Human Molecular Genetics, 2003, Vol. 12, No. 11 1321-1328
DOI: 10.1093/hmg/ddg138
© 2003 Oxford University Press
Trans mobilization of genomic DNA as a mechanism for retrotransposon-mediated exon shuffling
1Department of Radiological Sciences, Hiroshima Prefectural College of Health Sciences, 1-1 Gakuen-machi, Mihara, Hiroshima 723-0053, Japan and 2Hiroshima Prefecture Collaboration of Regional Entities for the Advancement of Technological Excellence, JST, 3-10-32 Kagamiyama, Higashihiroshima, Hiroshima 739-0046, Japan
Received December 17, 2002; Accepted March 24, 2003
| ABSTRACT |
|---|
|
|
|---|
Exon shuffling, the juxtaposition and new combinations of exons from different genes, facilitates evolutionary changes by increasing protein diversity or by generating new function. Exon shuffling is generated as a consequence of segmental duplications. Long interspersed element (LINE)-1 (L1)-mediated 3' transduction is a potential pathway for exon shuffling by which L1 associates 3' flanking DNA in cis as a read-through transcript and carries the DNA to a new genomic location. In this pathway, however, the targets are limited to the regions located 3' to L1s. Here we propose that the genomic DNA distant from L1 may be mobilized by an alternative (trans) action of L1. A partial ATM sequence containing a single exon and flanking introns has been retrotransposed to a new genomic location on chromosome 7. There was no L1 around the exon of the authentic ATM locus. An unusual feature that the poly(A) tail tagged to the transposed sequence oriented oppositely to the ATM's transcriptional orientation suggests that a trans action of reverse transcriptase on antisense transcript has driven the duplication of genomic DNA without removing introns. Taking account of similar duplication events in previous studies, a certain class of segmental duplications in the human genome may be accounted for by the trans action of retrotransposon machinery.
| INTRODUCTION |
|---|
|
|
|---|
Segmental duplications involving the transfer of a partial genomic sequence from one chromosomal site to another are abundant in the human genome (13). Many of the segmental duplications have emerged during the past 35 million years, some of which may represent critical genetic changes associated with primate evolution (46). An important outcome of segmental duplications is the evolution of new function by the process of exon shuffling (79). A potential mechanism for exon shuffling is the long interspersed element (LINE)-1 (L1)-mediated 3' transduction. Upon retrotransposition, L1 often associates 3' flanking DNA as a read-through transcript and carries the non-L1 sequence to a new genomic location (1012). L1 is the most abundant retrotransposon in the human genome, and it serves as a major source of reverse transcriptase activity (1315). The 3' transduction is likely to be an efficient mechanism because sequence homology or physical proximity between the donor and recipient DNA is not required. As this operates in copy-and-paste manner via RNA intermediates, the donor sequences remain unaffected. In this pathway, however, only those regions that are located 3' to the active L1s are the targets for duplication.
L1 has a capability of mobilizing another class of non-L1 sequence by acting in trans to cellular RNA substrates. A major consequence is the formation of processed pseudogenes. They are generated by the reverse transcription of intronless mRNAs that have undergone RNA splicing, followed by the integration of resultant cDNAs to new genomic locations (16). The amplification of Alu elements, the most abundant non-autonomous short interspersed elements in the human genome, is also suspected to be due to a similar mechanism (17). The integration of processed pseudogenes occasionally leads to the generation of new genes (18,19), but the duplicated segments lack intronexon structure. It would be plausible to suppose further that the L1 machinery can also act in trans to unspliced RNA intermediates, not intronless mRNAs, occasionally transcribed from antisense strand, and let the intron-containing cDNAs integrate to new genomic locations. Then possible targets to be mobilized by the L1-mediated mechanism would not be limited to the 3' flanking regions but extended to the majority of the other genomic regions, providing the L1 machinery with an additional capability for exon shuffling. Here we propose that such a mechanism might have operated to generate a certain class of gene duplication events in the human genome.
