Human Molecular Genetics, 2002, Vol. 11, No. 8 981-991
© 2002 Oxford University Press
ARX, a novel Prd-class-homeobox gene highly expressed in the telencephalon, is mutated in X-linked mental retardation
1Institut Cochin CHU Cochin Port-Royal, 75014 Paris, France 2Service des Maladies congenitales et héréditaires, Hôpital Charles Nicolle, Tunis, Tunisie 3Service de Génétique, CHU Bretonneau, Tours, France 4Department of Human Genetics, University Hospital, Nijmegen, The Netherlands 5Max Plank Institut for Molekulare Genetik, Berlin, Germany 6Center for Human Genetics, Clinical Genetics Unit, Leuven, Belgium 7DCMG-Women's and children hospital, North Adelaide, SA5006, Australia and 8NIN-Division of Biochemistry and Cellular Biology, Ogawahigashi, Kodaira, Tokyo, Japan
| ABSTRACT |
|---|
|
|
|---|
Investigation of a critical region for an X-linked mental retardation (XLMR) locus led us to identify a novel Aristaless related homeobox gene (ARX ). Inherited and de novo ARX mutations, including missense mutations and in frame duplications/insertions leading to expansions of polyalanine tracts in ARX, were found in nine familial and one sporadic case of MR. In contrast to other genes involved in XLMR, ARX expression is specific to the telencephalon and ventral thalamus. Notably there is an absence of expression in the cerebellum throughout development and also in adult. The absence of detectable brain malformations in patients suggests that ARX may have an essential role, in mature neurons, required for the development of cognitive abilities.
| INTRODUCTION |
|---|
|
|
|---|
Mental retardation (MR) is a frequent cause of serious handicap in children and young adults. It is defined as an overall "intelligence quotient" (IQ) lower than 70 associated with functional deficits in adaptive behaviour (such as daily-living skills, social skills and communication), with an onset before 18 years (1,2). Moderate to severe MR (IQ<50) is estimated to affect 0.40.8% of the population and the prevalence increases to 2% if mild MR (50<IQ<70) is included, although these estimates vary widely between epidemiological studies (2). The underlying causes of MR are extremely heterogeneous. They include non-genetic factors that act prenatally or during early infancy and cause brain injury, as well as established genetic causes. The Online Mendelian Inheritance in Man (OMIM) database identifies close to 1000 entries, many of which are X-linked conditions (XLMR). The prevalence of XLMR has been estimated as 1.8/1000 males with a carrier frequency of 2.4/1000 females (3). Historically, XLMR are classified as syndromic (MRXS) and non-specific forms (MRX). For the cloning of the responsible genes, syndromic forms are in general amenable to conventional positional cloning strategies because families that share similar clinical phenotypes can be pooled for linkage analysis to narrow down a candidate interval. However, the situation is more complex for MRX because of the inconsistency of the phenotype and the extensive genetic heterogeneity (4). Although our knowledge of the monogenic causes of MR is still far from complete, in recent years striking progress has been made. It is believed that MRX disorders are caused by alterations in molecular pathways that are important for cognitive functions. Indeed, for MRX, positional cloning efforts have led to the identification of 7 different non-specific MR genes: FMR2; OPHN1; RabGDI1; PAK3; IL1RAPL; TM4SF2; and ARHGEF6. Moreover, three other genes ATRX, MECP2 and RSP6KA3 were found to be involved in both syndromic and non-specific forms (4). Three of the newly identified MRX genes, OPHN1, PAK3 and ARHGEF6 encode proteins that interact with RhoGTPases. This family of proteins are small Ras-like GTPases that act along signal transduction pathways from the cell surface to the actin cytoskeleton of the cell and the nucleus. These signal transduction pathways are believed to be crucial for neuronal morphogenesis and connectivity (5). The class of genes involved in chromatin remodelling (ATRX, MECP2 and RSK2) represent a more recent addition to the cellular processes that are disrupted in XLMR. Phenotypes associated with mutations in these genes might thus result from abnormalities in chromatin structure and deregulation of the expression of genes required for normal brain function. The newly identified gene reported in this study falls into this latter category as it encodes a novel homeodomain protein that belongs to a subset of Aristaless-related Paired-class homeodomain proteins. In addition to missense mutations, recurrent in frame insertions and duplications in CG rich regions resulting in an expansion of polyalanine tracts were detected in familial and sporadic cases. The expression pattern during development and the absence of mutations resulting in a complete loss-of-function suggest that ARX is required for early steps of cerebral development and patterning. We speculate that dysfunction of the ARX protein might disturb transcription pathways and the regulation of genes involved in cellular processes and functions required for cognitive development.
| RESULTS |
|---|
|
|
|---|
Analysis of the MRX54 locus and implication of the ARX gene in mental retardation
We have previously reported a large family (MRX54) with non-specific XLMR and showed that the genetic interval containing the disease-related gene maps to Xp21.322.1 between DXS989 and DXS1218 markers (6). The genetic distances between DXS989 and DXS1218 were initially estimated at approximately 2.7 cM (7). Information available in different databases, data from the literature and in silico analysis allowed the identification and characterisation of 10 genes in this region, most of them represented by clusters of ESTs, and one pseudogene (Fig. 1). The diversity of known genes involved in XLMR lead us to consider the screening of all genes located within the critical region. We combined mRNA and genomic sequence analyses. We analyzed the expression of these genes by RTPCR using total RNA extracted from normal human fetal brain and normal lymphoblastoid cell lines (LCL). Only genes expressed in human fetal brain were considered as candidates for MR phenotype. Eight genes were expressed in human fetal brain (PCYTB1, PDK3, PDX4, ZFX, MyO25, SAT, CGI-16 and ARX, Fig. 1), six of which were also expressed in lymphocytes (PDK3, ZFX, My025, SAT, PDX4 and CGI-16, Fig. 1). To identify the gene involved in the MRX54 family, we used RNA prepared from the proband's LCL and amplified by RTPCR coding sequences of all genes expressed in this cell type to look for quantitative and qualitative mRNA abnormalities. The analysis included direct cDNA sequencing of all RTPCR products. Using this method no mutations were detected in the coding sequences of ZFX, PDK3, SAT, CGI-16, PDX4 and My025 genes.
