Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (10)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Tang, Y.
Right arrow Articles by Akhurst, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tang, Y.
Right arrow Articles by Akhurst, R. J.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2003, Vol. 12, No. 13 1579-1589
DOI: 10.1093/hmg/ddg164
© 2003 Oxford University Press

Genetic modifiers interact with maternal determinants in vascular development of Tgfb1-/- mice

Yang Tang1, Margaret L. McKinnon1,{dagger}, Li Ming Leong2,{ddagger}, Sarah A. B. Rusholme2,§, Susana Wang1, and Rosemary J. Akhurst1,*

1UCSF Mt Zion Cancer Research Institute, Box 0875, 2340 Sutter Street, San Francisco, CA 94143, USA and 2Duncan Guthrie Institute of Medical Genetics, Glasgow University, Glasgow G3 8SJ, UK

Received March 7, 2003; Accepted April 30, 2003


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The transforming growth factor ß signaling family is a key player in genetic and multifactorial diseases, including hereditary hemorrhagic telangiectasia (HHT), cancer, atherosclerosis and immunomodulation. HHT types 1 and 2 are caused by loss of function mutations in ENG and ACVRL1; polymorphisms in TBRI and TGFB1 are also associated with altered risks for cancer and cardiovascular diseases. There is therefore much interest in identifying factors that influence transforming growth factor ß1 (TGFß1) action in vivo. Here we identify a potent modifier locus, Tgfbkm2129 (LOD=10.5, chromosome 1), that contributes over 90% of the genetic component determining survival to birth of Tgfb1-/- embryos in crosses between C57 and 129 mice, plus a suggestive modifier locus on chromosome 17 (LOD=3.7). Tgfb1-/- survival to birth (STB), in addition to dependence on embryonic Tgfbkm2 genotype, also depends on maternal effects. Fetal genotype and maternal factors interact to prevent Tgfb1-/- embryonic death due to defective yolk sac angiogenesis. C57 or C57/129.F1 mothers support high Tgfb1-/- STB rates, whereas 129 mothers do not. Strain differences in circulating maternal TGFß1 levels were excluded as the cause of this directional complementation. However, strong genetic support is provided for the involvement of maternal STB alleles of mitochondrial or imprinted genes that are only expressed when passed through the female lineage. Molecular identification of the functional gene(s) encoding Tgfbkm2 and its interacting maternal factors will be central to an understanding of the mode of action of TGFß1 in cardiovascular development.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The transforming growth factor ß1 (TGFß1) signaling pathway plays an important role in many diseases including the autosomal dominant disorder, hereditary haemorrhagic telangiectasia (HHT) (1), and the multifactorial diseases, atherosclerosis (2,3) and cancer (tumor suppression, progression and angiogenesis) (4,5), as well as immunomodulation (6,7). Components of the TGFß1 signaling pathway, including TGFB1 (8) and TBRI (9) have been shown to be functionally polymorphic in humans, and genetic associations have been found between carriers of specific TGFB1 and TBR1 polymorphic variants and disease susceptibility for cancer (9,10), atherosclerosis (8,11), hypertension (8,12) and other cardiovascular diseases (13). Genetic approaches to dissection of disease susceptibility will provide both prognostic tests and potential therapeutic targets for disease treatments. Entering the functional genomics era, the importance of genetic interactions in disease risk becomes apparent (14). One way to identify genetic components that interact in a particular pathway in vivo is to identify genetic modifiers of gene knock-out or transgenic mouse phenotypes. Towards this aim we have focused on TGFß1 and its role in vascular development. The central importance of TGFß1 in normal angiogenesis and vascular integrity has been clearly demonstrated by the phenotypes of both mice (4) and humans (1) with null mutations in components of the TGFß1 signaling pathway. Homozygosity for null mutations in Tgfb1, Tbr1, Tbr2, Eng and Acvrl1 results in early prenatal death, due to vascular defects, in mice (4). Hemizygosity for ENG or ACVRL1 in humans results in HHT, a vascular dysplasia with late age of onset (1). Interestingly, HHT is an autosomal-dominant genetic disorder with highly variable penetrance, making the identification of genetic and environmental modifiers of the disease an important area of study (15,16).

In addition to its role in the etiology of vascular dysplasias, TGFß1 is also important in tumor angiogenesis (4,5). Studies have shown TGFß to be either angiogenesis-inducing or -inhibiting during tumorigenesis (4,5). Divergent results are accounted for by the context-dependent action of this molecule, and the fact that its modulation of angiogenesis utilizes both direct and indirect effects on endothelial cells and their environment (4). For example, TGFß directly induces capillary formation of endothelial cells cultured on collagen matrix (17), and also induces expression of the angiogenesis-inducing factor, vascular endothelial cell growth factor (VEGF) (18,19). The identification of modifiers of the vascular phenotype of Tgfb1-/- mice is an unbiased approach to dissect physiologically relevant components that impinge on the TGFß1 signaling pathway during in vivo angiogenesis.

We previously demonstrated that the penetrance of Tgfb1-/- embryo lethality, due to vascular dysgenesis, was highly mouse strain dependent, and we mapped a strong genetic locus on chromosome 5, now termed Tgfbkm1, that modifies this penetrance in Tgfb1-/- mice on a NIH/OlaHsd (NIH) versus C57BL/6J (C57) background (20). Here, we have investigated the genetic basis for differing penetrance of Tgfb1-/- vascular dysgenesis in 129S2/SvHsd (129) versus C57 mice. We show that Tgfbkm1 is not a modifier in this cross, and identify a potent novel locus, Tgfbkm2, on telomeric chromosome 1 as the major determinant. We also demonstrate a maternal effect between C57 and 129 in supporting Tgfb1-/- survival to birth (STB). We exclude differences in circulating maternal TGFß1 (21) as responsible for this effect, and demonstrate that it is influenced by gene(s) expressed through the female lineage.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Tgfb1-/- prenatal lethality in C57 and 129 inbred mouse strains
On early backcross generations (BC4 and BC5), C57 Tgfb1-/- embryos were found to undergo implantation but died between 6.5 and 9.5 days post-coitum (dpc) (20) (Table 1, rows 1 and 3). Subsequent to these initial studies, the C57 Tgfb1+/- line was back-crossed six more generations to inbred C57 and the animals moved from a conventional to a barrier facility. As previously reported (20), no C57 Tgfb1-/- survived to birth (Fig. 1), but in contrast to our previous report (20) and to current observations on earlier back-cross generations (Table 1, rows 1 and 3), C57 Tgfb1-/- embryos from later back-cross generations all survived to 9.5 dpc (Table 1, rows 2 and 4). Almost all had defective development of the yolk sac (Table 1, row 4), similar to that reported previously (22). The lack of Tgfb1-/- lethality prior to 9.5 dpc observed in BC10 compared to BC4 may be explained by the breeding out of a genetic variant or by environmental factors (see Discussion).


