disruption of the rhodopsin gene using 129Sv-derived manipulated stem cells and C57BL/6J blastulas. Founders on the mixed 129/C57 background were backcrossed through a minimum of 12 successive generations onto essentially pure C57BL/6J and 129Sv genetic backgrounds. The latter were used in the current investigation. Purity of genetic background was confirmed using a series of genetic markers of both single nucleotide polymorphism (SNP) and microsatellite type. In all cases analysed, genotypes from Rho/ animals backcrossed onto the 129Sv background were the same as 129Sv wild-type (unpublished data). Total RNA was isolated from pooled retinas of two sets of 10 4-month-old 129Sv wild-type and 129Sv Rho/ mice by the method of Chomczynski and Sacchi (50).
cRNA preparation
Reverse transcription was performed on 12 µg of total RNA for 1 h at 42°C using a T7-oligo(dT)24-primer and Superscript II RT (Gibco, Life Technologies, Rockville, MD). Second strand cDNA synthesis was done for 2 h at 16°C using Escherichia coli DNA Pol I, DNA ligase and RNAseH (Gibco, Life Technologies), followed by incubation in NaOH/EDTA for 10 min at 65°C in order to degrade rRNA and tRNA. After phenol-chloroform extraction transcription was performed for 6 h at 37°C using the Bioarray high-yield RNA transcript labelling kit with Bio-16-UTP and Bio-11-CTP nucleotides (Enzo Diagnostics, Farmingdale, NY). cRNA samples were purified with the RNeasy kit (Qiagen, Crawley, UK) followed by fragmentation for 35 min at 95°C.
CHIP analysis
Samples were analysed on GeneChips" (Affymetrix, Santa Clara, CA), where perfect match and mismatch are defined by an algorithm. To check the quality of each sample with regard to housekeeping genes GAPDH and ß-actin, 15 µg of labelled cRNA was run on Test2-CHIPs (Affymetrix). Murine expression chips Mu11K subB (Affymetrix) containing 6595 data sets were hybridized with 15 µg labelled cRNA for 16 h at 45°C under rotation. Mu11K subB-chips were stained in an Affymetrix Fluidics station using SAPE (Streptavidin/Phycoerythrin) followed by staining with an anti-streptavidin antibody and SAPE. Chips were scanned with a HP-Laserscanner and data were analysed with the Micrarray Suite Software (Affymetrix). Each microarray was scaled to 150 for normalization and then analysed as described previously in detail (51).
Data analysis and selection of candidate genes
Four comparison analyses were obtained by comparing expression data of each wild-type versus each Rho/ sample using Affymetrix Software (Microarray Suite 4.0, Microdatabase 2.0 and Datamining Tool 2.0). After deletion of 55 Affymetrix spike-controls the remaining 6540 datasets derived from subB-Genechip analysis were sorted according to stringent criteria. 144 datasets were excluded from analysis because the absolute call was absent on all GeneChips" and 5497 datasets were excluded because the difference call was not changed in all four comparisons. A ranking based on difference calls was done on the remaining 899 datasets. Genes were then excluded in cases where three of four comparisons were not changed or two of four comparisons were not changed, accompanied by one decreased and one increased comparison. The 420 remaining genes showing an increase or decrease in at least two of four comparisons were regarded as potential candidates. 275 genes were up-regulated and 145 were down-regulated in the Rho/ mouse retinas. Seventy-four of these genes changed >3-fold in at least three comparisons and were regarded as the most interesting candidate genes (30 up- and 44 down-regulated and, of these, 19 genes were up- and 35 were down-regulated in all four comparisons).
Quantitative RTPCR
Relative quantitative RTPCR was used to verify the microarray data for a number of the differentially expressed genes. First-strand cDNA synthesis was carried out using 2 µg of total RNA from the pooled wild-type and knockout RNA samples with 4 U Omniscript RT (Qiagen, Crawley, UK) and 1 µM of random hexamers. Quantitative PCR was subsequently performed on a Roche LightCycler using the Quantitech PCR kit (Qiagen). Serial dilutions of cDNA were used to generate standard curves of crossing cycle number versus the logarithms of concentration for each gene of interest. A linear regression line calculated from the standard curves allowed relative transcript levels in both RNA samples to be determined. Values were normalized to the relative amounts of GAPDH present in the same cDNA preparations.