|
We then focused on the analysis of two genes which were not expressed in lymphocytes but expressed in fetal brain, PCYTB1 and the gene represented by the Unigene EST cluster Hs.157208 (http://www.ncbi.nlm.nih.gov/UniGene/index.html). This latter cluster showed a significant similarity with the 3'UTR sequence of the mouse Arx cDNA (aristaless-related homeobox gene) (8). Computational analysis of the human genomic sequences (GenBank AC002504) containing this EST cluster allowed the prediction of additional potential expressed sequences homologous to the mouse Arx gene. To validate all predicted exons and ascertain the presence of the human ARX gene in the critical region we performed RTPCR experiments using primers located in the potential exons, and human fetal brain total RNA as template. We also hybridized a 1.5 kb RTPCR fragment extending from the homeodomain to the 3'UTR to Northern blots containing poly(A+) RNA and detected a transcript of approximately 3 kb expressed in fetal and adult human brain (Fig. 2A). Gene structure analysis, including definition of exon-intron boundaries (Table 1), showed that the human ARX gene has 5 exons spanning approximately 11 kb of genomic DNA. Sequence analysis of the cDNA revealed a single open reading frame (ORF) of 1686 bp that encodes a predicted homeodomain-containing protein of 562 amino acids (Fig. 2B). As homeodomain genes are known to play crucial roles in the establishment of cerebral structures and/or the generation of certain cell types, ARX was considered as a strong candidate gene for XLMR families mapped to this region. To search for mutations in the proband of the MRX54 family, we combined denaturing high performance liquid chromatography (DHPLC) analysis and direct sequencing of PCR products corresponding to all coding exons and intron-exon junctions. These analyses revealed the presence of a T to C nucleotide substitution at position 98 (98C>T) of the ORF (Fig. 3A and 3B), leading to a leucine (CTG) to proline (CCG) substitution at amino acid 33 of ARX (L33P; Fig. 2B). This missense mutation creates a unique SmaI restriction site that permitted us to score for the mutation in 17 available family members. This analysis showed a co-segregation of the mutation with the disease (Fig. 3C). The 98C>T change was not detected in 200 control normal males of different ethnic origins. Moreover, L33 was found to be conserved in orthologs of ARX and in many other aristaless-related proteins (Fig. 3D). All together, these results indicate that this missense mutation in ARX underlies the non-specific MR phenotype observed in the MRX54 family.
|
|
|
Expansion of polyalanine tracts and missense mutations in ARX associated with MR
In order to look for additional mutations in ARX we screened all available MRX families known to be located in the Xp22.1 region, collected by the European XLMR Consortium (4). Figure 4A shows genetic and physical intervals encompassing ARX, including flanking markers and lod score values, corresponding to the eight relevant MRX families (besides MRX54). Clinical and neuropsychological features, and MRI imaging investigations are summarized in Table 2. In addition, we screened ARX in 148 MR patients from clinically well-characterized small families having at least two affected brothers; and in 40 sporadic cases of mentally retarded males. All coding exons of the ARX gene were screened for mutations by DHPLC followed by direct DNA sequencing of PCR products showing abnormal DHPLC patterns. Such abnormal DHPLC patterns were identified in seven unrelated MRX patients (P49, P73, T6, N8, N52, L32, T4) out of the eight families mapped to this region. In the N9-MRX family with a genetic interval covering almost the entire X chromosome (DXS989HPRT, 113.3 Mb), no abnormality was identified. This screening also revealed abnormal profiles in three small MR families and in one sporadic MR case.
|
|
Direct sequencing of the abnormal PCR products showed the presence in five MRX families (L32, N8, N52, P49, P73) of an in-frame duplication of 24 bp localized in exon 2 (428451dup) (24 bp). Figure 4B shows the segregation of the duplication with the phenotype in the P73-MR family. This duplication was also found in the sporadic case of MR, but not in his healthy mother, indicating its de novo origin. The duplication is predicted to cause an expansion of the polyalanine tract at amino acid position 144155 (Fig. 2B), from 12 to 20 alanines. Also, a small in-frame insertion, 304insGCGGCG, leading to a 2 amino acid increase of the normal 16 polyalanine tract (at position 100115, Fig. 2B) was found in another small MRX family (T80). In the T4-MRX family we identified a missense mutation: an A to G transition in ARX resulting in a Q (CAG) to R (CGG) amino acid change was detected at position 163 of the predicted ARX protein. An additional missense mutation: a G to A transition resulting in a G (GGC) to S (AGC) amino acid change at position 286 (G286S) was identified in a small MRX family (P25). Figure 4C summarises the nature and position of all these mutations and the MRX families concerned. Co-segregation of the duplication, insertion and missense mutations with the disease was confirmed in all families. The presence of all mutations was systematically tested in a control population; none of the mutations were detected among 200 control males.
The remaining MRX family (T6-MRX family) with a genetic interval encompassing ARX showed the presence of an in-frame deletion: 448del9 (gccgcggcc). Although family analysis showed co-segregation of the deletion with the phenotype, it is likely that this abnormality corresponds to a rare polymorphism. This conclusion is based on the detection of yet another in frame deletion: 429del24 (ggccgccgcggcagccgcggccgc) within the same polyalanine tract in a healthy male from a small MRX family (L45-MRX family).
Temporal and spatial expression patterns of ARX encoding a novel homeodomain-containing protein
As shown in Figure 2, human multiple tissue Northern-blot data suggest that during development the 3 kb ARX transcript is expressed only in fetal brain. However, in adult stages, expression is detected in a wider range of tissues including brain, heart and skeletal muscle. Interestingly, in brain only a single 3 kb mRNA isoform is expressed, while in adult heart one additional isoform (approximately 4.4 kb) was detected. A Northern blot containing poly(A)+ RNA from different structures of the adult brain showed an expression of the 3 kb mRNA in adult cerebral cortex, amygdala, thalamus, corpus callosum, caudate nucleus, substantia nigra and hippocampus (data not shown). To further investigate ARX expression during development, in adult brain and in primary cultures of mouse neuronal and astro-glial cells, we derived appropriate primers from the mouse homologous gene and studied its expression by RTPCR. Figure 5A shows RTPCR amplification (20 cycles) of the mouse Arx mRNA and GDI-1 mRNA (9) used here as a control. In addition to the expected expression of Arx in fetal brain at different embryonic stages, Figure 5A shows a significant level of Arx expression in adult hippocampus and cortex, whereas it is not detected in cerebellum. This latter result was also obtained after 35 cycles of amplification (data not shown). This figure shows also a significant level of Arx expression in primary cultures of mouse neuronal and astro-glial cells derived from fetal brain at E15 and newborn mouse brains, respectively.