View this table:
[in this window]
[in a new window]
  		Table 1. Most Tgfb1-/- embryos on 129 and C57 genetic backgrounds survive to 9.5 dpc, but die due to defective yolk sac development
 


View larger version (15K):
[in this window]
[in a new window]
  		Figure 1. Genetic and maternal factors contribute to Tgfb1-/- embryo survival in a C57x129 genetic cross. The STB rate for Tgfb1-/- mice was estimated as 100x(number of Tgfb1-/- births/number Tgfb1+/+ births) for the indicated Tgfb1+/- intercrosses. According to standard convention, maternal strain is shown on the left of the cross, and paternal on the right. Results shown are pooled from two independent analyses, one intercrossing mice from back-cross generations 4 for both strains, and one between 129 BC8 versus C57 BC10. The data from both analyses was very similar.

 
In contrast, on a 129 genetic background, 30% of Tgfb1-/- mice developed normally and reached term (Fig. 1), subsequently dying around three weeks post-partum from multi-focal inflammation (6). 129 Tgfb1-/- embryos 9.5 and 11.5 dpc had yolk sac defects similar to those seen on the C57 background (Fig. 2). The incidence of yolk sac defects in 9.5 dpc 129 Tgfb1-/- embryos (~70%, Table 1, column 7) is consistent with the STB rate (30%). It can therefore be concluded that abnormal yolk sac development is the cause of most Tgfb1-/- prenatal loss on both the C57 and 129 genetic backgrounds.



View larger version (84K):
[in this window]
[in a new window]
  		Figure 2. Defective yolk sac angiogenesis in Tgfb1-/- embryos. Wild-type (A, D), and Tgfb1-/- (B, C, E, F) 129 BC4 embryos of 9.5 dpc (A–C) or 11.5 dpc (D–F), visualized by dark-field stereomicroscopy. Note inadequate vascular development in (C, E and F), and anemia in (B). 129 BC8 Tgfb1-/- embryos exhibited the same phenotype as BC4 (data not shown). ys, yolk sac; bv, blood vessel; ha, hemorrhage. Scale bar is 850 µm.

 
The phenotype of the Tgfb1-/- embryos on a 129 genetic background was examined by morphological (Fig. 2) and histological analysis (not shown). The most common defect of the vascular system was reduced vascular remodeling within the yolk sac. There was a decrease in branching of the vitelline vessels, and in the incidence of small capillary-like vessels. Occasional 9.5 dpc Tgfb1-/- embryos retained the primitive honeycomb-like vascular network characteristic of an 8.5 dpc embryo. Vessels that did form were dilated and fragile, with leakage of blood into the yolk sac cavity. Defects in the allantois and chorion were also common. In a minority of cases (two out of the 23 Tgfb1-/- embryos examined), the allantois had failed to fuse with the chorion. The affected embryos were all anemic. By 11.5 days, there was already a significant loss of viable Tgfb1-/- embryos by death and resorption (Table 1). Of those still alive, vascular defects of the yolk sac were obvious, and the embryos were beginning to become necrotic. Some conceptuses had a reduced syncytio-trophoblast layer within the placenta, although by this stage it was impossible to determine whether this was a primary or secondary defect. Qualitatively, the 9.5 dpc yolk sac phenotype in all affected Tgfb1-/- mice did not vary between the two strains, but was the same as previously reported, including anemia (22).

Genetic and maternal factors contribute to survival of Tgfb1-/- embryos
We previously demonstrated variable penetrance of prenatal lethality of Tgfb1-/- mice on the C57 and NIH strains (20). Here we show that there was a low STB rate (~30%) of Tgfb1-/- mice on a 129 genetic background, intermediate between that of NIH (>80%) and C57 (0%) (Fig. 1). Reciprocal Tgfb1+/- intercrosses between C57 and 129 revealed inter-strain genetic complementation with a maternal effect. The STB rate of Tgfb1-/- mice was intermediate between that of the two parents when the mother was 129 and the father C57 (Fig. 1, column 4). However, in the reciprocal cross, the STB rate was greatly enhanced to levels well above those of either of the two parental strains (Fig. 1, column 3). The complementation effect was also observed when the mother was C57/129.F1, as seen by STB rates in the F1 back-cross (Fig. 1, column 6).

Inter-strain variations in the STB rate suggest the existence of STB alleles in the 129 strain. The dramatic maternal complementation effect suggests that the function of the variant STB allele(s) in the embryo is strongly enhanced by factors provided by a C57 or F1 mother, but not a 129 mother. The simplest genetic model that describes the data in Fig. 1 is of a single dominant or co-dominant 129 STB allele that shows enhanced penetrance on a C57 or F1 maternal background.

Genetic loci
Six regions of the genome showed suggestive linkage (P<0.05, Table 2) in an F1 intercross genome scan of Tgfb1-/- neonates (Fig. 3). Markers that showed a LOD score ≥3.5 were used to genotype a further 26 Tgfb1-/- F2 neonates from the F1 intercross. Only two loci, on chromosomes 1 and 17, showed an increasing LOD score as more data was added, suggesting true linkage disequilibrium.


View this table:
[in this window]
[in a new window]
  		Table 2. Genome scan of F2 Tgfb1-/- neonatal mice from an F1(C57.129).Tgfb1+/- intercross
 


View larger version (25K):
[in this window]
[in a new window]
  		Figure 3. F1 intercross analysis and selective genotyping of Tgfb1-/- neonatal mice.

 
Tgfbkm2, on chromosome 1 was selected for fine mapping based on its high LOD score (>10), far greater than the threshold (LOD 4.3) proposed for definitive linkage (23). Nine SSR markers spanning ~20 Mb on distal chromosome 1 were used. An LODMAX of 10.5 was found for Tgfbkm2 at D1Mit17 (95% CI, 192.5–195 Mb; Fig. 4).



View larger version (15K):
[in this window]
[in a new window]
  		Figure 4. Genetic and molecular characterization of the Tgfbkm2 locus. High-resolution genetic linkage analysis of telomeric chromosome 1. 111 Tgfb1-/- neonates from the F1 intercross were genotyped for various SSR markers (Table 2). Data was analyzed by {chi}2 with 2 d.f. for an additive genetic model. The 95% confidence intervals (CI) are shown.