Mutational screening
For mutation analysis of the IMPDH1 gene, coding exons were amplified from patient genomic DNA using primers located in flanking intron sequence. PCR reactions were carried out in 50 µl vols containing 10 mM TrisHCl, 50 mM KCl, 2 mM MgCl2, 25 pmol of each primer, 200 µM each dNTP, 500 ng patient DNA and 1.25 U HotStar DNA polymerase (Qiagen). The primers used for amplification of IMPDH1 exon 7 were as follows: forward, ccctcctaaacatctcccaaa; reverse, ggtgaacctgggtcctcata. After an initial denaturation (94°C for 15 min), 30 cycles of PCR amplification were performed of 94°C for 30 s, 57°C for 30 s and 72°C for 1 min with a final 10 min extension at 72°C. PCR products were purified using Qiaquick columns (Qiagen). Automated sequencing was carried out on an ABI 310 genetic analyser (Perkin Elmer, Shelton, CT) using Big Dye Terminator chemistries (Perkin Elmer).
| ACKNOWLEDGEMENTS |
|---|
The authors wish to express very sincere thanks to the family that took part in this study and to Dr Blanca Garcia-Sandoval for her involvement in the clinical analysis. The authors also wish to thank Dr Jim Curry for useful advice and Dr Gerry Mahon for his contribution to analysis of the Rho/ mouse. This report is supported by grants from the Wellcome Trust, the Foundation Fighting Blindness (USA), the British RP Society, Fighting Blindness Ireland, the Health Research board of Ireland and the European Union 5th Framework Programme. We are also grateful to ONCE/Fundacion, ONCE/Fundaluce and FIS 99/0010-01E for financial support. The Ocular Genetics Unit at TCD is a member of the HEA-Ireland-sponsored Biopharmaceutical Science Network.
| FOOTNOTES |
|---|
+ To whom correspondence should be addressed. Tel: +353 1 6082484; Fax: +353 1 6083848; Email: akennan@tcd.ie
| REFERENCES |
|---|
|
|
|---|
1 Dowling,J.E. (1987) The Retina: An Approachable Part of the Brain. The Belknap Press of Harvard University Press, Cambridge, Massachusetts and London.
2
Humphries,P., Kenna,P. and Farrar,G.J. (1992) On the molecular genetics of retinitis pigmentosa. Science, 256, 804808.
3 Dryja,T.P., McGee,T.L., Reichel,E., Hahn,L.B., Cowley,G.S., Yandell,D.W., Sandberg,M.A. and Berson,E.L. (1990) A point mutation of the rhodopsin gene in one form of retinitis pigmentosa. Nature, 343, 364366.[Medline]
4 Kajiwara,K., Hahn,L.B., Mukai,S., Travis,G.H., Berson,E.L. and Dryja,T.P. (1991) Mutations in the human retinal degeneration slow gene in autosomal dominant retinitis pigmentosa. Nature, 12, 480483.
5 Farrar,G.J., Kenna,P., Jordan,S.A., Kumar-Singh,R., Humphries,M.M., Sharp,E.M., Sheils,D.M. and Humphries,P. (1991) A three-base-pair deletion in the peripherin-RDS gene in one form of retinitis pigmentosa. Nature, 354, 478480.[Medline]
6
Kajiwara,K., Berson,E.L. and Dryja,T.P. (1994) Digenic retinitis pigmentosa due to mutations at the unlinked peripherin/RDS and ROM1 loci. Science, 264, 16041608.