|
To better define the temporal and spatial expression patterns of ARX and confirm the absence of expression in the cerebellum, we performed whole-mount and a series of RNA in situ hybridization experiments on mouse embryo sections of different stages. Whole-mount in situ hybridization showed that the onset of Arx expression in the nervous system was at approximately embryonic day 8 (E8) in a restricted region of the neuroepithelium corresponding to the prospective forebrain (Fig. 5B). At E9 and E10, in addition to a sustained expression in the telencephalic vesicles, a significant level of expression in the floor plate was observed (Fig. 5B, embryo at E9). This expression was transient as it had significantly decreased at E10. Interestingly, in situ hybridization on sections confirmed the expression in the forebrain and showed a highly restricted expression of Arx during development (Fig. 5C). At E10.5, a strong expression was detected only in the developing telencephalon (presumptive cerebral cortex) and ventral thalamus. At later stages of development, from E10.5 to neonatal stages, Arx expression was relatively widespread throughout telencephalic structures such as the ganglionic eminences (see Fig. 5C, E15.5), cerebral cortex, and the hippocampus (Fig. 5C, neonatal stage). As shown in Figure 5C, no expression was detected in the majority of the mesencephalon and diencephalon, except the ventral thalamus (E10.5 and E15.5), nor in the cerebellum (neonate). In adult brain, a weaker expression of Arx was observed in all structures except the olfactory bulb, which continued to show a high level of expression (data not shown). Higher magnifications of the embryonic sections showed that Arx is expressed in the ventricular zone of the developing cortex, which contains proliferating cells, in the intermediate zone which contains migrating neurons and in the developing cortical plate, which contains young maturing neuronal cells (Fig. 5D). Interestingly, it appears that the highest level of expression concerns the superficial cell poor layer of the cortex corresponding most likely to the marginal zone (Fig. 5C and 5D). Preliminary expression data of Arx in mouse and zebrafish embryos have previously been reported (8,10). Although most of their data are concordant with our expression studies, significant divergent results, such as the expression in the hippocampus and cortical layers, were observed.
The restricted pattern of Arx expression in the CNS is reminiscent of other forebrain transcription factors, such as Otx, Emx, Dlx, Pax and BF-1 genes, described with specific expression boundaries within the telencephalic neuroepithelium (1115). These regulatory genes are believed to establish positional identity in the neuroepithelium and to control the patterning of the CNS. Though mechanisms underlying Arx involvement in forebrain development and patterning remain to be defined, its restricted expression in the telencephalon and ventral thalamus and its conservation during evolution further emphasize that ARX represents a useful new marker of the developing brain.
Functional domains and nuclear localization of ARX
The ARX predicted protein belongs to one of the three largest classes of homeoproteins, the paired (Prd) class, and it is a member of a specific sub-class within this class. The members of this sub-class contain a glutamine residue at the critical position 50 of their homeodomains (Q50), a residue also found in Drosophila aristaless protein (al). The homeodomain encoded by ARX shows 100% identity to that of Mus musculus ARX and 85% identity to Drosophila al protein (8,16). In vitro experiments have showen that in general, Q50/homeodomain proteins bind optimally to palindromic DNA sequences composed of two TAAT half sites (17). In addition to its paired/Q50 central homeodomain, ARX is characterized by a 14 amino acid C-terminal aristaless domain (for review see 18,19). The function of this domain is still unknown, but it could be involved in the specific recognition of genes which are targets for transcriptional regulation. Another highly conserved predicted functional domain corresponds to the octapeptide domain located near the N-terminus (Fig. 2B and 3D). This motif designated as the GEH (Goosecoid Engrailed Homology), known also as the eh-1 domain in the Engrailed (En) homeoprotein (20) was shown to be involved in transcriptional repression, both in vivo and in vitro (2123). ARX also contains four polyalanine tracts (Fig. 2B) which are present in the mouse homologous protein, but interestingly not conserved in zebrafish and fly orthologs. Polyalanine tracts are common among homeodomain proteins and other transcription factors, but their function is still unknown. In this study, we generated a construct containing full length ARX in fusion with GFP and over-expressed this fusion protein in Cos-7 and PC12 cells and confirmed the expected nuclear localisation of ARX (24).
| DISCUSSION |
|---|
|
|
|---|
Phenotypic heterogeneity with consistent MR resulting from mutations in ARX
In this study we present multiple lines of evidence which demonstrate that mutations in ARX, a novel aristaless-related gene, are responsible for mental deficiency. In addition to its localisation in a region encompassed by genetic intervals corresponding to several MR families, the identification in ARX of ten inherited mutations that co-segregate with MR phenotypes strongly suggest the involvement of this gene in XLMR. This data is reinforced by the detection of the recurrent mutation (24 bp duplication) in a sporadic case of MR that was shown to be de novo. Although further studies are required to assess the effect of this mutation, as well as the other mutations, on the activity of the ARX protein, their involvement in MR phenotypes should allow a rational design of specific mutants aiding a dissection of the function of ARX.
In total we identified mutations in ARX in ten unrelated MRX families (7 out of the 9 families linked to Xp22.1, 2 out of 148 small families and 1 out of the 40 sporadic cases). Almost all available families with genetic intervals encompassing ARX were found to be mutated (Fig. 4A and 4C). These findings are interesting per se when compared with the very rare mutations (found in one to three families) that have been reported for the other known genes involved in MRX (4). In addition to the involvement of ARX in non-specific MR, further data reported by Strømme et al. (33) who have identified mutations in ARX in families with syndromic forms of mental retardation. These syndromes include: (1) X-linked West syndrome (WS) characterized by the triad of infantile spasms, chaotic electroencephalogram (EEG) patterns termed hypsarrythmia and mental retardation (ISSX, MIM 308350); (2) Partington syndrome (PRTS, MIM 309510) characterized by MR and dystonic movements of the hands; (3) MR associated with myoclonic epilepsy and spasticity. Phenotype/genotype data concerning ARX are particularly striking and uncommon. The spectrum of phenotypes associated with the identical recurrent duplication of the 24 bp of exon 2, predicted to cause an expansion of a polyalanine tract from 12 to 20 alanines, include non-specific forms of mental retardation, West syndrome and Partington syndrome. Understanding the mechanisms underlying this clinical heterogeneity resulting from the same mutation is a difficult and challenging issue. One potential hypothesis to explain this phenotypic heterogeneity could be differences in genetic and environmental backgrounds which are obviously specific to each family.