 
D17Mit177 had a lower LOD score (LOD=3.7) in the intercross analysis. However, this region of chromosome 17 also showed weak linkage in an independent F1 back-cross analysis (P=0.015, n=82), supporting the presence of a true locus. Interestingly, despite the fact that we have never observed a single C57 Tgfb1-/- animal that reaches birth, the C57 allele of D17Mit177 (D17Mit177C57) was enriched relative to D17Mit177129 in Tgfb1-/- neonatal offspring of both the intercross (Table 2) and back-cross D17Mit177 (30SS : 52SC, P=0.015, expected 1 : 1). The D17Mit177C57 allele thus functions as a STB variant, whereas D17Mit177129is associated with Tgfb1-/- embryonic loss.

Within the F1 intercross, D1Mit17 (Tgfbkm2) genotype ratios suggested that the Tgfbkm2129 STB allele acts in an additive fashion, since fewer Tgfb1-/- neonates were heterozygous at D1Mit17 versus homozygous for 129 at this marker (P= 0.0001, expected 2 : 1, Table 2). A maternal F1xpaternal 129 Tgfb1+/- back-cross analysis was undertaken to generate independent mapping data and to further assess the dominant versus recessive nature of the modifier locus. This analysis showed a peak LOD score at D1Mit209, and confirmed the additive nature of Tgfbkm2129 (72SS : 40SC, P=0.002, expected 1 : 1). Data from the back-cross analysis on D17Mit177 (30SS : 52SC, P=0.015, expected 1 : 1), together with the under-representation of D17Mit177129/C57Tgfb1-/- neonates versus D17Mit177C57/C57Tgfb1-/- neonates in the F1 intercross (Table 2; P=0.03, expected 2 : 1), suggests that this locus also acts in a predominantly additive mode.

Genetic and molecular characterization of the Tgfbkm2 locus
Intercross analysis localized Tgfbkm2 within a 2.5 Mb interval with 95% confidence (LODmax-1) on the basis of genetic linkage analysis with 2 d.f. (Fig. 4). When increasing the confidence interval to 99% (LODMAX-1.7), Tgfbkm2 maps within a 7 Mb region (188.5–195.5 Mb). To investigate possible candidate genes within the critical map region, an electronic map of all transcribed genes within a 20 Mb region encompassing Tgfbkm2 was generated, using both public and Celera databases. DNA sequences within the coding regions of genes were electronically compared between 129 and C57 (Table 3). Six out of six SNPs electronically detected by us were confirmed to be polymorphic between 129S2/Sv and C57BL/6J by DNA sequencing.


View this table:
[in this window]
[in a new window]
  		Table 3. Amino acid polymorphisms in known genes around Tgfbkm2
 
Maternal effects
To investigate the possibility that strain-specific differences in circulating maternal TGFß1 (16,21,25) might account for the maternal effects observed in the reciprocal 129xC57 crosses, the entire transcribed region of the Tgfb1 gene, plus over 4 kb of the 5' promoter, was sequenced from cDNA and genomic DNA respectively, in the different mouse strains. The genomic sequences from three different strains (C57, 129 and NIH) were identical (data not shown), thus discounting the possibility that strain differences in the primary protein sequence of maternal TGFß1 could account for the maternal effects seen herein.

Regulation of the bioactivity of TGFß1 is not limited to gene–protein structure, but multifactorially controlled (24). Therefore TGFß1 protein levels were directly assayed in platelet-depleted (PD) plasma of 129, C57 and NIH age-matched female mice, either virgins or 8.5 dpc pregnant (Fig. 5). In agreement with previous studies (25), active circulating TGFß1 could not be detected in the plasma of any of the strains of mice examined, and total (acid-activatable) PD plasma TGFß1 levels were in the range of 2.5–5 ng/ml. Although TGFß1 levels were significantly depleted in hemizygous Tgfb1+/- compared to wild-type mice, total PD plasma TGFß1 levels were invariant between the three strains.



View larger version (12K):
[in this window]
[in a new window]
  		Figure 5. Maternal levels of circulating TGFß1 are invariant between C57, 129 and NIH. Acid-activated TGF-ß1 levels in PD plasma from Tgfb1 wild-type and hemizygous age-matched virgin female mice measured by a TGFß1 ELISA assay. Total TGFß1 levels were invariant between strains, but there was a clear depletion of TGFß1 levels in PD plasma of hemizygous Tgfb1+/- compared to wild-type mice. High standard deviations are probably due to inter-animal variation in stages of the estrus cycle. (B) Acid-activated TGFß1 levels were also found to be invariable between PD plasma samples of pregnant mice, 8.5 dpc, using a plasminogen activator inhibitor-1/luciferase bioassay. (C) Acid-activated TGFß1 levels in C57 platelet releasate was twice that of 129, as previously documented (25).

 
Since strain variation in circulating TGFß1 levels has been reported (16,25), we determined the platelet number and platelet TGFß1 concentration in C57 and 129 mice. The platelet count of C57 mice was twice that of 129 (C57= 684±58 K per µl; 129=322±12 K per µl), and the amount of total TGFß1 released per platelet, upon activation by thrombin and EDTA, was 2-fold higher in C57 than in 129 (P=0.016, Fig. 5C), raising the possibility that maternal TGFß1 provided by platelet degranulation around the site of embryo implantation could contribute to differential rescue of embryos from prenatal lethality. Counterintuitive to this argument, however, C57/129.F1 mothers that can also rescue F1 back-cross embryos from prenatal lethality (Fig. 1, column 6) were, like 129, thrombocytopenic ( platelet count=404±49 K per µl).

To address the possibility of a genomic imprinting effect, we examined the parental origin of chromosomes in F1 mothers utilized in the backcross analysis (Fig. 1, column 6). Interestingly, when the C57 alleles were derived from the grandfather, STB rate was only ~50%, P=0.0002 (98 Tgfb1+/+ : 178 Tgfb1+/- : 50 Tgfb1-/-), whereas when they were derived from the grandmother there was 100% STB of conceived Tgfb1-/- F1 back-cross animals (49 Tgfb1+/+ : 131 Tgfb1+/- : 53 Tgfb1-/-). The differential STB rate seen when the origins of the maternal grandparents differed was significant (P=0.016), suggesting that STB depends not only the embryonic genotype of Tgfbkm2 and other lesser loci, but also on maternal factors inherited from the grandmother.