7 Sohocki,M.M., Sullivan,L.S., Mintz-Hittner,H.A., Birch,D., Heckenlively,J.R., Freund,C.L., McInnes,R.R. and Daiger,S.P. (1998) A range of clinical phenotypes associated with mutations in CRX, a photoreceptor transcription-factor gene. Am. J. Hum. Genet., 63, 13071315.[Web of Science][Medline]
8 Bessant,D.A., Payne,A.M., Mitton,K.P., Wang,Q.L., Swain,P.K., Plant,C., Bird,A.C., Zack,D.J., Swaroop,A. and Bhattacharya,S.S. (1999) A mutation in NRL is associated with autosomal dominant retinitis pigmentosa. Nat. Genet., 21, 355356.[Web of Science][Medline]
9 Sullivan,L.S., Heckenlively,J.R., Bowne,S.J., Zuo,J., Hide,W.A., Gal,A., Denton,M., Inglehearn,C.F., Blanton,S.H. and Daiger,S.P. (1999) Mutations in a novel retina-specific gene cause autosomal dominant retinitis pigmentosa. Nat. Genet., 22, 255259.[Web of Science][Medline]
10
Wada,Y., Abe,T., Takeshita,T., Sato,H., Yanashima,K. and Tamai,M. (2001) Mutation of human retinal fascin gene (FSCN2) causes autosomal dominant retinitis pigmentosa. Invest. Ophthalmol. Vis. Sci., 42, 23952400.
11
McKie,A.B., McHale,J.C., Keen,T.J., Tarttelin,E.E., Goliath,R., van Lith-Verhoeven,J.J., Greenberg,J., Ramesar,R.S., Hoyng,C.B., Cremers,F.P. et al. (2001) Mutations in the pre-mRNA splicing factor gene PRPC8 in autosomal dominant retinitis pigmentosa (RP13). Hum. Mol. Genet., 10, 15551562.
12 Vithana,E.N., Abu-Safieh,L., Allen,M.J., Carey,A., Papaioannou,M., Chakarova,C., Al-Maghtheh,M., Ebenezer,N.D., Willis,C., Moore,A.T. et al. (2001) A human homolog of yeast pre-mRNA splicing gene, PRP31, underlies autosomal dominant retinitis pigmentosa on chromosome 19q13.4 (RP11). Mol. Cell., 8, 375381.[Web of Science][Medline]
13 Jordan,S.A., Farrar,G.J., Kenna,P., Humphries,M.M., Sheils,D.M., Kumar-Singh,R., Sharp,E.M., Ayuso,C., Benitez,J. and Humphries,P. (1993) Localization of an autosomal dominant retinitis pigmentosa gene to chromosome 7q. Nat. Genet., 4, 5458.[Web of Science][Medline]
14 McGuire,R.E., Gannon,A.M., Sullivan,L.S., Rodriguez,J.A. and Daiger,S.P. (1995) Evidence for a major gene (RP10) for autosomal dominant retinitis pigmentosa on chromosome 7q: linkage mapping in a second, unrelated family. Hum. Genet., 95, 7174.[Web of Science][Medline]
15 Millan,J.M., Martinez,F., Vilela,C., Beneyto,M., Prieto,F. and Najera,C. (1995) An autosomal dominant retinitis pigmentosa family with close linkage to D7S480 on 7q. Hum. Genet., 96, 216218.[Web of Science][Medline]
16
Mohamed,Z., Bell,C., Hammer,H.M., Converse,C.A., Esakowitz,L. and Haites,N.E. (1996) Linkage of a medium sized Scottish autosomal dominant retinitis pigmentosa family to chromosome 7q. J. Med. Genet., 33, 714715.
17 Humphries,M.M., Rancourt,D., Farrar,G.J., Kenna,P., Hazel,M., Bush,R.A., Sieving,P.A., Sheils,D.M., McNally,N., Creighton,P., Erven,A., Boros,A., Gulya,K., Capecchi,M.R. and Humphries,P. (1997) Retinopathy induced in mice by targeted disruption of the rhodopsin gene. Nat. Genet., 15, 216219.[Web of Science][Medline]
18 Hobson,A.H., Donovan,M., Humphries,M.M., Tuohy,G., McNally,N., Carmody,R., Cotter,T., Farrar,G.J., Kenna,P.F. and Humphries,P. (2000) Apoptotic photoreceptor death in the rhodopsin knockout mouse in the presence and absence of c-fos. Exp. Eye Res., 71, 247254.[Web of Science][Medline]
19 Humphries,M.M., Kiang,S., McNally,N., Donovan,M.A., Sieving,P.A., Bush,R.A., Machida,S., Cotter,T., Hobson,A., Farrar,J., Humphries,P. and Kenna,P. (2001) Comparative structural and functional analysis of photoreceptor neurons of Rho-/- mice reveal increased survival on C57BL/6J in comparison to 129Sv genetic background. Vis. Neurosci., 18, 437443.