Molecular bases underlying ARX dysfunction
Mutations identified in ARX include missense mutations, a recurrent in-frame 24 bp duplication, described above, and a small in-frame insertion (304insGCGGCG) leading to an increase of another polyalanine tract containing 16 residues. The relative diversity of mutations in ARX involved in different forms of MR contrasts with the absence of nonsense or frameshift mutations predicted to lead to a complete loss-of-function. MR phenotypes with no obvious brain malformations (detectable by up to date brain imaging techniques) contrast also with certain other severe congenital syndromes resulting from the haploinsufficiency of regulatory homeodomain genes with restricted patterns of expression within the neuroepithelium (2527). These observations suggest that mutations resulting in a complete loss-of-function might lead either to prenatal lethality or to more severe phenotypes associated with cortical dysgenesis and brain malformations. Although gene redundancy cannot be excluded, this hypothesis is supported by the very early (E8) expression of ARX and the restricted patterns of its expression throughout brain development in the telencephalon and ventral thalamus.
The recurrent in- frame duplication of 24 bp detected in five MRX families and in one sporadic case as well as the in-frame insertion (304insGCGGCG) give rise to certain hypotheses concerning the potential molecular mechanisms underlying ARX dysfunction. As all mutations, including missense mutations, have in common only MR, it is reasonable to expect a consistent effect on the expression of genes required for cognitive development, regulated by the transcriptional complexes in which ARX is involved. However, whether these mutations act through a loss-of-function (with some residual activity) or a gain of abnormal function remains an open question. There are at least four other genes in which alanine expansions have been shown to cause human diseases. These include: HOXD13 involved in synpolydactyly (SPD), an inherited abnormality of the hands and feets (28); RUNX2 (known also as CBFA1) involved in cleidocranial dysplasia (CDD) (29); PABP2 involved in oculopharyngeal muscular dystrophy (OPMD) (30); and ZIC2 involved in holoprosencephaly (HPE) (31). Polyalanine expansions are reminiscent of polyglutamine expansions in genes involved in neurodegenerative diseases characterized by the presence of aggregations in deficient neuronal cells. However, it is unlikely that pathophysiological mechanisms resulting from polyalanine expansions are similar to those associated with polyglutamine expansions. Nevertheless, nuclear aggregation has been shown for PABP2 with expanded polyalanine tracts (32).
As far as MR phenotypes resulting from mutations in ARX are concerned, it is reasonable to propose that the observed expansions of the polyalanine tracts and the missense mutations may have various effects depending on the position of the mutation. ARX interacts with DNA as a complex and mutations may affect either proteinprotein interactions and/or DNAprotein interactions. The L33P mutation predicted to alter proteinprotein interactions may lead to a dysregulation of the transcriptional repression activity. Similar reasoning could be proposed for the P353L mutation identified in the ARX homeodomain (33). This missense mutation which is predicted to alter DNAprotein interactions may also lead to a perturbation of gene expression regulated by the transcription complex in which ARX is involved.
ARX and mental deficiency
While major advances have been made in identifying genes involved in X-linked MR with no major brain malformation, our understanding of how a primary molecular defect is translated into MR remains very limited. The defining features that include an overall intelligence quotient (IQ) of less than 70 would imply a relationship between the function of MR-related genes, and the acquisition of higher cognitive functions. With the identification of ARX as a gene involved in MR with wide clinical heterogeneity, further complexity is added to the repertoire of gene families and potential molecular and cellular mechanisms underlying MR. At the expression level, the restricted pattern of ARX during development as well as its distribution in adult brain structures, contrast with the spatial and temporal expression patterns of most MR-related genes. Most of the known genes involved in MRX do not have restricted patterns of expression during development, while in adult stages the expression level is highest in certain structures of the CNS, such as the cortex, hippocampus, dentate gyrus and cerebellum (IL1RAPL, TM4SF2, PAK3; and Oligophrenin) (34, 35 and unpublished data). Also, the striking absence of ARX expression in the cerebellum suggests, at least in MR forms resulting from mutations in ARX, that this structure of the CNS is not primarily involved in the mechanisms underlying the cognitive deficits.
The ARX protein belongs to a subset of aristaless-related paired-class homeodomain proteins. The mouse Arx gene was identified in 1997 (8), but the precise function of the protein and its role in the development of the brain is still unknown. In Drosophila melanogaster, hypomorphic mutations in the highly similar al gene have been shown to affect development of the arista, the posterior scutellar bristle and the scutellum (16). In view of its high level of expression in the ventricular and marginal zones, ARX may act in combination with other genes to regulate neuroepithelial cell proliferation and the timing of neuronal differentiation. Also, the continued expression during cerebral cortex development, and in adult stages, albeit with reduced intensity, suggest that ARX may be essential for the differentiation and maintenance of specific neuronal subtypes in the cerebral cortex. Such processes are likely to be crucial for the development of cognitive function.
Despite the increasing genetic complexity and potential diversity of mechanisms underlying mental retardation, delineation of the monogenic causes of MR, and their molecular and cellular consequences, remains an important reliable approach that should provide insights into the mechanisms that are required for the normal development of human cognitive function.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Family material and patients
We analysed nine extended families with XLMR. Cognitive impairment is the only common feature between patients of these families. Clinical and genetic data concerning MRX54, -36 and -43 were previously reported (6,36,37). Clinical and linkage data for the remaining families are summarised in Table 2 and Fig. 4). In the MRX36 family (36), three females show an intelligence level in the low-normal range as a result of a heterozygous carrier status. In the MRX75 family, the mental retardation was noticed during early childhood and appeared non-progressive. In two other MRX families (P73 and P49), the most important neurological sign was language deficit. The degree of mental retardation in the tested affected family members varied from moderate to profound. For T4- and P49-MRX families, genetic mapping allowed us to exclude the entire X chromosome except the regions indicated in Figure 4A. We also studied a panel of probands from 148 clinically well-characterized small families with at least two boys affected with MR; and 40 sporadic cases of MR. CGG Expansion involved in Fragile X syndrome was excluded by Southern blot analysis using DNA digested with EcoRI/EagI restriction enzymes and StB12-3 probe corresponding to FRAXA locus. In this panel, mutation screening combined with direct sequencing excluded the presence of mutations in OPHN1, TM4SF2, ILRAPL, PAK3, RabGDI1 and MECP2. Ethics committee approval and patient or family consent was obtained.
