Human Molecular Genetics, 2003, Vol. 12, No. 13 1631-1641
DOI: 10.1093/hmg/ddg172
© 2003 Oxford University Press
Lathosterolosis: an inborn error of human and murine cholesterol synthesis due to lathosterol 5-desaturase deficiency
ová3,41Unit on Molecular Dysmorphology, Heritable Disorders Branch, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD 20892, USA, 2The Johns Hopkins University, Kennedy Krieger Institute, Baltimore, MD 21205, USA, 3Institute of Molecular Genetics, Academy of Sciences of the Czech Republic, 14220 Prague, Czech Republic, 4Molecular Inflammation Section, National Institute of Arthritis and Musculoskeletal and Skin Diseases, National Institutes of Health, Bethesda, MD 20892, USA, 5Laboratory of Mammalian Genes and Development, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD 20892, USA, 6National Human Genome Research Institute, National Institutes of Health, Bethesda, MD 20892, USA, 7Genetics Patient Service Unit, Children's Hospital of Eastern Ontario, Ottawa, Ontario K1H 8L1, Canada and 8National Cancer Institute, National Institutes of Health, Bethesda, MD 20892, USA
Received March 31, 2003; Accepted May 7, 2003
| ABSTRACT |
|---|
|
|
|---|
Lathosterol 5-desaturase catalyzes the conversion of lathosterol to 7-dehydrocholesterol in the next to last step of cholesterol synthesis. Inborn errors of cholesterol synthesis underlie a group of human malformation syndromes including SmithLemliOpitz syndrome, desmosterolosis, CHILD syndrome, CDPX2 and lathosterolosis. We disrupted the lathosterol 5-desaturase gene (Sc5d ) in order to further our understanding of the pathophysiological processes underlying these disorders and to gain insight into the corresponding human disorder. Sc5d -/- pups were stillborn, had elevated lathosterol and decreased cholesterol levels, had craniofacial defects including cleft palate and micrognathia, and limb patterning defects. Many of the malformations found in Sc5d -/- mice are consistent with impaired hedgehog signaling, and appear to be a result of decreased cholesterol rather than increased lathosterol. A patient initially described as atypical SLOS with mucolipidosis was shown to have lathosterolosis by biochemical and molecular analysis. We identified a homozygous mutation of SC5D (137A>C, Y46S) in this patient. An unique aspect of the lathosterolosis phenotype is the combination of a malformation syndrome with an intracellular storage defect.
| INTRODUCTION |
|---|
|
|
|---|
Inborn errors of cholesterol synthesis have been shown to cause a number of human malformation syndromes. The prototypical example is the SmithLemliOpitz syndrome (SLOS) due to a deficiency of 3ß-hydroxysterol
7-reductase (DHCR7) activity (1). Other malformation syndromes due to cholesterol biosynthesis defects include desmosterolosis (3ß-hydroxysterol
24-reductase), X-linked dominant chondrodysplasia punctata type 2 (3ß-hydroxysterol
8,
7-isomerase), Greenberg skeletal dysplasia (3ß-hydroxysterol
14-reductase activity of the lamin B receptor), and CHILD syndrome (3ß-hydroxysterol
8,
7-isomerase and 3ß-hydroxysterol dehydrogenase). Although the molecular defect has not been reported, impaired lanosterol-14-
-demethylase activity has been associated with some cases of AntleyBixler syndrome. The clinical, biochemical and molecular aspects of these syndromes have been reviewed (25). Lathosterol 5-desaturase (SC5D) catalyzes the conversion of lathosterol to yield 7-dehydrocholesterol (7DHC) in the cholesterol synthetic pathway (Fig. 1A). In the subsequent enzymatic step, 7DHC is reduced by DHCR7 to yield cholesterol. Mutations of DHCR7 cause SLOS, which is an autosomal-recessive, multiple malformation/mental retardation syndrome with an estimated birth prevalence of about 1/25 000 to 1/40 000 in North America (3,6). We previously reported the development and characterization of a mouse model for SLOS (Dhcr7-/-) (7). Dhcr7-/- pups demonstrated growth retardation, craniofacial abnormalities including cleft palate, poor feeding and an uncoordinated suck, hypotonia and decreased movement. To understand the pathophysiological processes that underlie the genesis of the malformations found in SLOS and the Dhcr7-/- mouse, one needs to consider the potential detrimental effects of decreased cholesterol levels versus the teratogenic effects of increased 7DHC. To help distinguish between these two possibilities, we produced a mouse model in which Sc5d was disrupted. Sc5d mutant embryos would be expected to have decreased cholesterol levels similar to Dhcr7 mutant embryos; however, lathosterol rather than 7DHC would be the accumulating intermediate. A second goal of producing a Sc5d mutant mouse was to aid in the recognition of a human lathosterolosis syndrome.