We thus conclude that the ability of Tgfb1-/- embryos to undergo normal yolk sac angiogenesis and normal development depends firstly on the possession of an embryonic genotype conducive to embryonic/fetal survival. The major locus involved in this effect is Tgfbkm2129, complemented to some extent by lesser loci such as that on chromosome 17. Nevertheless, possession of an embryonic ‘survival genome’ is not in itself sufficient, but also depends on a permissive maternal environment.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 REFERENCES
 
We investigated the genetic basis for differing penetrance of Tgfb1-/- vascular dysgenesis in 129 versus C57 mice. In this particular cross, we found that Tgfb1-/- STB requires both a specific embryonic STB genotype as well as a maternal environment conducive to survival of such embryos (Table 4). A novel co-dominant modifier in this cross, Tgfbkm2129 on the telomeric arm of chromosome 1, contributes over 90% of the fetal genetic determinants that dictate whether Tgfb1-/- embryos can undertake successful angiogenesis. This is illustrated by the fact that only one out of 112 F2 Tgfb1-/- animals that survive to birth does not carry a 129 allele at D1Mit407.


View this table:
[in this window]
[in a new window]
  		Table 4. Interaction of maternal and embryonic components in determining Tgfb1-/- STB
 
Our analysis also reveals a second lesser modifier locus on chromosome 17, near D17Mit177. Although neither of the chromosome 17 P values for the F1 intercross or back-cross analyses reached the threshold for definitive linkage (23), the fact that both independent analyses demonstrate linkage in the same direction suggests that there is a true modifier locus here. Power calculations suggest that it would be necessary to genotype over 110 Tgfb1-/- intercross animals and over 180 Tgfb1-/- back-cross animals to approach definitive linkage for D17Mit177. At this locus, the C57 rather than 129 allele is linked to STB, suggesting the existence of a STB allele on an otherwise lethal genetic background. This may contribute to the inter-strain complementation seen in C57/129.F1 embryos. Additionally, this observation may account for the more severe Tgfb1-/- embryo-lethal phenotype observed in BC4 (20) compared to BC10. It is, for example, possible that a lethality susceptibility allele, such as that linked to D17Mit177129, may have been a contaminant in the BC4, but was subsequently bred out in further back-crosses.

A novel finding of this study is that 129 mothers are unable to support high efficiency Tgfb1-/- embryo STB even when the embryo has an STB genotype, whereas both C57 and C57/129.F1 mothers can (Table 4). A candidate for such a maternal effect is the level of circulating maternal TGFß1 that may rescue Tgfb1-/- embryos with a STB phenotype (21). Indeed, it has been suggested that low plasma levels of TGFß1 in 129 mice may account for the increased penetrance of vascular dysplasias seen in the Eng+/- mouse model of HHT (16). However, we show that plasma levels of total TGFß1 are invariant between the two strains, as reported by Abdelouhard et al. (25). The TGFß1 plasma range observed by us (2.5–5 ng/ml) is in concordance with most laboratories that utilize heparin/EDTA-independent harvesting of plasma. More importantly, we found that 129 mice are thrombocytopenic, which might account for the enhanced penetrance of vascular defects seen in Eng+/- mice (16). The thrombocytopenia, however, does not explain the maternal strain-dependent effect seen here, since C57/129.F1 mice that are also thrombocytopenic can support high-efficiency Tgfb1-/- STB.

Intriguingly, we found a grand parental effect on the ability of Tgfb1-/- to survive to birth. In the F1 back-cross to 129, when the maternal grandmother was C57, 100% of Tgfb1-/- embryos survived to birth. In contrast, when the maternal grandmother was 129, only 50% of Tgfb1-/- embryos survived (Fig. 6). In both cases, the nuclear genomes of the embryos were genetically identical (1 : 1, Tgfbkm2129/129 : Tgfbkm2129/C57). This observation suggests one of two scenarios. Firstly, survival of Tgfb1-/- embryos with the requisite STB genotype, may be enhanced by the presence of mitochondria derived from C57 (Fig. 6A). These organelles are always passed through the female germ-line (www.mitomap.org), hence the grand-maternal effect. If this was the case, one might postulate that energy metabolism and/or apoptosis might be involved in the Tgfb1-/- defective vascular phenotype (26–28). Intriguingly, TGFß1 protein has been found localized to mitochondria in several cell types, although the significance of this observation is unresolved (29,30). Alternatively, Tgfb1-/- embryos that are genetically programmed to undergo efficient angiogenesis (i.e. Tgfbkm2129/129) may depend on a supportive maternal environment for STB (Fig. 6B). This ‘favorable’ environment would be dependent on polymorphic gene(s) expressed only through the maternal lineage (i.e. either paternally imprinted or mitochondrial). For example, it may be requisite for the mother to express the C57 allele of a gene that is paternally imprinted (31,32). Hence mice with a 129 grandmother, including the pure 129 strain, would have poor STB. A candidate for such a gene is Igfr2, which is paternally imprinted (31) and involved in TGFß1 activation (24).



View larger version (25K):
[in this window]
[in a new window]
  		Figure 6. Influence of grandparental strain on Tgfb1-/- STB suggests mitochondrial or genomic imprinting effects. Two alternative models are proposed. (A) M xyz and shading denote origin of the mitochondrial genome; C57, gray; 129, white. Tgfbkm2129/129 embryos carrying C57 mitochondria have a higher STB than those carrying 129 mitochondria. (B) Axyz denotes a gene(s) that is paternally imprinted, i.e. only expressed when inherited from the mother. The bold allele is expressed, struck-through allele is imprinted and silent. Shading denotes the form of the A allele expressed; C57, gray; 129, white. In this model STB of the embryo is influenced by the maternal environment, which differs between A129-expressing and AC57-expressing mothers. Notice that embryos from both crosses (striped) are genetically identical, half express A129and half express AC57.

 
In Drosophila, modifier screens have been invaluable for elucidating signal-transduction pathways (33), and it is possible that Tgfbkms interact directly with the TGFß signaling pathway. However, an alternative scenario is that Tgfbkm2 is on an alternative signaling pathway, normally redundant to that of TGFß1, such that mutation or polymorphism in both pathways is required for the full-blown defects in angiogenesis. Our selection of candidate genes responsible for the Tgfbkm2 effect is based on several criteria (a) appropriate genetic linkage, (b) appropriate expression pattern during embryogenesis and (c) differential gene expression between strains and/or amino-acid polymorphisms between strains.