20 Toda,K., Bush,R.A., Humphries,P. and Sieving,P.A. (1999) The electroretinogram of the rhodopsin knockout mouse. Vis. Neurosci., 16, 391398.[Web of Science][Medline]
21 Livesey,F.J., Furukawa,T., Steffen,M.A., Church,G.M. and Cepko,C.L. (2000) Microarray analysis of the transcriptional network controlled by the photoreceptor homeobox gene Crx. Curr. Biol., 10, 301310.[Web of Science][Medline]
22
Carr,S.F., Papp,E., Wu,J.C. and Natsumeda,Y. (1993) Characterization of human type I and type II IMP dehydrogenases. J. Biol. Chem., 268, 2728627290.
23 Nimmesgern,E., Black,J., Futer,O., Fulghum,J.R., Chambers,S.P., Brummel,C.L., Raybuck,S.A. and Sintchak,M.D. (1999) Biochemical analysis of the modular enzyme inosine 5'-monophosphate dehydrogenase. Protein Expr. Purif., 17, 282289.[Web of Science][Medline]
24 Sintchak,M.D. and Nimmesgern,E. (2000) The structure of inosine 5'-monophosphate dehydrogenase and the design of novel inhibitors. Immunopharmacology, 47, 163184.[Web of Science][Medline]
25
Natsumeda,Y., Ohno,S., Kawasaki,H., Konno,Y., Weber,G. and Suzuki,K. (1990) Two distinct cDNAs for human IMP dehydrogenase. J. Biol. Chem., 265, 52925295.
26
Nagai,M., Natsumeda,Y., Konno,Y., Hoffman,R., Irino,S. and Weber,G. (1991) Selective up-regulation of type II inosine 5'-monophosphate dehydrogenase messenger RNA expression in human leukemias. Cancer Res., 51, 38863890.
27 Jayaram,H.N., Cooney,D.A. and Grusch,M. (1999) Consequences of IMP dehydrogenase inhibition, and its relationship to cancer and apoptosis. Curr. Med. Chem., 6, 561574.[Web of Science][Medline]
28 Senda,M. and Natsumeda,Y. (1994) Tissue-differential expression of two distinct genes for human IMP dehydrogenase(E.C.1.1.1.205). Life Sci., 54, 19171926.[Web of Science][Medline]
29
Gu,J.J., Spychala,J. and Mitchell,B.S. (1997) Regulation of the human inosine monophosphate dehydrogenase type I gene. Utilization of alternative promoters. J. Biol. Chem., 272, 44584466.
30 Zimmermann,A.G., Gu,J.J., Laliberte,J. and Mitchell,B.S. (1998) Inosine-5'-monophosphate dehydrogenase: regulation of expression and role in cellular proliferation and T lymphocyte activation. Prog. Nucleic Acid Res. Mol. Biol., 61, 181209.[Web of Science][Medline]
31 Gu,J.J., Stegmann,S., Gathy,K., Murray,R., Laliberte,J., Ayscue,L. and Mitchell,B.S. (2000) Inhibition of T lymphocyte activation in mice heterozygous for loss of the IMPDH II gene. J. Clin. Invest., 106, 599606.[Web of Science][Medline]
32 Catapano,C.V., Dayton,J.S., Mitchell,B.S. and Fernandes,D.J. (1995) GTP depletion induced by IMP dehydrogenase inhibitors blocks RNA-primed DNA synthesis. Mol. Pharmacol., 47, 948955.[Abstract]
33 Yalowitz,J.A. and Jayaram,H.N. (2000) Molecular targets of guanine nucleotides in differentiation, proliferation and apoptosis. Anticancer Res., 20, 23292338.[Web of Science][Medline]
34
Hong,D.H., Yue,G., Adamian,M. and Li,T. (2001) Retinitis pigmentosa GTPase regulator (RPGRr)-interacting protein is stably associated with the photoreceptor ciliary axoneme and anchors RPGR to the connecting cilium. J. Biol. Chem., 276, 1209112099.