| RESULTS AND DISCUSSION |
|---|
|
|
|---|
The ATM (AT, mutated) is the gene responsible for the human autosomal-recessive disorder ataxiatelangiectasia (20). The ATM is located at chromosome 11q22.3, spans the 146 kb genomic region, and contains 66 exons (21,22). The presence of a partial ATM sequence on chromosome 7 was first recognized through a Southern blot analysis. An ATM cDNA probe containing nucleotides 24145433 of ATM ORF (exons 1838 of the ATM gene) detected two unusual bands that are present in human diploid fibroblasts but not in the human chromosome-11-containing somatic cell hybrids (Fig. 1A). We supposed these bands represent ATM-like sequence outside the ATM locus. Additional analyses revealed they originate from chromosome 7. We next screened the human chromosome-7-specific genomic library (LA07NS01, EcoRI-digested DNA cloned in Charon21A vector), and isolated a positive clone (LA07NS01-atmr). In the 5442 bp LA07NS01-atmr insert, a partial ATM sequence was embedded in the 1126 bp region located between the two disrupted L1ME ORF2 blocks (Fig. 2). This corresponds to the region containing exon 30 and flanking introns of the ATM locus ranging from nucleotide 75894 (intron 29, IVS30 -700) to 77075 (intron 30, IVS30 +295) of the ATM genomic sequence (GenBank accession no. U82828) (22). A difference from the authentic ATM locus was the occurrence of a 5' inversion (the 454 bp region around exon 30, ATM 7662277075). By a BLAST search, this sequence was mapped to chromosome 7p11.2 (GenBank accession no. NT_033968, nucleotides 33768393382279) located within the 280 kb region between the two hypothetical genes LOC223000 and LOC222001. Because exon 30 was the only exon included in the partial ATM sequence on chromosome 7, the ATM cDNA probe (ORF 24145433) should detect a single extra band (5435, 15 316 or 11 852 bp) for each restriction enzyme (EcoRI, HindIII or MspI, respectively; Fig. 1B and C). Southern blot results (Fig. 1A, upper right panel) agreed with this assumption, although the 11 852 bp MspI band was hardly discernible from the 10 635 bp band derived from the authentic ATM locus. Also, we performed a BLAST search of the whole ATM locus (91 909 nucleotides excluding interspersed repeats) against the draft human genome sequence, but we detected no additional duplication event involving another part of the ATM locus.
|
|
Molecular features suggested that this duplication be mediated by L1 retrotransposition (Fig. 2). The ATM-derived sequence was flanked by 15 bp target site duplications (TSDs). The sequence around the 5' end of the 5' TSD (TTAAAA) matched with the consensus sequence for L1 endonuclease cleavage site (23). There was found a poly(A) tail immediately preceding the 3' TSD. No apparent polyadenylation signal was recognized. Instead, a 61 bp sequence had been lost from the 3' terminus of the ATM insert. The deletion (ATM 7590175961) involved the A-rich linker sequence connecting the two Alu monomers in the Alu-Jb element oriented oppositely to the ATM gene, where resides a sequence AATATAAA (complementary to ATM 7592075927). Probably there once was a canonical polyadenylation signal AATAAA, which has degenerated by subsequent A/T substitution at position 3 or 5. Loss of the 3' terminus polyadenylation signal is occasionally seen in naturally occurring or experimentally induced L1 retrotransposition (12,16). In one relevant example (12) (case of gi 4006838) where L1 associated with a partial Alu-Y element as a 3'-transduced segment, the region around the polyadenylation signal had been lost from the Alu-Y 3' terminus, whereas the downstream poly(A) tail and 3' TSD remained intact. The occurrence of inversion is also a hallmark of L1 retrotransposition. The inversion points associated with L1 retrotransposition are known to cluster within the region 722922 bp from the 3' end poly(A) tail (24). The distance between the inversion point and the 3' end was 729 bp in our case, which is within the predicted range. Duplication of a short stretch of nucleotides at the inversion point (duplication of 14 nucleotides in our case) is also a feature characteristic to L1-associated inversions. Because no L1 element was present neither adjacent to the retrotransposed ATM insert nor around the authentic ATM exon 30, the mobilization of the ATM sequence to chromosome 7 cannot by explained simply by 3' transduction. Conspicuously the orientation of poly(A) tail was opposite to the transcriptional orientation of the ATM gene. One possible explanation would be that a part of the opposite strand of the ATM locus spanning exon 30 was transcribed and processed by the addition of a poly(A) tail, followed by the reverse transcription by the L1 machinery.