Towards identification of Tgfbkm2 candidate genes, a contig was generated containing all known expressed sequences of the Tgfbkm2 locus, with the caveat that gene structure predictions may be inexact, and thus the contig may not be comprehensive. Many of the genes within the Tgfbkm2 critical map region appear to be related in function, associated with cell growth, proliferation, mitosis and DNA repair, such as Nek2, Cenp-f, Bpnt1, Emk3, Tlr5, ribosomal protein L21, H3 histone 3A and Karp1-binding protein. It is possible that Tgfbkm2 represents a cluster of functionally related polymorphic genes, as has been suggested for several other genetic modifiers of complex disease traits (34,35). It is well established that TGFß1 is involved in control of cellular proliferation (5). The finding that this locus is rich in cell proliferation-associated genes tempts one to speculate that the basis of the aberrant phenotype might be abnormal cellular proliferation.

Intriguingly, Tgfb2 maps central to the critical map region (at ~190 Mb), suggesting that its encoded ligand might, in a strain-specific manner, compensate for loss of TGFß1. However, there are no amino acid polymorphisms between the C57 and 129 Tgfb2 alleles (data no shown), moreover there are no clear strain-specific differences in expression profile of this gene (data not shown). With respect to the locus on chromosome 17, Vegf1 is an excellent candidate gene, albeit at low-resolution mapping.

It is likely that the Tgfbkm loci play a role in determining susceptibility to diseases in which TGFß1 is implicated. The Sle locus on telomeric chromosome 1 encodes a cluster of genes predisposing to the autoimmune disorder, systemic lupus erythematosis (34). Although most of these genes map significantly proximal to Tgfbkm2, Sle1c is 9 Mb distal to Tgfbkm2 (36), implying that Tgfbkm2 could be part of the Sle1 gene complex. Another cluster of QTLs on telomeric mouse chromosome 1 alters risk for athersclerosis and circulating HDL-C levels (37), but most of these map at least 10 cM proximal to Tgfbkm2. With respect to cancer, a radiation-induced acute myeloid leukemia susceptibility locus has been found in CBA/H X C57BL/6 mice, close to the stem cell frequency regulator locus (Scfr1) (38,39) and to Tgfbkm2. Finally, the syntenic region of the human genome, chromosome 1q31–1q41, in addition to harboring SLE1 (40), is frequently amplified in primary human breast tumors (41). It is possible that some of these traits involve the same gene(s) that lead to the Tgfbkm2 effect. Once the Tgfbkm2 gene(s) have been identified, it will be important to examine their role in penetrance of the HHT phenotype, and in human susceptibilities for cancer, cardiovascular and autoimmune diseases. Ultimately, the identification of the Tgfbkm2 gene(s) will enhance our understanding of the mechanism of regulation of angiogenesis by TGFß1, and may provide new drug targets for various disease therapies.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
REFERENCES
 
Animals
The Tgfb1+/- mice (6) were bred through four generations onto either inbred C57BL/6JOlaHsd (C57) or 129S2/SvHsd (129) backgrounds in a conventional animal facility, and some experiments performed at this stage. Mice were then re-derived by embryo transfer and bred in a barrier facility. C57 was bred a further six generations to C57BL/6NTac, i.e. to back-cross generation 10 (BC10), and 129 was bred a further four generations to BC8 on 129S2/SvHsd.

For embryo analysis, 129 BC4 Tgfb1+/- mice were housed conventionally (light from 5 a.m. to 7 p.m.), and timed matings set up. Noon on the day of the copulation plug was taken as 0.5 dpc. Embryos were dissected and examined in ice-cold PBS.

Genomic DNA extraction and PCR analysis
Genomic DNA was extracted from tail biopsies by DNEasy 96 well kit (QIAgen, Valencia, CA, USA) or automatic DNA isolation (Autogen 740, Holliston, MA, USA). Tgfb1 genotyping was performed using a four-primer PCR. The wild-type allele generated a 402 nt band using primers B1 (TCACCCGCGTGCTAATGGTGGACCGC) and B2 (ACACCTTCCATTCTCTTGAGCTGGG). The null mutant allele generated a 350 nt product using primers B3 (CATGGAGCTGGTGAAACGGAAGCGC) and B4 (TCCATCTGCACGAGACTAGT). Dinucleotide repeat (SSR) primer sequences were obtained from www.jax.org. Additional SSR primers (D1ucsf17, D1ucsf459 and D1ucsf34) were designed using Primer3 software (MIT, MA, USA), based on genomic sequences at www.celera.com.

Genetic crosses and genome scan
C57/129.F1 were generated by intercrossing 129 BC8 and C57 BC10 Tgfb1+/- mice. Tgfb1+/- C57/129.F1 mice were intercrossed, and DNA collected from all newborn F2 mice. A total of 404 SSR markers were screened for polymorphisms between 129 and C57 (ABI-3700 capillary DNA fragment analysis). Of these, 136 were polymorphic. A genome scan was performed by the NHLBI Genotyping Service at the Marshfield Medical Research Foundation, on 86 neonatal Tgfb1-/- DNA samples using 100 informative SSR markers spanning the genome at ~20 cM intervals (Table 1; http://research.marshfieldclinic.org/genetics). Linkage disequilibrium was assessed by {chi}2 test with 2 d.f. for an additive model. Where markers showed significant linkage disequilibrium, Tgfb1+/+ and/or Tgfb1+/- F2 littermates were typed with the same marker, to exclude non-random segregation distortion unrelated to the Tgfb1-/- genotype. C57/129.F1 Tgfb1+/- mice were also back-crossed to 129. A total of 110 Tgfb1-/- BC neonates were genotyped at several markers on chromosomes 1 and 17.

Construction of electronic contig and amino acid polymorphism detection
Our search for coding variations was initiated a few months before Celera's release of its SNP database. All consensus transcript sequences, from multiple strains and mapping within an 11 MB interval around Tgfbkm2 were downloaded from Celera's Mouse Genome Assembly under Celera Discovery System (http://cds.celera.com/biolib/cdsTopLibrary.jsp). These were blasted against NCBI's Trace Mouse Database (www.ncbi.nlm.nih.gov/Traces), which contains a library of C57BL/6J genomic sequences. Since the Celera consensus sequence was assembled using DNA from a mixture of mouse strains 129X1/SvJ, 129S1/SvImJ, DBA/2K, A/J and C57BL/6J, the single-nucleotide polymorphism (SNP)-containing region was blasted back to the Celera Sequence Fragment Database (http://cds.celera.com/seqsearch/cdsSequenceSearch.jsp) to determine the strain source of the polymorphism. Those SNPs occurring specifically between 129 sub-strains and C57BL/6J were documented. To complement this approach, we utilized the recently released Celera Mouse RefSNP database (Release 1.0) containing 2 566 706 SNPs between 129X1/SvJ, 129S1/SvImJ, DBA/2J, A/J and C57BL/6J mouse strains. We used this to screen for SNPs that cause mis-sense mutations between 129 and C57BL/6, within a 20 Mb region (180–200 Mb) around Tgfbkm2.