Bioinformatic analyses
Potential expressed sequences in the candidate region, DXS989DXS1218
2.7 cM, were defined by combining information available in different databases such as Ensembl, (http://www.ensembm.org/) and Unigene, (http://www.ncbi.nlm.gov/UniGene/index.html). Predicted exons were also analysed using BLAST programs and confirmation of their expression was assessed by RTPCR using total RNA extracted from normal fetal brain and lymphoblastoid cell lines.
Mutation analysis
For genes expressed in lymphoblasts, total RNA was extracted from lymphoblastoid cell lines (LCL) and RTPCR was carried out according to standard procedures. Semi-quantitative studies were performed using PCR products obtained with 20 cycles of amplification, while qualitative and direct sequencing of coding regions were performed using 35 cycles. Genes only expressed in brain were analysed at the genomic level using denaturing high pressure liquid chromatography (DHPLC) followed by direct sequencing of PCR fragments that showed abnormal DHPLC profiles. DNA extracted from blood leukocytes or LCL was used to amplify the five exons and the flanking intronic sequences of the ARX gene. Primer sequences and PCR conditions are available upon request. DHPLC condi-tions were chosen according to the Wavemaker program (Transgenomics, Santa Clara, CA, USA). The search for mutations was performed by DHPLC scanning on an automated DHPLC instrument (Transgenomics, Santa Clara, CA, USA). PCR products were subjected to chromatography using appropriate temperatures and acetonitrile gradients. PCR products were eluted with a linear acetonitrile gradient at a flow rate of 0.9 ml/min, and those showing an abnormal DHPLC profile were directly sequenced on an automated sequencer (ABI 377, Perkin-Elmer) using the Dye Terminator method.
Expression analysis
Fetal and adult multiple-tissue Northern blots (Clontech) were hybridized with a 1.5 kb RTPCR fragment extending from the homeodomain to the 3'UTR of ARX, and subsequently washed according to standard procedures. For RTPCR experiments, total RNA samples were prepared from human fetal brain and embryonic, newborn and postnatal (P60) mouse brains. Cells were derived from brains of randomly bred Swiss mice. Glial cells were from newborn mouse cerebral hemispheres and 95% of the cells were identified as type-1 astrocytes. Cultures of neuronal cells were set up from single-cell suspension of fetal brains at 15 days of gestation. Cultures consisted predominantly of neurons (>95%). Amplification by RTPCR was performed according to standard procedures. Products obtained after 20 and 35 cycles of PCR were analysed by Southern blots that were hybridized with internal primers.
Whole-mount and RNA in situ hybridization studies were performed as previously described using a 1.5 kb ARX cDNA fragment to generate sense and antisense probes (38). RNA in situ hybridization using 35S-labelled probes was carried out on mouse sections in 50% formamide solution at 58°C. Sections were washed in 50% formamide and then successively stringent SSC wash solutions, with a final wash at 0.1xSSC at 60°C. Slides were dipped in diluted Kodak NTB2 emulsion and exposed for 715 days. Emulsions were developed and sections counter-stained with toludine blue, mounted in Eukitt, and examined under light microscopy.
GenBank accession numbers
AC002504, human genomic sequence of the RPCI1-258N20 clone containing ARX gene. AI422850, Homo sapiens cDNA IMAGE clone corresponding to ARX 3'UTR; AB006103, mouse Arx mRNA; AB006104, zebrafish Arx mRNA; AAF51505 fly aristaless protein.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
We thank patients, family members and the XLMR European Consortium for their participation in this study. We thank Dr Ponsot for clinical assessment and Mrs Odette Godard for helpful logistic support. This work was supported by grants from Institut National de la Santé et de la Recherche Médicale (INSERM), Fondation pour la Recherche Médicale (FRM, project ARS 2.14), Fondation Electricité de France, European Community (contract No QLG2-1999-00791), Association Française du Syndrome de Rett (AFSR), Fondation France Telecom, and Fondation Jerome Lejeune.
| NOTE ADDED IN PROOF |
|---|
|
|
|---|
Date showing the involvement of ARX in different syndrome forms of mental retardation, including West syndrome and Partington syndrome will be published in Nature Genetics (Stromme et al. (33)).
| FOOTNOTES |
|---|
* To whom correspondence should be addressed at: Laboratoire de Génétique et Physiopathologie des Retards Mentaux, Institut Cochin, CHU Cochin Port Royal, 24 Rue du Fg Saint Jacques, 75014 Paris, France. Tel: +33 1 44 41 24 81; Fax: +33 1 44 41 24 21; Email: chelly{at}cochin.inserm.fr
| REFERENCES |
|---|
|
|
|---|
1 Moser, H.W., Ramey, C.T. and Leonard, C.O. (1990) Mental retardation. In Emery, A.E.H. and Rimoin, D.L. (eds.), Principles and Practice of Medical Genetics. Churchill Livingstone, Edinburgh, 1, pp. 495511.
2 Stevenson, R.E. (2000) Splitting and lumping in the nosology of XLMR. Am. J. Med. Genet., 97, 174182.[Web of Science][Medline]
3 Herbst, D.S. and Miller, J.R. (1980) Nonspecific X-linked mental retardation II: the frequency in British Columbia. Am. J. Med. Genet., 7, 461 469.[Web of Science][Medline]
4 Chelly, J. and Mandel, J.L. (2001) Monogenic causes of X-linked mental retardation. Nat. Rev. Genet., 2, 669680.[Web of Science][Medline]
5 Luo, L. (2000). Rho GTPases in neuronal morphogenesis. Nat Rev Neurosci., 1, 173180.[Web of Science][Medline]
6 Ben Jemaa, L., des Portes, V., Zemni, R., Mrad, R., Maazoul, F., Beldjord, C., Chaabouni, H. and Chelly J. (1999) Refined 2.7 centimorgan locus in Xp21.322.1 for a nonspecific X-linked mental retardation gene (MRX54). Am. J. Med. Genet., 85, 276282.[Web of Science][Medline]
7 Dib, C., Fauré, S., Fizames, C., Samson, D., Drouot, N., Vognal, A., Millasseau, P., Marc, S., Hazan, J., Seboun, E. et al. (1996) A comprehensive genetic map of the human genome based on 50264 microsatellites. Nature, 380, 152154.[Medline]
8 Miura, H., Yanazawa, M., Kato, K., and Kitamura, K. (1997) Expression of a novel aristaless related homeobox gene ARX in the vertebrate telencephalon, diencephalon and floor plate. Mech. Dev., 65, 99109.[Web of Science][Medline]
9
Shisheva, A., Südhof, T. and Czech, P. (1994) Cloning characterization, and expression of a novel GDP dissociation inhibitor isoform from skeletal muscle. Mol. Cell. Biol., 14, 34593468.