To estimate the time of this retrotransposition during primate evolution, we searched for homologous loci in non-human primates. PCR amplification using a primer pair (P1+P2) giving a 3281 bp product in the human (LA07NS01-atmr 1095-4375) gave rise to a similar band in the chimpanzee (Pan troglodytes) or the gorilla (Gorilla gorilla), but a shorter band in the orangutan (Pongo pygmaeus; Fig. 3). Sequence analyses revealed that the bands detected in the chimpanzee and the gorilla represent the loci homologous to the human chromosome-7 locus containing the ATM insert, while the shorter band in the orangutan represents the ancestral locus without the ATM insert (Fig. 4). The longer PCR band (P1+P3) seen in the orangutan (Fig. 3) proved to reflect the insertion of a 306 bp Alu-Y element between L1PA5 and L1ME ORF2. It is therefore estimated that this retrotransposition event occurred after the divergence of the genus Pongo but before the divergence of the genus Gorilla from Hominidae lineage, that is about 510 million years ago. The extent of sequence identity between the two paralogous ATM loci (96.2% for the human, 95.7% for the chimpanzee, 95.6% for the gorilla) is consistent with this estimate. We also compared the sequence around exon 30 of the ATM locus among primates (Fig. 5). The genomic structure in this region was highly conserved in the six species belonging to the suborder Anthropoidea. The genomic structure was somewhat different in the ring-tailed lemur (Lemur catta) which belongs to the suborder Prosimii, but a full-length L1 element was not present in any species. The results further suggest that the region around ATM exon 30 has long been devoid of an active L1 element, which might have driven 3' transduction, during primate evolution.
|
|
|
Two gene duplication events with similar molecular features have been documented previously. The case of the transposition of exon 9 and flanking introns of the cystic fibrosis transmembrane conductance regulator (CFTR) gene is quite similar to ours (25). No L1 element was found around exon 9 of the CFTR locus, and the orientation of poly(A) tail is opposite to the CFTR's transcriptional orientation. An inversion has occurred within a partial L1 sequence co-integrated 5' to the CFTR sequence, and the distance between the inversion point and the 3' end poly(A) tail is 772 bp, which is comparable to ours (729 bp). The other case is the transposition of a part of the melanin-concentrating hormone (MCH) gene. This has generated a new chimeric gene, the pro MCH-like (PMCHL) gene, which contains a partial MCH sequence with a poly(A) tail oriented oppositely to MCH's transcriptional orientation (26,27). It is to be noted that, in both cases, the duplicated units include exon-containing genomic DNA of functional genes.
It remains possible, however, that the retrotransposition event we described here resulted from L1-mediated 3' transduction. Namely, it is possible that there once was a full-length L1 in the opposite orientation of the ATM gene, upstream of exon 30, which generated a read-through transcript, and carried the ATM sequence to a new genomic location on chromosome 7. The L1 may have been 10 kb or more distant from exon 30, because splicing may have eliminated the sequence between them. Extensive 5' truncation would leave no evidence of the L1 sequence, resulting in a very similar structure to our case (Fig. 6, upper right). In the ATM gene, there are three full-length, currently inactive L1s in intron 18 (ATM 4831054319), intron 63 (ATM 144786150805), as well as in the 3' untranslated region (ATM 160948167473). However, because they are oriented in the same direction as the ATM gene, they could not be the driver of exon-30 transduction. However, recent evidence suggests that there is strong selective pressure against the accumulation of full-length L1s in human DNA (28). It is therefore possible that the once-active L1 involved in this event has now been lost from the population.