Collection of platelet-depleted (PD) plasma and platelets
Whole blood (450 µl) was collected by retro-orbital puncture into siliconized microcentrifuge tubes containing acid–citrate dextrose anticoagulant (CTAD; Diatube-H, Becton Dickinson), centrifuged at 735g for 20 min at 4°C (42), and 100 µl of plasma supernatant re-centrifuged at 1310g for 30 min at 4°C to pellet the platelets. A 1.4 µl aliquot of Protease Inhibitor CocktailTM (Boehringer Mannheim) was added to 75 µl of the PD plasma and frozen in liquid nitrogen ready for TGFß1 assay.

Platelet counts were measured in whole blood and isolated platelet pellets using a fluorescent activated cell sorter (FACS)-based assay. Blood was diluted 4-fold in Ca2+/Mg2+-free Tyrodes Hepes (CMFTH; 12 mM NaHCO3, 138 mM NaCl, 5.5 mM glucose, 2.9 mM KCl, 10 mM Hepes, pH 7.4). Platelet pellets obtained from approximately 500 µl of blood were resuspended in 20 µl of platelet storage buffer, and 5 µl diluted 4-fold in CMFTH. To the diluted whole blood or isolated platelets, a cocktail of the following, in CMFTH, was added: 0.01 mg/ml of R-phycoerythrin (R-PE)-conjugated hamster anti-mouse CD61 (integrin B3 chain) monoclonal antibody (BD Pharmingen), and 2.5 mM gly-pro-arg-pro (Bachem), to prevent fibrin clotting. The samples were incubated at room temperature for 30 min and fixed with 1% formaldehyde in CMFTH for 30 min. Samples were transferred to TrucountTM tubes (Becton Dickinson), which contain a known number of fluorescent beads. During analysis, the absolute number of platelets per µl was determined by comparing the number of platelet events to bead events acquired by FACS. Platelet counts were also independently assayed by the UCSF Comprehensive Cancer Center Mouse Pathology Core facility, using standard hematological procedures.

Quantification of acid-activated TGF-ß1
Two complementary assays were utilized to quantify total TGFß1 in PD plasma and platelets; an ELISA and a bioassay. Isolated platelets were adjusted to 1.6x105 platelets/µl with platelet storage buffer and treated with thrombin and EDTA as described (25). PD plasma or thrombin/EDTA-treated platelets were treated with 0.25 M HCl at 37°C for 30 min (42), or for 1 h at 4°C (25), respectively, and neutralized with 1.2 N NaOH/0.5 M HEPES. Samples were diluted in PBS with 1.4% fatty acid-free BSA (Sigma), 0.05% Tween 20, and plated in triplicate at 100 µl per well. Levels of total TGFß-1 were determined by comparison to a recombinant human TGFß-1 standard (R&D Systems) using a modified Quantikine assay from R&D Systems. Mink lung epithelial cells (MLECs) stably-transfected with a construct containing a truncated PAI-1 promoter element fused to the firefly luciferase reporter gene (PAI-1-luciferase construct) were used as described (25,43). Cells were maintained in high glucose (4500 mg/l) Dulbecco's modified Eagle's medium containing 10% fetal calf serum, 2 mM L-glutamine, 1 mM sodium pyruvate, and 200 µg/ml Geneticin (G418-sulfate). Prior to assay, cells were grown for 24 h in the serum-free medium supplemented with 0.1% BSA (Sigma), trypsinized, washed several times in medium, and plated at 1.6x105 cells/ml, 400 µl per well, into 24-well tissue culture plates (Becton Dickinson). The assay was performed essentially as described by Abe et al. (43).


   ACKNOWLEDGEMENTS
 
Thanks to Fanya Rostker for technical assistance, and Dean Sheppard and Dan Rifkin for the PAI-1-luciferase-transfected cells. This work was funded in part by grant no. RO-1 GM60514 from the NIH; grant no. 0150607N from the American Heart Association; grant no. 6-FY01-36 from the March of Dimes Birth Defects Foundation; MRC, UK; and the Stewart Trust, UCSF. The genome-wide scan was performed by the Genotyping Service at the Marshfield Medical Research Foundation, Marshfield, WI, USA.


   FOOTNOTES
 
* To whom correspondence should be addressed. Tel: +1 4155140215; Fax: +1 4155026779; Email: rakhurst{at}cc.ucsf.edu Back

{dagger} Present address: The University of British Columbia, Medical School, 2329 West Mall Vancouver, BC Canada V6T 1Z4. Back

{ddagger} Present address: Biomedical Research Council, 250 North Bridge Road, #15-01/02 Raffles City Tower, Singapore 179101. Back

§ Present address: National Space Centre, Exploration Drive, Leicester, UK. Back

Present address: Elan Pharmaceuticals, 800 Gateway Boulevard, South San Francisco, CA 94080, USA. Back


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Marchuk, D.A. (1998) Genetic abnormalities in hereditary hemorrhagic telangiectasia. Curr. Opin. Hematol., 5, 332–338.[Medline]

  2. Grainger, D.J., Kemp, P.R., Metcalfe, J.C., Liu, A.C., Lawn, R.M., Williams, N.R., Grace, A.A., Schofield, P.M. and Chauhan, A. (1995) The serum concentration of active transforming growth factor-ß is severely depressed in advanced atherosclerosis. Nat. Med., 1, 74–79.[CrossRef][ISI][Medline]

  3. Topper, J.N. (2000) TGF-ß in the cardiovascular system: molecular mechanisms of a context-specific growth factor. Trends Cardiovasc. Med., 10, 132–137.[CrossRef][ISI][Medline]

  4. Akhurst, R.J. and Derynck, R. (2001) TGF-ß signaling in cancer—a double-edged sword. Trends Cell Biol., 11, S44–S51.[ISI][Medline]

  5. Derynck, R., Akhurst, R.J. and Balmain, A. (2001) TGF-ß signaling in tumor suppression and cancer progression. Nat. Genet., 29, 117–129.[CrossRef][ISI][Medline]