10 Kitamura, K., Miura, H., Yanazawa, M., Miyashita, T. and Tako, K. (1997) Expression patters of Brx1 (rieg gene), Sonic hedgehog, Nkx2.2, Dlx1 and Arx during zona limitans intrathalamica and embryonic ventral lateral geniculate nuclear formation. Mech. Dev., 67, 8396.[Web of Science][Medline]
11 Simeone, A., D'Apice, M.R., Nigro, V., Casanova, J., Graziani, F., Acampara, D. and Avantaggiato, V. (1994) Ortopedia, a novel homeobox-containing gene expressed in the developing CNS of both mouse and drosophila. Neuron, 13, 83101.[Web of Science][Medline]
12 Porteus, M., Bulfone, A., Ciaranello, R.D. and Rubenstein, J.L.R. (1991) Isolation and characterization of a novel cDNA clone encoding a homeodomain that is developmentally regulated in the ventral forebtain. Neuron, 7, 221229.[Web of Science][Medline]
13 Price, M., Lemaistre, M., Pischetola, M., DiLauro, R., and Duboule, D. (1991). A mouse gene related to Distal-less shows a restricted expression in the developing forebrain. Nature, 351, 748751.[Medline]
14 Chalepakis, G., Stoykova, A., Wijnholds, J., Trembley, P. and Gruss, P. (1993) Pax: gene regulators in the developing nervous system. J. Neurobiol., 24, 13671384.[Web of Science][Medline]
15 Xuan, S., Baptista, C.A., Balas, G., Tao, W., Soares, V.C., and Eseng, L. (1995) Winged Helix transcription factor BF-1 is essential for the development of the cerebral hemispheres. Neuron, 14, 11411152.[Web of Science][Medline]
16
Schneitz, K., Spielmann, P. and Noll, M. (1993). Molecular genetics of aristaless, a prd-type homeobox gene involved in the morphogenesis of proximal and distal pattern elements in a subset of appendages in drosophila. Genes Dev., 7, 114129.
17 Szostak, J.W. (1992) In vitro genetics. Trends Biochem. Sci., 17, 8993.[Web of Science][Medline]
18 Galliot, B. and Miller, D. (2000) Origin of anterior patterning. How old is our head? Trends Genet., 16, 15.[Web of Science][Medline]
19 Meijlink, F., Beverdam, A., Brouwer, A., Oosterveen, T.C. and Berge D.T. (1999) Vertebrate aristaless-related genes. Int. J. Dev. Biol., 43, 651663.[Web of Science][Medline]
20 Hemmati-Brivanlou, A., de la Torre, J.R., Holt, C. and Harland R.M. (1991) Cephalic expression and molecular characterization of Xenopus En-2. Development, 111, 715724.[Abstract]
21 Han, K. and Manley, J. (1993) Functional domains of the drosophila Engrailed protein. EMBO J., 12, 27232733.[Web of Science][Medline]
22 John, A., Smith, S.T. and Jaynes, J.B. (1995) Inserting the Ftz homeodomain into Engrailed creates a dominant transcriptional repressor that specifically turns off Ftz target genes in vivo. Development, 121, 18011813.[Abstract]
23 Mailhos, C., Andre, S., Mollereau, B., Goriely, A., Hemmati-Brivanlou, A. and Desplan C. (1998). Drosophila Goosecoid requires a conserved heptapeptide for repression of paired-class homeoprotein activators. Development, 125, 937947.[Abstract]
24
Wilson, D., Sheng, G., Lecuit, T., Dostatni, N. and Desplan C. (1993) Cooperative dimerization of paired class homeo domains on DNA. Genes Dev., 7, 21202134.
25 Engelkamp, D. and van Heyningen, V. (1996) Transcription factors in disease. Curr. Opin. Genet. Dev., 6, 334342.[Web of Science][Medline]
26 Boncinelli, E. (1997) Homeobox genes and disease. Curr. Opin. Genet. Dev., 7, 331337.[Web of Science][Medline]
27 Muenke, M. and Beachy, P.A. (2000) Genetics of ventral forebrain development and holoprosencephaly. Curr. Opin. Genet. Dev., 10, 262269.[Web of Science][Medline]
28 Muragaki, Y., Mundlos, S., Upton, J. and Olsen, B.R. (1996) Altered growth and branching patterns in synpolydactyly caused by mutations in HOXD13. Science, 272, 548551.[Abstract]
29 Mundlos, S., Otto, F., Mundlos, C., Mulliken, J.B., Aylsworth, A.S., Albright, S., Lindhout, D., Cole, W.G., Henn, W., Knoll, J.H. et al. (1997). Mutations involving the transcription factor CBFA1 cause cleidocranial dysplasia. Cell, 89, 773779.[Web of Science][Medline]
30 Brais, B., Bouchard, J.P., Xie, Y.G., Rochefort, D.L., Chretien, N., Ome, F.M., Lafreniere, R.G., Rommens, J.M., Uyama, E., Nohira, O. et al. (1998) Short GCG expansion in the PABP2 gene cause oculopharyngeal muscular dystrophy. Nature Genet., 18, 164167.[Web of Science][Medline]
31 Brown, S.A., Warburton, D., Brown, L.Y., Yu, C.Y., Roeder, E.R., Stengel-Rutkowski, S., Hennekam, R.C. and Muenke, M. (1998) Holoprosencephaly due to mutations in ZIC2, a homologue of Drosophila odd-paired. Nature Genet., 20, 180183.[Web of Science][Medline]
32
Calado, A., Tome, F.M., Brais, B., Rouleau, G.A., Kuhn, U., Wahle, E. and Carmo-Fonseca, M. (2000) Nuclear inclusions in oculopharyngeal muscular dystrophy consist of poly(A) binding protein aggregates with sequester poly(A) RNA. Hum. Mol. Genet., 9, 23212328.
33 Strømme, P., Mangelsdorf, M.E., Shaw, M.A., Lower, K.M., Lewis, S.M.S., Bruyere, H., Gedeon, A.K., Scheffer, I.E., Turner, G., Partington, M. et al. (2002) A novel human homeobox gene, Aristaless, is mutated in various X-linked neurological disorders. Nature Genet., (advanced online publication available).