|
An equally plausible explanation we propose is that a partial, antisense ATM transcript was retrotransposed in trans by the L1 machinery (Fig. 6, lower left). The generation of an aberrant, antisense transcript may have been initiated from a cryptic promoter on the opposite strand of the ATM gene. To be captured in trans by the L1 machinery, the transcript would have to compete with the L1 RNA for the L1-encoded proteins, either within the nucleus or after being transported to the cytoplasm. By a BLAST search of ATM mRNA sequence against dbEST, we identified five human expression sequence tags (ESTs) possibly representing antisense ATM transcripts. The ESTs contain the genomic sequence around exon 53 (ATM 119076119232 for GenBank accession no. AA412245, ATM 118749119164 for AA912542 and ATM 118749119154 for AA960806) or exons 4344 (ATM 103532103912 for GenBank accession no. AA460148 and ATM 103488103957 for AA460746) of the ATM locus. Interestingly, three of them (AA412245, AA460148 and AA460746) are expressed in testis. The others may also be of testis-origin because they are derived from a pooled library made from fetal lung, testis and B-cell cDNAs. The antisense ATM transcripts may represent some unknown tissue-specific function. Otherwise, their existence may be a consequence of reduced RNA surveillance against antisense or nonsense transcripts in testis (29,30). In view of the elevated L1 activity in the germline, it is conceivable that the L1 machinery has targeted such testis-specific antisense transcripts. The presence of a partial Alu-Jb sequence at the 3' end of the ATM transcript may have been another factor. Alu elements are thought to amplify their copies by the L1 machinery. Alu RNA is a good template for the target-primed reverse transcription by L1 ORF2 protein in vitro (31). Two signal recognition particle proteins (SRP9 and SRP14) bind with high affinity to the 7SL RNA domain of Alu (32). It is suggested that the SRP9/14-Alu complex binds to the large ribosomal subunit, leaving Alu poly(A) suitably positioned to interact with L1 ORF2 protein (17). The Alu-like 3' structure of the ATM transcript may have facilitated its access to the L1-encoded proteins.
L1-encoded proteins preferentially mobilize in cis the transcript from which they are encoded (16,33). The 3' transduction (cis-mobilization) is therefore an efficient mechanism to mobilize the 3' flanking exons. On the other hand, the trans-mobilization of distant genomic DNA would be another strategy of L1 machinery to shuffle exons. This complements the capability of 3' transduction because virtually any genomic regions become the potential targets. The length of genomic DNA mobilized by the trans action of L1 would, as in other L1-mediated events, usually not exceed 1 kb due to the inherent low processivity of L1 reverse transcriptase (1,1015,34). Therefore, a certain proportion of short segmental duplications of no more than 1 kb, as well as the resultant exon shuffling events, is likely to be accounted for by this mechanism.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell culture
Non-human primate cell lines were purchased from Coriell Cell Repository: GM03448A for chimpanzee, Pan troglodytes; AG05251B for lowland gorilla, Gorilla gorilla; GM04272 for orangutan, Pongo pygmaeus; GM03446 for cab-eating macaque, Macaca fascicularis; AG05352 for black-handed spider monkey Ateles geoffroyi; and AG07099A for ring-tailed lemur, Lemur catta. Mouse A9 and A9-derived human chromosome-11-containing somatic cell hybrid cell line were gifts from M. Oshimura.
DNA preparation, RNA preparation and nucleotide sequencing
Genomic DNA was prepared using DNA Extraction Kit (Stratagene, CA, USA). Plasmid DNA was prepared using QIAprep spin miniprep column (Qiagen GmbH). Total RNA was prepared using Trizol reagent (Invitrogen, CA, USA). Nucleotide sequencing was performed using BigDye Terminator Cycle Sequencing FS Ready Reaction Kit (Applied Biosystems, CA, USA) and a DNA sequencer (Applied Biosystems, model ABI Prism 310 Genetic Analyzer). Identification of interspersed repeats was performed by the CENSOR program (35).
Southern hybridization
The ATM cDNAs were synthesized by the RTPCR method. Four sense and four antisense primers derived from the ATM mRNA sequence were used to synthesize four overlapping cDNA fragments (nucleotides 13033, 24145433, 50628091 and 74539171 of ATM ORF). Primer sequences and procedures for Southern blot analysis were described previously (36).
Library screening
Human chromosome-7-specific genomic library LA07NS01 constructed by cloning the EcoRI-digested DNA from hamster/human MR3.31 6TG6 hybrids into Charon 21A lambda phage vector (37) was purchased from American Type Culture Collection. The library was plated at a density of 10 00020 000 plaques per plate, and 600 000 clones were screened with a 3.02 kb ATM cDNA probe (nucleotides 24145433). Secondary and tertiary screening were used to purify positive clones. Lambda DNA was prepared by using Lambda Quick! Spin Kit (BIO 101, CA, USA). Excised inserts were recloned in ZAP Express Vector (Stratagene, CA, USA), and liberated from the plaques with the ExAssist/SOLR in vivo excision protocol (Stratagene, CA, USA).