35 Hedstrom,L. (1999) IMP dehydrogenase: mechanism of action and inhibition. Curr. Med. Chem., 6, 545560.[Web of Science][Medline]
36
Beyaert,R., Heyninck,K. and Van Huffel,S. (2000) A20 and A20-binding proteins as cellular inhibitors of nuclear factor-
B-dependent gene expression and apoptosis. Biochem. Pharmacol., 60, 11431151.[Web of Science][Medline]
37
Okano,H.J., Park,W.Y., Corradi,J.P. and Darnell,R.B. (1999) The cytoplasmic Purkinje onconeural antigen cdr2 down-regulates c-Myc function: implications for neuronal and tumor cell survival. Genes Dev., 13, 20872097.
38 Weil,D., Blanchard,S., Kaplan,J., Guilford,P., Gibson,F., Walsh,J., Mburu,P., Varela,A., Levilliers,J., Weston,M.D. et al. (1995) Defective myosin VIIA gene responsible for Usher syndrome type 1B. Nature, 374, 6061.[Medline]
39 Tuxworth,R.I., Weber,I., Wessels,D., Addicks,G.C., Soll,D.R., Gerisch,G. and Titus,M.A. (2001) A role for myosin VII in dynamic cell adhesion. Curr. Biol., 11, 318329.[Web of Science][Medline]
40 Weston,M.D., Eudy,J.D., Fujita,S., Yao,S., Usami,S., Cremers,C., Greenburg,J., Ramesar,R., Martini,A., Moller,C. et al. (2000) Genomic structure and identification of novel mutations in usherin, the gene responsible for Usher syndrome type IIa. Am. J. Hum. Genet., 66, 11991210.[Web of Science][Medline]
41 Eudy,J.D., Weston,M.D., Yao,S., Hoover,D.M., Rehm,H.L., Ma-Edmonds,M., Yan,D., Ahmad,I., Cheng,J.J., Ayuso,C. et al. (1998) Mutation of a gene encoding a protein with extracellular matrix motifs in Usher syndrome type IIa. Science, 280, 753757.
42 Weber,B.H., Vogt,G., Pruett,R.C., Stohr,H. and Felbor,U. (1994) Mutations in the tissue inhibitor of metalloproteinases-3 (TIMP3) in patients with Sorsbys fundus dystrophy. Nat. Genet., 8, 352356.[Web of Science][Medline]
43
Fariss,R.N., Apte,S.S., Luthert,P.J., Bird,A.C. and Milam,A.H. (1998) Accumulation of tissue inhibitor of metalloproteinases-3 in human eyes with Sorsbys fundus dystrophy or retinitis pigmentosa. Br. J. Ophthalmol., 82, 13291334.
44 Bolz,H., von Brederlow,B., Ramirez,A., Bryda,E.C., Kutsche,K., Nothwang,H.G., Seeliger,M., del C-Salcedo Cabrera,M., Vila,M.C., Molina,O.P., Gal,A. and Kubisch,C. (2001) Mutation of CDH23, encoding a new member of the cadherin gene family, causes Usher syndrome type 1D. Nat. Genet., 27, 108112.[Web of Science][Medline]
45 Stone,E.M., Lotery,A.J., Munier,F.L., Heon,E., Piguet,B., Guymer,R.H., Vandenburgh,K., Cousin,P., Nishimura,D., Swiderski,R.E. et al. (1999) A single EFEMP1 mutation associated with both Malattia Leventinese and Doyne honeycomb retinal dystrophy. Nat. Genet., 22, 199202.[Web of Science][Medline]
46 Krishnamoorthy,R., Agarwal,N. and Chaitin,M.H. (2000) Upregulation of CD44 expression in the retina during the rds degeneration. Brain Res. Mol. Brain Res., 77, 125130.[Medline]
47 Hendriks,L. and Van Broeckhoven,C. (1996) A ß A4 amyloid precursor protein gene and Alzheimers disease. Eur. J. Biochem., 237, 615.[Web of Science][Medline]
48 Gorevic,P.D., Casey,T.T., Stone,W.J., DiRaimondo,C.R., Prelli,F.C. and Frangione,B. (1985) ß-2 microglobulin is an amyloidogenic protein in man. J. Clin. Invest., 76, 24252429.