  6. Kulkarni, A.B., Huh, C.G., Becker, D., Geiser, A., Lyght, M., Flanders, K.C., Roberts, A.B., Sporn, M.B., Ward, J.M. and Karlsson, S. (1993) Transforming growth factor ß1 null mutation in mice causes excessive inflammatory response and early death. Proc. Natl Acad. Sci. USA, 90, 770–774.[Abstract/Free Full Text]

  7. Wahl, S.M., Orenstein, J.M. and Chen, W. (2000) TGF-ß influences the life and death decisions of T lymphocytes. Cytokine Growth Factor Rev., 11, 71–79.[CrossRef][ISI][Medline]

  8. Cambien, F., Ricard, S., Troesch, A., Mallet, C., Generenaz, L., Evans, A., Arveiler, D., Luc, G., Ruidavets, J.B. and Poirier, O. (1996) Polymorphisms of the transforming growth factor-ß1 gene in relation to myocardial infarction and blood pressure. The Etude Cas-Temoin de l'Infarctus du Myocarde (ECTIM) Study. Hypertension, 28, 881–887.[Abstract/Free Full Text]

  9. Pasche, B., Kolachana, P., Nafa, K., Satagopan, J., Chen, Y.G., Lo, R.S., Brener, D., Yang, D., Kirstein, L., Oddoux, C. et al. (1999) TßR-I(6A) is a candidate tumor susceptibility allele. Cancer Res., 59, 5678–5682.[Abstract/Free Full Text]

  10. Ziv, E., Cauley, J., Morin, P.A., Saiz, R. and Browner, W.S. (2001) Association between the T29->C polymorphism in the transforming growth factor ß1 gene and breast cancer among elderly white women: The Study of Osteoporotic Fractures. JAMA, 285, 2859–2863.[Abstract/Free Full Text]

  11. Yokota, M., Ichihara, S., Lin, T.L., Nakashima, N. and Yamada, Y. (2000) Association of a T29->C polymorphism of the transforming growth factor-ß1 gene with genetic susceptibility to myocardial infarction in Japanese. Circulation, 101, 2783–2787.[Abstract/Free Full Text]

  12. Yamada, Y., Fujisawa, M., Ando, F., Niino, N., Tanaka, M. and Shimokata, H. (2002) Association of a polymorphism of the transforming growth factor-ß1 gene with blood pressure in Japanese individuals. J. Hum. Genet., 47, 243–248.[CrossRef][ISI][Medline]

  13. Beranek, M., Kankova, K., Benes, P., Izakovicova-Holla, L., Znojil, V., Hajek, D., Vlkova, E. and Vacha, J. (2002) Polymorphism R25P in the gene encoding transforming growth factor-ß (TGF-ß1) is a newly identified risk factor for proliferative diabetic retinopathy. Am. J. Med. Genet., 109, 278–283.[CrossRef][ISI][Medline]

  14. Frankel, W.N. and Schork, N.J. (1996) Who's afraid of epistasis? Nat. Genet., 14, 371–373.[CrossRef][ISI][Medline]

  15. Guttmacher, A.E., Marchuk, D.A. and White, R.I. Jr. (1995) Hereditary hemorrhagic telangiectasia. New Engl. J. Med., 333, 918–924.[Free Full Text]

  16. Bourdeau, A., Faughnan, M.E., McDonald, M.L., Paterson, A.D., Wanless, I.R. and Letarte, M. (2001) Potential role of modifier genes influencing transforming growth factor-ß1 levels in the development of vascular defects in endoglin heterozygous mice with hereditary hemorrhagic telangiectasia. Am. J. Pathol., 158, 2011–2020.[Abstract/Free Full Text]

  17. Madri, J.A., Pratt, B.M. and Tucker, A.M. (1988) Phenotypic modulation of endothelial cells by transforming growth factor-ß depends upon the composition and organization of the extracellular matrix. J. Cell Biol., 106, 1375–1384.[Abstract/Free Full Text]

  18. Pertovaara, L., Kaipainen, A., Mustonen, T., Orpana, A., Ferrara, N., Saksela, O. and Alitalo, K. (1994) Vascular endothelial growth factor is induced in response to transforming growth factor-ß in fibroblastic and epithelial cells. J. Biol. Chem., 269, 6271–6274.[Abstract/Free Full Text]

  19. Breier, G., Blum, S., Peli, J., Groot, M., Wild, C., Risau, W. and Reichmann, E. (2002) Transforming growth factor-ß and Ras regulate the VEGF/VEGF-receptor system during tumor angiogenesis. Int. J. Cancer, 97, 142–148.[CrossRef][ISI][Medline]

  20. Bonyadi, M., Rusholme, S.A., Cousins, F.M., Su, H.C., Biron, C.A., Farrall, M. and Akhurst, R.J. (1997) Mapping of a major genetic modifier of embryonic lethality in TGF ß1 knockout mice. Nat. Genet., 15, 207–211.[CrossRef][ISI][Medline]

  21. Letterio, J.J., Geiser, A.G., Kulkarni, A.B., Roche, N.S., Sporn, M.B. and Roberts, A.B. (1994) Maternal rescue of transforming growth factor-ß1 null mice. Science, 264, 1936–1938.[Abstract/Free Full Text]

  22. Dickson, M.C., Martin, J.S., Cousins, F.M., Kulkarni, A.B., Karlsson, S. and Akhurst, R.J. (1995) Defective haematopoiesis and vasculogenesis in transforming growth factor-ß1 knock out mice. Development, 121, 1845–1854.[Abstract]

  23. Lander, E. and Kruglyak, L. (1995) Genetic dissection of complex traits: guidelines for interpreting and reporting linkage results. Nat. Genet., 11, 241–247.[CrossRef][ISI][Medline]

  24. Annes, J.P., Munger, J.S. and Rifkin, D.B. (2003) Making sense of latent TGFß activation. J. Cell Sci., 116, 217–224.[Abstract/Free Full Text]

  25. Abdelouahed, M., Ludlow, A., Brunner, G. and Lawler, J. (2000) Activation of platelet-transforming growth factor ß-1 in the absence of thrombospondin-1. J. Biol. Chem., 275, 17933–17936.[Abstract/Free Full Text]

  26. Larisch, S., Yi, Y., Lotan, R., Kerner, H., Eimerl, S., Tony Parks, W., Gottfried, Y., Birkey Reffey, S., de Caestecker, M.P., Danielpour, D. et al. (2000) A novel mitochondrial septin-like protein, ARTS, mediates apoptosis dependent on its P-loop motif. Nat. Cell Biol., 2, 915–921.[CrossRef][ISI][Medline]