PCR
PCR amplification of reverse-transcribed cDNA, lambda phage insert or genomic DNA from non-human primates was performed by eLONGase amplification system (Invitrogen, CA, USA). For the amplification of phage insert DNA, a pair of Charon 21A vector primers (5'GTTGGCAGGGATATTCTGGC3'; 5'AGGACGTAGCCAGACGGAAC3') was used. For the amplification of the region around the retrotransposed ATM insert, three primers (P1, 5'CTGCAATCTACTCTTCTGAC3'; P2, 5'ACATGAGGTCAAAAGTCTTC3'; and P3, 5'GAAGCACAGTAAAATCAAGC3') were used. For the amplification of the region around exon 30 of the ATM locus, two primers (ATM29F, 5'TGTGGTGGAGTTATTGATGA3'; ATM31R, 5'TCAGCTGCTTGCTCACATAT3') were used. The PCR products derived from non-human primate DNA were cloned in pGEM-T Easy Vector by TA cloning protocol (Promega, WI, USA).
| ACKNOWLEDGEMENTS |
|---|
This work was supported by grants-in-aid from the Ministry of Education, Culture, Sports, Science and Technology of Japan to Y.E.
| FOOTNOTES |
|---|
* To whom correspondence should be addressed. Tel: +81 848601171; Fax: +81 848601129; Email: ezima{at}hpc.ac.jp
| REFERENCES |
|---|
|
|
|---|
- International Human Genome Sequencing Consortium (2001) Initial sequencing and analysis of the human genome. Nature, 409, 860921.[CrossRef][Medline]
-
Venter, J.C., Adams, M.D., Myers, E.W., Li, P.W., Mural, R.J., Sutton, G.G., Smith, H.O., Yandell, M., Evans, C.A., Holt, R.A. et al. (2001) The sequence of the human genome. Science, 291, 13041351.
[Abstract/Free Full Text] -
Bailey, J.A., Yavor, A.M., Massa, H.F., Trask, B.J. and Eichler, E.E. (2001) Segmental duplications: organization and impact within the current human genome project assembly. Genome Res., 11, 10051017.
[Abstract/Free Full Text] - Eichler, E.E. (2001) Recent duplication, domain accretion and the dynamic mutation of the human genome. Trends Genet., 17, 661669.[CrossRef][Web of Science][Medline]
- Bailey, J.A., Yavor, A.M., Viggiano, L., Misceo, D., Horvath, J.E., Archidiacono, M., Schwartz, S., Rocchi, M. and Eichler, E.E. (2002) Human-specific duplication and mosaic transcripts: the recent paralogous structure of chromosome 22. Am. J. Hum. Genet., 70, 83100.[CrossRef][Web of Science][Medline]
- Samonte, R.V. and Eichler, E.E. (2002) Segmental duplications and the evolution of the primate genome. Nat. Rev. Genet., 3, 6572.[Web of Science][Medline]
- Gilbert, W. (1978) Why genes in pieces? Nature, 271, 501.[CrossRef][Medline]
- Patthy, L. (1999) Genome evolution and the evolution of exon-shufflinga review. Gene, 238, 103114.[CrossRef][Web of Science][Medline]
-
Jones, J.M., Huang, J.-D., Mermall, V., Hamilton, B.A., Mooseker, M.S., Escayg, A., Copeland, N.G., Jenkins, N.A. and Meisler, M.H. (2000) The mouse neurological mutant flailer expresses a novel hybrid gene derived by exon shuffling between Gnb5 and Myo5a. Hum. Mol. Genet., 9, 821828.
[Abstract/Free Full Text] -
Moran, J.V., DeBerardinis, R.J. and Kazazian, H.H. Jr. (1999) Exon shuffling by L1 retrotransposition. Science, 283, 15301534.
[Abstract/Free Full Text] -
Goodier, J.L., Ostertag, E.M. and Kazazian, H.H. Jr. (2000) Transduction of 3'-flanking sequences is common in L1 retrotransposition. Hum. Mol. Genet., 9, 653657.
[Abstract/Free Full Text] -
Pickeral, O.K., Makalowski, W., Boguski, M.S. and Boeke, J.D. (2000) Frequent human genomic DNA transduction driven by LINE-1 retrotransposition. Genome Res., 10, 411415.