34 Carrié, A., Jun, L., Bienvenu, T., Vinet, M.C., Van Buggenhout, G., Frints, S., Hamel, B., Moraine, C., Ropers, H.H., Strom, T. et al. (1999) A novel member of the IL-1 receptor family highly expressed in hippocampus and involved in X-linked mental retardation. Nature Genet., 23, 2531.[Web of Science][Medline]
35 Allen, K., Joseph, G.G., Bagrodia, S., Partington, M.W., MacMillan, J.C., Cerione, R.A., Mulley, J.C., and Walsh, C. (1998) PAK3 mutation in nonspecific X-linked mental retardation. Nature Genet., 20, 2530.[Web of Science][Medline]
36 Claes, S., Gu, X.X., Legius, E., Lorenzetti, E., Marynen, P., Fryns, J.P., Cassiman, J.J. and Raeymaekers, P. (1996) Linkage analysis in three families with nonspecific X-linked mental retardation. Am. J. Med. Genet., 64, 137146.[Web of Science][Medline]
37 Hamel, B.C.J., Smit, A.P., van den Helm, B., Smeets, D.F., Knoers, N.V., van Roostmalen, T., Thoonen, G.H., Assman-Hulsmans, C.F., Ropers, H.H. and Mariman, E.C. (1999) Four families (MRX43, MRX44, MRX45, MRX2) with nonspecific X-linked mental retardation: clinical and psychometric data and results of linkage analysis. Am. J. Med. Genet., 85, 290304.[Web of Science][Medline]
38 Wilkinson, D.G. In situ hybridization. In Stern, C.D. and Holland, P.W.H. (eds.), Essential Developmental Biology. IRL Press, Oxford, UK, pp 257274.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
K. Kitamura, Y. Itou, M. Yanazawa, M. Ohsawa, R. Suzuki-Migishima, Y. Umeki, H. Hohjoh, Y. Yanagawa, T. Shinba, M. Itoh, et al. Three human ARX mutations cause the lissencephaly-like and mental retardation with epilepsy-like pleiotropic phenotypes in mice Hum. Mol. Genet., October 1, 2009; 18(19): 3708 - 3724. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Lin, W. Ye, L. Cai, X. Meng, G. Ke, C. Huang, Z. Peng, Y. Yu, J. A. Golden, A. M. Tartakoff, et al. The Roles of Multiple Importins for Nuclear Import of Murine Aristaless-related Homeobox Protein J. Biol. Chem., July 24, 2009; 284(30): 20428 - 20439. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Price, J. W. Yoo, D. L. Burgess, F. Deng, R. A. Hrachovy, J. D. Frost Jr, and J. L. Noebels A Triplet Repeat Expansion Genetic Mouse Model of Infantile Spasms Syndrome, Arx(GCG)10+7, with Interneuronopathy, Spasms in Infancy, Persistent Seizures, and Adult Cognitive and Behavioral Impairment J. Neurosci., July 8, 2009; 29(27): 8752 - 8763. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. D. Marsh and J. A. Golden Developing an animal model for infantile spasms: pathogenesis, problems and progress Dis. Model. Mech., July 1, 2009; 2(7-8): 329 - 335. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Marsh, C. Fulp, E. Gomez, I. Nasrallah, J. Minarcik, J. Sudi, S. L. Christian, G. Mancini, P. Labosky, W. Dobyns, et al. Targeted loss of Arx results in a developmental epilepsy mouse model and recapitulates the human phenotype in heterozygous females Brain, June 1, 2009; 132(6): 1563 - 1576. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. T. Fulp, G. Cho, E. D. Marsh, I. M. Nasrallah, P. A. Labosky, and J. A. Golden Identification of Arx transcriptional targets in the developing basal forebrain Hum. Mol. Genet., December 1, 2008; 17(23): 3740 - 3760. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Colasante, P. Collombat, V. Raimondi, D. Bonanomi, C. Ferrai, M. Maira, K. Yoshikawa, A. Mansouri, F. Valtorta, J. L. R. Rubenstein, et al. Arx Is a Direct Target of Dlx2 and Thereby Contributes to the Tangential Migration of GABAergic Interneurons J. Neurosci., October 15, 2008; 28(42): 10674 - 10686. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Fallet-Bianco, L. Loeuillet, K. Poirier, P. Loget, F. Chapon, L. Pasquier, Y. Saillour, C. Beldjord, J. Chelly, and F. Francis Neuropathological phenotype of a distinct form of lissencephaly associated with mutations in TUBA1A Brain, September 1, 2008; 131(9): 2304 - 2320. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Friocourt, S. Kanatani, H. Tabata, M. Yozu, T. Takahashi, M. Antypa, O. Raguenes, J. Chelly, C. Ferec, K. Nakajima, et al. Cell-Autonomous Roles of ARX in Cell Proliferation and Neuronal Migration during Corticogenesis J. Neurosci., May 28, 2008; 28(22): 5794 - 5805. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Guerrini, F. Moro, M. Kato, A. J. Barkovich, T. Shiihara, M. A. McShane, J. Hurst, M. Loi, J. Tohyama, V. Norci, et al. Expansion of the first PolyA tract of ARX causes infantile spasms and status dystonicus Neurology, July 31, 2007; 69(5): 427 - 433. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E Schwartz, P. S Tarpey, H. A Lubs, A. Verloes, M. M May, H. Risheg, M. J Friez, P A. Futreal, S. Edkins, J. Teague, et al. The original Lujan syndrome family has a novel missense mutation (p.N1007S) in the MED12 gene J. Med. Genet., July 1, 2007; 44(7): 472 - 477. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Troester, T. Trachtenberg, and V. Narayanan A Novel Mutation of the ARX Gene in a Male With Nonsyndromic Mental Retardation J Child Neurol, June 1, 2007; 22(6): 744 - 748. [Abstract] [PDF] |
||||
![]() |