  27. Perlman, R., Schiemann, W.P., Brooks, M.W., Lodish, H.F. and Weinberg, R.A. (2001) TGF-ß-induced apoptosis is mediated by the adapter protein Daxx that facilitates JNK activation. Nat. Cell Biol., 3, 708–714.[CrossRef][ISI][Medline]

  28. Jang, C.W., Chen, C.H., Chen, C.C., Chen, J.Y., Su, Y.H. and Chen, R.H. (2002) TGF-ß induces apoptosis through Smad-mediated expression of DAP-kinase. Nat. Cell Biol., 4, 51–58.[CrossRef][ISI][Medline]

  29. Heine, U.I., Burmester, J.K., Flanders, K.C., Danielpour, D., Munoz, E.F., Roberts, A.B. and Sporn, M.B. (1991) Localization of transforming growth factor-ß1 in mitochondria of murine heart and liver. Cell Regul., 2, 467–477.[ISI][Medline]

  30. Chen, W., Jin, W., Tian, H., Sicurello, P., Frank, M., Orenstein, J.M. and Wahl, S.M. (2001) Requirement for transforming growth factor ß1 in controlling T cell apoptosis. J. Exp. Med., 194, 439–453.[Abstract/Free Full Text]

  31. Ferguson-Smith, A.C. and Surani, M.A. (2001) Imprinting and the epigenetic asymmetry between parental genomes. Science, 293, 1086–1089.[Abstract/Free Full Text]

  32. Constancia, M., Hemberger, M., Hughes, J., Dean, W., Ferguson-Smith, A., Fundele, R., Stewart, F., Kelsey, G., Fowden, A., Sibley, C. et al. (2002) Placental-specific IGF-II is a major modulator of placental and fetal growth. Nature, 417, 945–948.[CrossRef][Medline]

  33. St Johnston, D. (2002) The art and design of genetic screens: Drosophila melanogaster. Nat. Rev. Genet., 3, 176–188.[CrossRef][ISI][Medline]

  34. Morel, L., Blenman, K.R., Croker, B.P. and Wakeland, E.K. (2001) The major murine systemic lupus erythematosus susceptibility locus, Sle1, is a cluster of functionally related genes. Proc. Natl Acad. Sci. USA, 98, 1787–1792.[Abstract/Free Full Text]

  35. Steinmetz, L.M., Sinha, H., Richards, D.R., Spiegelman, J.I., Oefner, P.J., McCusker, J.H. and Davis, R.W. (2002) Dissecting the architecture of a quantitative trait locus in yeast. Nature, 416, 326–330.[CrossRef][Medline]

  36. Boackle, S.A., Holers, V.M., Chen, X., Szakonyi, G., Karp, D.R., Wakeland, E.K. and Morel, L. (2001) Cr2, a candidate gene in the murine Sle1c lupus susceptibility locus, encodes a dysfunctional protein. Immunity, 15, 775–785.[CrossRef][ISI][Medline]

  37. Phelan, S.A., Beier, D.R., Higgins, D.C. and Paigen, B. (2002) Confirmation and high resolution mapping of an atherosclerosis susceptibility gene in mice on Chromosome 1. Mamm. Genome, 13, 548–553.[CrossRef][ISI][Medline]

  38. Muller-Sieburg, C.E. and Riblet, R. (1996) Genetic control of the frequency of hematopoietic stem cells in mice: mapping of a candidate locus to chromosome 1. J. Exp. Med., 183, 1141–1150.[Abstract/Free Full Text]

  39. Boulton, E., Cole, C., Knight, A., Cleary, H., Snowden, R. and Plumb, M. (2002) Low penetrance genetic susceptibility and resistance loci implicated in the relative risk of radiation-induced acute myeloid leukaemia in mice. Blood, 101, 2349–2354.

  40. Tsao, B.P., Cantor, R.M., Kalunian, K.C., Chen, C.J., Badsha, H., Singh, R., Wallace, D.J., Kitridou, R.C., Chen, S.L., Shen, N. et al. (1997) Evidence for linkage of a candidate chromosome 1 region to human systemic lupus erythematosus. J. Clin. Invest., 99, 725–731.[ISI][Medline]

  41. Bieche, I., Champeme, M.H. and Lidereau, R. (1995) Loss and gain of distinct regions of chromosome 1q in primary breast cancer. Clin. Cancer Res., 1, 123–127.[Abstract/Free Full Text]

  42. Reinhold, D., Bank, U., Buhling, F., Junker, U., Kekow, J., Schleicher, E. and Ansorge, S. (1997) A detailed protocol for the measurement of TGF-ß1 in human blood samples. J. Immunol. Meth., 209, 203–206.[CrossRef][ISI][Medline]

  43. Abe, M., Harpel, J.G., Metz, C.N., Nunes, I., Loskutoff, D.J. and Rifkin, D.B. (1994) An assay for transforming growth factor-ß using cells transfected with a plasminogen activator inhibitor-1 promoter-luciferase construct. Anal. Biochem., 216, 276–284.[CrossRef][ISI][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Biol. Reprod.Home page
W. V. Ingman and S. A. Robertson
Mammary Gland Development in Transforming Growth Factor Beta1 Null Mutant Mice: Systemic and Epithelial Effects
Biol Reprod, October 1, 2008; 79(4): 711 - 717.
[Abstract] [Full Text] [PDF]

Home page
 J. Am. Soc. Nephrol.Home page
J. Ratelade, T. A. Lavin, A. O. Muda, L. Morisset, G. Mollet, O. Boyer, D. S. Chen, A. Henger, M. Kretzler, N. Hubner, et al.
Maternal Environment Interacts with Modifier Genes to Influence Progression of Nephrotic Syndrome
J. Am. Soc. Nephrol., August 1, 2008; 19(8): 1491 - 1499.
[Abstract] [Full Text] [PDF]

Home page
 DevelopmentHome page
K. Jiao, M. Langworthy, L. Batts, C. B. Brown, H. L. Moses, and H. S. Baldwin
Tgf{beta} signaling is required for atrioventricular cushion mesenchyme remodeling during in vivo cardiac development
Development, November 15, 2006; 133(22): 4585 - 4593.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
I. S. McLennan and K. Koishi
Fetal and Maternal Transforming Growth Factor-{beta}1 May Combine to Maintain Pregnancy in Mice
Biol Reprod, June 1, 2004; 70(6): 1614 - 1618.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science