[Abstract/Free Full Text] - Kazazian, H.H. Jr. and Moran, J.V. (1998) The impact of L1 retrotransposons on the human genome. Nat. Genet., 19, 1924.[CrossRef][Web of Science][Medline]
- Smit, A.F.A. (1999) Interspersed repeats and other mementos of transposable elements in mammalian genomes. Curr. Opin. Genet. Dev., 9, 657663.[CrossRef][Web of Science][Medline]
-
Kazazian, H.H. Jr. (2000) L1 retrotransposons shape the mammalian genome. Science, 289, 11521153.
[Free Full Text] - Esnault, C. Maestre, J. and Heidmann, T. (2000) Human LINE retrotransposons generate processed pseudogenes. Nat. Genet., 24, 363367.[CrossRef][Web of Science][Medline]
- Boeke, J.D. (1997) LINEs and Alusthe polyA connection. Nat. Genet., 16, 67.[CrossRef][Web of Science][Medline]
- Long, M. and Langley, C.H. (1993) Natural selection and the origin of jingwei, a chimeric processed functional gene in Drosophila. Science, 260, 9195.
-
Long, M. (2000) A new function evolved from gene fusion. Genome Res., 10, 16551657.
[Free Full Text] - Sedgwick, R.P. and Boder, E. (1991) Ataxiatelangiectasia. In Vinken, P.J., Bruyn, G.W. and Klawans, H.L. (eds), Handbook of Clinical Neurology, Vol. 16. Elsevier Science, Oxford, pp. 347423.
-
Savitsky, K., Bar-Shira, A., Gilad, S., Rotman, G., Ziv, Y., Vanagaite, L., Tagle, D.A., Smith, S., Uziel, T., Sfez, S. et al. (1995) A single ataxia telangiectasia gene with a product similar to PI-3 kinase. Science, 268, 17491753.
[Abstract/Free Full Text] -
Platzer, M., Rotman, G., Bauer, D., Uziel, T., Savitsky, K., Bar-Shira, A., Gilad, S., Shiloh, Y. and Rosenthal, A. (1997) Ataxiatelangiectasia locus: sequence analysis of 184 kb of human genomic DNA containing the entire ATM gene. Genome Res., 7, 592605.
[Abstract/Free Full Text] - Cost, G.J. and Boeke, J.D. (1998) Targeting of human retrotransposon integration is directed by the specificity of the L1 endonuclease for regions of unusual DNA structure. Biochemistry, 37, 1808118093.[CrossRef][Medline]
-
Ostertag, E.M. and Kazazian, H.H. Jr. (2001) Twin priming: a proposed mechanism for the creation of inversions in L1 retrotransposition. Genome Res., 11, 20592065.
[Abstract/Free Full Text] - Rozmahel, R., Heng, H.H.Q., Duncan, A.M.V., Shi, X.-M., Rommens, J.M. and Tsui, L.-C. (1997) Amplification of CFTR exon 9 sequences to multiple locations in the human genome. Genomics, 45, 554561.[CrossRef][Web of Science][Medline]
- Viale, A., Ortola, C., Richard, F., Vernier, P., Presse, F., Schilling, S., Dutrillaux, B. and Nahon, J.-L. (1998) Emergence of a brain-expressed variant melanin-concentrating hormone gene during higher primate evolution: a gene in search of a function. Mol. Biol. Evol., 15, 196214.[Abstract]
- Courseaux, A. and Nahon, J.-L. (2001) Birth of two chimeric genes in the Hominidae lineage. Science, 291, 12931297.[CrossRef][Web of Science][Medline]
-
Boissinot, S., Entezam, A. and Furano, A.V. (2001) Selection against deleterious LINE-1-containing loci in the human lineage. Mol. Biol. Evol., 18, 926935.
[Abstract/Free Full Text] -
Van den Eynde, B.J., Gaugler, B., Probst-Kepper, M., Michaux, L., Devuyst, O., Lorge, F., Weynants, P. and Boon, T. (1999) A new antigen recognized by cytolytic T lymphocytes on a human kidney tumor results from reverse strand transcription. J. Exp. Med., 190, 17931799.