49 Allikmets,R., Singh,N., Sun,H., Shroyer,N.F., Hutchinson,A., Chidambaram,A., Gerrard,B., Baird,L., Stauffer,D., Peiffer,A. et al. (1997) A photoreceptor cell-specific ATP-binding transporter gene (ABCR) is mutated in recessive Stargardt macular dystrophy. Nat. Genet., 15, 236246.[Web of Science][Medline]
50 Chomczynski,P. and Sacchi,N. (1987) Single-step method of RNA isolation by acid guanidiniumthiocyanatephenolchloroform extraction. Anal. Biochem., 162, 156159.[Web of Science][Medline]
51
Thykjaer,T., Workman,C., Kruhoffer,M., Demtroder,K., Wolf,H., Andersen,L.D., Frederiksen,C.M., Knudsen,S. and Orntoft,T.F. (2001) Identification of gene expression patterns in superficial and invasive human bladder cancer. Cancer Res., 61, 24922499.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
H. Koso, C. Minami, Y. Tabata, M. Inoue, E. Sasaki, S. Satoh, and S. Watanabe CD73, a Novel Cell Surface Antigen That Characterizes Retinal Photoreceptor Precursor Cells Invest. Ophthalmol. Vis. Sci., November 1, 2009; 50(11): 5411 - 5418. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Pimkin, J. Pimkina, and G. D. Markham A Regulatory Role of the Bateman Domain of IMP Dehydrogenase in Adenylate Nucleotide Biosynthesis J. Biol. Chem., March 20, 2009; 284(12): 7960 - 7969. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Mortimer, D. Xu, D. McGrew, N. Hamaguchi, H. C. Lim, S. J. Bowne, S. P. Daiger, and L. Hedstrom IMP Dehydrogenase Type 1 Associates with Polyribosomes Translating Rhodopsin mRNA J. Biol. Chem., December 26, 2008; 283(52): 36354 - 36360. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Shinzato, M. Enoki, H. Sato, K. Nakamura, T. Matsui, and Y. Kamagata Specific DNA Binding of a Potential Transcriptional Regulator, Inosine 5'-Monophosphate Dehydrogenase-Related Protein VII, to the Promoter Region of a Methyl Coenzyme M Reductase I-Encoding Operon Retrieved from Methanothermobacter thermautotrophicus Strain {Delta}H Appl. Envir. Microbiol., October 15, 2008; 74(20): 6239 - 6247. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Fingert, K. Oh, M. Chung, T. E. Scheetz, J. L. Andorf, R. M. Johnson, V. C. Sheffield, and E. M. Stone Association of a Novel Mutation in the Retinol Dehydrogenase 12 (RDH12) Gene With Autosomal Dominant Retinitis Pigmentosa Arch Ophthalmol, September 1, 2008; 126(9): 1301 - 1307. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. C.S. Tam, A.-S. Kiang, A. Kennan, P. F. Kenna, N. Chadderton, M. Ader, A. Palfi, A. Aherne, C. Ayuso, M. Campbell, et al. Therapeutic benefit derived from RNAi-mediated ablation of IMPDH1 transcripts in a murine model of autosomal dominant retinitis pigmentosa (RP10) Hum. Mol. Genet., July 15, 2008; 17(14): 2084 - 2100. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Hornan, S. N. Peirson, A. J. Hardcastle, R. S. Molday, M. E. Cheetham, and A. R. Webster Novel Retinal and Cone Photoreceptor Transcripts Revealed by Human Macular Expression Profiling Invest. Ophthalmol. Vis. Sci., December 1, 2007; 48(12): 5388 - 5396. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. V. Alvarez, E. N. Vithana, Z. Yang, A. H. Koh, K. Yeung, V. Yong, H. J. Shandro, Y. Chen, P. Kolatkar, P. Palasingam, et al. Identification and Characterization of a Novel Mutation in the Carbonic Anhydrase IV Gene that Causes Retinitis Pigmentosa Invest. Ophthalmol. Vis. Sci., August 1, 2007; 48(8): 3459 - 3468. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Bowne, Q. Liu, L. S. Sullivan, J. Zhu, C. J. Spellicy, C. B. Rickman, E. A. Pierce, and S. P. Daiger Why Do Mutations in the Ubiquitously Expressed Housekeeping Gene IMPDH1 Cause Retina-Specific Photoreceptor Degeneration? Invest. Ophthalmol. Vis. Sci., September 1, 2006; 47(9): 3754 - 3765. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Yu, M. F. Hirshman, N. Fujii, J. M. Pomerleau, L. E. Peter, and L. J. Goodyear Muscle-specific overexpression of wild type and R225Q mutant AMP-activated protein kinase {gamma}3-subunit differentially regulates glycogen accumulation Am J Physiol Endocrinol Metab, September 1, 2006; 291(3): E557 - E565. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. S. Sullivan, S. J. Bowne, D. G. Birch, D. Hughbanks-Wheaton, J. R. Heckenlively, R. A. Lewis, C. A. Garcia, R. S. Ruiz, S. H. Blanton, H. Northrup, et al. Prevalence of disease-causing mutations in families with autosomal dominant retinitis pigmentosa: a screen of known genes in 200 families. Invest. Ophthalmol. Vis. Sci., July 1, 2006; 47(7): 3052 - 3064. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Zangerl, Q. Sun, J. Pillardy, J. L. Johnson, P. A. Schweitzer, A. G. Hernandez, L. Liu, G. M. Acland, and G. D. Aguirre Development and characterization of a normalized canine retinal cDNA library for genomic and expression studies. Invest. Ophthalmol. Vis. Sci., June 1, 2006; 47(6): 2632 - 2638. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Abou-Sleymane, F. Chalmel, D. Helmlinger, A. Lardenois, C. Thibault, C. Weber, K. Merienne, J.-L. Mandel, O. Poch, D. Devys, et al. Polyglutamine expansion causes neurodegeneration by altering the neuronal differentiation program Hum. Mol. Genet., March 1, 2006; 15(5): 691 - 703. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Bowne, L. S. Sullivan, S. E. Mortimer, L. Hedstrom, J. Zhu, C. J. Spellicy, A. I. Gire, D. Hughbanks-Wheaton, D. G. Birch, R. A. Lewis, et al. Spectrum and Frequency of Mutations in IMPDH1 Associated with Autosomal Dominant Retinitis Pigmentosa and Leber Congenital Amaurosis Invest. Ophthalmol. Vis. Sci., January 1, 2006; 47(1): 34 - 42. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ignoul and J. Eggermont CBS domains: structure, function, and pathology in human proteins Am J Physiol Cell Physiol, December 1, 2005; 289(6): C1369 - C1378. [Abstract] [Full Text] [PDF] |
||||
![]() |
A Schuster, N Weisschuh, H Jagle, D Besch, A R Janecke, H Zierler, S Tippmann, E Zrenner, and B Wissinger Novel rhodopsin mutations and genotype-phenotype correlation in patients with autosomal dominant retinitis pigmentosa Br J Ophthalmol, October 1, 2005; 89(10): 1258 - 1264. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wada, M. A. Sandberg, T. L. McGee, M. A. Stillberger, E. L. Berson, and T. P. Dryja Screen of the IMPDH1 Gene among Patients with Dominant Retinitis Pigmentosa and Clinical Features Associated with the Most Common Mutation, Asp226Asn Invest. Ophthalmol. Vis. Sci., May 1, 2005; 46(5): 1735 - 1741. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Hackam, R. Strom, D. Liu, J. Qian, C. Wang, D. Otteson, T. Gunatilaka, R. H. Farkas, I. Chowers, M. Kageyama, et al. Identification of Gene Expression Changes Associated with the Progression of Retinal Degeneration in the rd1 Mouse Invest. Ophthalmol. Vis. Sci., September 1, 2004; 45(9): 2929 - 2942. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Lord-Grignon, N. Tetreault, A. J. Mears, A. Swaroop, and G. Bernier Characterization of New Transcripts Enriched in the Mouse Retina and Identification of Candidate Retinal Disease Genes Invest. Ophthalmol. Vis. Sci., September 1, 2004; 45(9): 3313 - 3319. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Zareparsi, A. Hero, D. J. Zack, R. W. Williams, and A. Swaroop Seeing the Unseen: Microarray-Based Gene Expression Profiling in Vision Invest. Ophthalmol. Vis. Sci., August 1, 2004; 45(8): 2457 - 2462. [Full Text] [PDF] |