E. Colombo, P. Collombat, G. Colasante, M. Bianchi, J. Long, A. Mansouri, J. L. R. Rubenstein, and V. Broccoli Inactivation of Arx, the Murine Ortholog of the X-Linked Lissencephaly with Ambiguous Genitalia Gene, Leads to Severe Disorganization of the Ventral Telencephalon with Impaired Neuronal Migration and Differentiation J. Neurosci., April 25, 2007; 27(17): 4786 - 4798. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Szczaluba, M. Nawara, K. Poirier, J. Pilch, M. Gajdulewicz, K. Spodar, J. Chelly, J. Bal, and T. Mazurczak Genotype-phenotype associations for ARX gene duplication in X-linked mental retardation Neurology, December 12, 2006; 67(11): 2073 - 2075. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Lamant, F. Smih, R. Harmancey, P. Philip-Couderc, A. Pathak, J. Roncalli, M. Galinier, X. Collet, P. Massabuau, J.-M. Senard, et al. ApoO, a Novel Apolipoprotein, Is an Original Glycoprotein Up-regulated by Diabetes in Human Heart J. Biol. Chem., November 24, 2006; 281(47): 36289 - 36302. [Abstract] [Full Text] [PDF] |
||||
![]() |
F L Raymond X linked mental retardation: a clinical guide J. Med. Genet., March 1, 2006; 43(3): 193 - 200. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Barkovich, R. I. Kuzniecky, G. D. Jackson, R. Guerrini, and W. B. Dobyns A developmental and genetic classification for malformations of cortical development Neurology, December 27, 2005; 65(12): 1873 - 1887. [Abstract] [Full Text] [PDF] |
||||
![]() |
F Laumonnier, S Holbert, N Ronce, F Faravelli, S Lenzner, C E Schwartz, J Lespinasse, H Van Esch, D Lacombe, C Goizet, et al. Mutations in PHF8 are associated with X linked mental retardation and cleft lip/cleft palate J. Med. Genet., October 1, 2005; 42(10): 780 - 786. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tucker, M. Sieber, M. Morphew, and M. Han The Caenorhabditis elegans aristaless Orthologue, alr-1, Is Required for Maintaining the Functional and Structural Integrity of the Amphid Sensory Organs Mol. Biol. Cell, October 1, 2005; 16(10): 4695 - 4704. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Melkman and P. Sengupta Regulation of chemosensory and GABAergic motor neuron development by the C. elegans Aristaless/Arx homolog alr-1 Development, April 15, 2005; 132(8): 1935 - 1949. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kato and W. B. Dobyns X-Linked Lissencephaly With Abnormal Genitalia as a Tangential Migration Disorder Causing Intractable Epilepsy: Proposal for a New Term, "Interneuronopathy" J Child Neurol, April 1, 2005; 20(4): 392 - 397. [Abstract] [PDF] |
||||
![]() |
S.-i. Yoshihara, K. Omichi, M. Yanazawa, K. Kitamura, and Y. Yoshihara Arx homeobox gene is essential for development of mouse olfactory system Development, February 15, 2005; 132(4): 751 - 762. [Abstract] [Full Text] [PDF] |
||||
![]() |
E Scala, F Ariani, F Mari, R Caselli, C Pescucci, I Longo, I Meloni, D Giachino, M Bruttini, G Hayek, et al. CDKL5/STK9 is mutated in Rett syndrome variant with infantile spasms J. Med. Genet., February 1, 2005; 42(2): 103 - 107. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. M. Nasrallah, J. C. Minarcik, and J. A. Golden A polyalanine tract expansion in Arx forms intranuclear inclusions and results in increased cell death J. Cell Biol., November 8, 2004; 167(3): 411 - 416. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Amiel, D. Trochet, M. Clement-Ziza, A. Munnich, and S. Lyonnet Polyalanine expansions in human Hum. Mol. Genet., October 1, 2004; 13(suppl_2): R235 - R243. [Abstract] [Full Text] [PDF] |
||||
![]() |
V Cantagrel, A-M Lossi, S Boulanger, D Depetris, M-G Mattei, J Gecz, C E Schwartz, L Van Maldergem, and L Villard Disruption of a new X linked gene highly expressed in brain in a family with two mentally retarded males J. Med. Genet., October 1, 2004; 41(10): 736 - 742. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. E. Weese-Mayer and E. M. Berry-Kravis Genetics of Congenital Central Hypoventilation Syndrome: Lessons from a Seemingly Orphan Disease Am. J. Respir. Crit. Care Med., July 1, 2004; 170(1): 16 - 21. [Full Text] [PDF] |
||||
![]() |
T Kleefstra, H G Yntema, A R Oudakker, M J G Banning, V M Kalscheuer, J Chelly, C Moraine, H-H Ropers, J-P Fryns, I M Janssen, et al. Zinc finger 81 (ZNF81) mutations associated with X-linked mental retardation J. Med. Genet., May 1, 2004; 41(5): 394 - 399. [Full Text] [PDF] |
||||
![]() |
M. Kato and W. B. Dobyns X-Linked Lissencephaly With Abnormal Genitalia as a Tangential Migration Disorder Causing Intractable Epilepsy: Proposal for a New Term, "Interneuronopathy" J Child Neurol, March 1, 2004; 19(3): 392 - 397. [Abstract] [PDF] |
||||
![]() |
G. Uyanik, L. Aigner, P. Martin, C. Gross, D. Neumann, H. Marschner-Schafer, U. Hehr, and J. Winkler ARX mutations in X-linked lissencephaly with abnormal genitalia Neurology, July 22, 2003; 61(2): 232 - 235. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kato, S. Das, K. Petras, Y. Sawaishi, and W.B. Dobyns Polyalanine expansion of ARX associated with cryptogenic West syndrome Neurology, July 22, 2003; 61(2): 267 - 276. [Full Text] [PDF] |
||||
![]() |
M. Kato and W. B. Dobyns Lissencephaly and the molecular basis of neuronal migration Hum. Mol. Genet., April 2, 2003; 12(90001): R89 - 96. [Abstract] [Full Text] [PDF] |
||||
![]() |
P Stromme, S J Bakke, A Dahl, and J Gecz Brain cysts associated with mutation in the Aristaless related homeobox gene, ARX J. Neurol. Neurosurg. Psychiatry, April 1, 2003; 74(4): 536 - 538. [Abstract] [Full Text] [PDF] |
||||
![]() |
I Longo, S G M Frints, J-P Fryns, I Meloni, C Pescucci, F Ariani, M Borghgraef, M Raynaud, P Marynen, C Schwartz, et al. A third MRX family (MRX68) is the result of mutation in the long chain fatty acid-CoA ligase 4 (FACL4) gene: proposal of a rapid enzymatic assay for screening mentally retarded patients J. Med. Genet., January 1, 2003; 40(1): 11 - 17. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

