[Abstract/Free Full Text] -
Sun, X., Li, X., Moriarty, P.M., Henics, T., LaDuca, J.P. and Maquat, L.E. (2001) Nonsense-mediated decay of mRNA for the selenoprotein phospholipid hydroperoxide glutathione peroxidase is detectable in cultured cells but masked or inhibited in rat tissues. Mol. Biol. Cell, 12, 10091017.
[Abstract/Free Full Text] - Cost, G.J., Feng, Q, Jacquier, A. and Boeke, J.D. (2002) Human L1 element target-primed reverse transcription in vitro. EMBO J., 21, 58995910.[CrossRef][Web of Science][Medline]
-
Chang, D.-Y., Nelson, B., Bilyeu, T., Hsu, K., Darlington, G.J. and Maraia, R.J. (1994) A human Alu RNA-binding protein whose expression is associated with accumulation of small cytoplasmic Alu RNA. Mol. Cell. Biol., 14, 39493959.
[Abstract/Free Full Text] -
Wei, W., Gilbert, N., Ooi, S.L., Lawler, J.F., Ostertag, E.M., Kazazian, H.H., Jr., Boeke, J.D. and Moran, J.V. (2001) Human L1 retrotransposition: cis preference versus trans complementation. Mol. Cell. Biol., 21, 14291439.
[Abstract/Free Full Text] - Moran, J.V., Holmes, S.E., Naas, T.P., DeBerardinis, R.J., Boeke, J.D. and Kazazian, H.H. Jr. (1996) High frequency retrotransposition in cultured mammalian cells. Cell, 87, 917927.[CrossRef][Web of Science][Medline]
- Jurka, J., Klonowski, P., Dagman, V. and Pelton, P. (1996) CENSORa program for identification and elimination of repetitive elements from DNA sequences. Comput. Chem., 20, 119121.[CrossRef][Web of Science][Medline]
- Ejima, Y. and Sasaki, M.S. (1998) Mutations of the ATM gene detected in Japanese ataxiatelangiectasia patients: possible preponderance of the two founder mutations 4612del165 and 7883del5. Hum. Genet., 102, 403408.[CrossRef][Web of Science][Medline]
-
Rommens, J.M., Zengerling, S., Burns, J., Melmer, G., Kerem, B.S., Plavsic, N., Zsiga, M., Kennedy, D., Markiewicz, D., Rozmahel, R. et al. (1988) Identification and regional localization of DNA markers on chromosome 7 for the cloning of the cystic fibrosis gene. Am. J. Hum. Genet., 43, 645663.[Web of Science][Medline]
This article has been cited by other articles:
![]() |
K. K. Kojima and N. Okada mRNA Retrotransposition Coupled with 5' Inversion as a Possible Source of New Genes Mol. Biol. Evol., June 1, 2009; 26(6): 1405 - 1420. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Xing, H. Wang, V. P. Belancio, R. Cordaux, P. L. Deininger, and M. A. Batzer From the Cover: Eukaryotic Transposable Elements and Genome Evolution Special Feature: Emergence of primate genes by retrotransposon-mediated sequence transduction PNAS, November 21, 2006; 103(47): 17608 - 17613. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Stribinskis and K. S. Ramos Activation of Human Long Interspersed Nuclear Element 1 Retrotransposition by Benzo(a)pyrene, an Ubiquitous Environmental Carcinogen. Cancer Res., March 1, 2006; 66(5): 2616 - 2620. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Lipovich and M.-C. King Abundant novel transcriptional units and unconventional gene pairs on human chromosome 22 Genome Res., January 1, 2006; 16(1): 45 - 54. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Nozawa, T. Aotsuka, and K. Tamura A Novel Chimeric Gene, siren, With Retroposed Promoter Sequence in the Drosophila bipectinata Complex Genetics, December 1, 2005; 171(4): 1719 - 1727. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhou and B. Mishra Quantifying the mechanisms for segmental duplications in mammalian genomes by statistical analysis and modeling PNAS, March 15, 2005; 102(11): 4051 - 4056. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Gonzalez, F. Casals, and A. Ruiz Duplicative and Conservative Transpositions of Larval serum protein 1 Genes in the Genus Drosophila Genetics, September 1, 2004; 168(1): 253 - 264. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||