||||
![]() |
S. Yoshida, A. J. Mears, J. S. Friedman, T. Carter, S. He, E. Oh, Y. Jing, R. Farjo, G. Fleury, C. Barlow, et al. Expression profiling of the developing and mature Nrl-/- mouse retina: identification of retinal disease candidates and transcriptional regulatory targets of Nrl Hum. Mol. Genet., July 15, 2004; 13(14): 1487 - 1503. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Estevez, M. Pusch, C. Ferrer-Costa, M. Orozco, and T. J. Jentsch Functional and structural conservation of CBS domains from CLC chloride channels J. Physiol., June 1, 2004; 557(2): 363 - 378. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Aherne, A. Kennan, P. F. Kenna, N. McNally, D. G. Lloyd, I. L. Alberts, A.-S. Kiang, M. M. Humphries, C. Ayuso, P. C. Engel, et al. On the molecular pathology of neurodegeneration in IMPDH1-based retinitis pigmentosa Hum. Mol. Genet., March 15, 2004; 13(6): 641 - 650. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Akimoto, E. Filippova, P. J. Gage, X. Zhu, C. M. Craft, and A. Swaroop Transgenic Mice Expressing Cre-Recombinase Specifically in M- or S-Cone Photoreceptors Invest. Ophthalmol. Vis. Sci., January 1, 2004; 45(1): 42 - 47. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Cavusoglu, D. Thierse, S. Mohand-Said, F. Chalmel, O. Poch, A. Van-Dorsselaer, J.-A. Sahel, and T. Leveillard Differential Proteomic Analysis of the Mouse Retina: The Induction of Crystallin Proteins by Retinal Degeneration in the rd1 Mouse Mol. Cell. Proteomics, August 1, 2003; 2(8): 494 - 505. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Hyle, R. J. Shaw, and D. Reines Functional Distinctions between IMP Dehydrogenase Genes in Providing Mycophenolate Resistance and Guanine Prototrophy to Yeast J. Biol. Chem., August 1, 2003; 278(31): 28470 - 28478. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Nielsen, K. Birkenkamp-Demtroder, N. Ehlers, and T. F. Orntoft Identification of Differentially Expressed Genes in Keratoconus Epithelium Analyzed on Microarrays Invest. Ophthalmol. Vis. Sci., June 1, 2003; 44(6): 2466 - 2476. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Wilson, B. G. Hobbs, W.-Y. Shen, T. P. Speed, U. Schmidt, C. G. Begley, and P. E. Rakoczy Argon Laser Photocoagulation-Induced Modification of Gene Expression in the Retina Invest. Ophthalmol. Vis. Sci., April 1, 2003; 44(4): 1426 - 1434. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kondo, T. Tahira, A. Mizota, E. Adachi-Usami, K. Oshima, and K. Hayashi Diagnosis of Autosomal Dominant Retinitis Pigmentosa by Linkage-Based Exclusion Screening with Multiple Locus-Specific Microsatellite Markers Invest. Ophthalmol. Vis. Sci., March 1, 2003; 44(3): 1275 - 1281. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. McNally, P. F. Kenna, D. Rancourt, T. Ahmed, A. Stitt, W. H. Colledge, D. G. Lloyd, A. Palfi, B. O'Neill, M. M. Humphries, et al. Murine model of autosomal dominant retinitis pigmentosa generated by targeted deletion at codon 307 of the rds-peripherin gene Hum. Mol. Genet., May 1, 2002; 11(9): 1005 - 1016. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||