|
We report the development and characterization of a lathosterolosis mouse model. Sc5d-/- pups are stillborn, demonstrate intrauterine growth retardation, have craniofacial abnormalities including cleft palate and micrognathia, and limb patterning defects. Many of the malformations are consistent with impaired hedgehog functioning during development due to decreased cholesterol levels. We also report the identification of a human lathosterolosis patient with an SLOS-like phenotype and mucolipidosis.
| RESULTS |
|---|
|
|
|---|
Disruption of the lathosterol 5-desaturase gene
Sc5d was disrupted in mouse embryonic stem cells using targeted homologous recombination. Recombination between the targeting vector and the endogenous Sc5d allele resulted in the insertion of the neomycin phosphotransferase gene (PGK-neor) and deletion of exon 5 and part of exon 6 of Sc5d (Fig. 1B). Southern blot analysis of EcoRI-digested genomic DNA from 129 G418-resistant embryonic stem cell clones identified two clones (1.5%) in which homologous recombination occurred between the targeting vector and a Sc5d allele. Proper targeting between both flanks of the targeting vector and the endogenous allele was initially detected by Southern blot analysis using probe A, and confirmed by PCR amplification of both flanks (Fig. 1C). Clones 48 and 83 were used to produce germline transmitting chimeric founders, and an identical phenotype was observed with both lines.
Heterozygous mice appeared phenotypically normal. Thus, we intercrossed Sc5d+/- mice to determine if a recessive phenotype was present. No Sc5d-/- mice were identified at weaning (n=322); however, when all pups and embryos were genotyped (n=426) we found a close to expected Mendelian ratio for an autosomal-recessive trait of 27.5% +/+, 50.2% +/- and 22.3% -/- (Fig. 1D).
Phenotypic characterization of Sc5d-/- mice
Homozygous mutant pups were stillborn, growth retarded, had craniofacial malformations, short limbs, autopod patterning defects and kinked tails (Fig. 2AO). Cardiac activity was detected in Sc5d-/- embryos just prior to birth, thus mutant pups died during or immediately after birth. Intrauterine growth retardation was present with mutant pups having a birth weight of 1.10±0.01 g (n=30) compared with a birth weight of 1.38±0.12 (n=86) for controls (P<0.001, unpaired t-test).
|
Craniofacial abnormalities included micrognathia, cleft palate, a narrow frontonasal process and calvarial defects. Micrognathia was present in all Sc5d-/- mice (Fig. 2AD). Alizarin red and alcian blue stained skeletal preparations demonstrated that the micrognathia was due to hypoplasia of the distal mandibular arch (Fig. 2C, D, F and G). Cleft palate (Fig. 2E) was observed in 14/16 (88%) of the Sc5d-/- pups but was not observed among 38 controls (P<0.0001, Fisher's exact test). In mutant pups the nose was narrower than normal (Fig. 2A, B and H), and the mineralized portion of the interparietal bone was hypoplastic (Fig. 2C, D and H).
Limb patterning defects were observed in both the proximaldistal as well as the preaxialpostaxial axes. Postaxial polydactyly, which consisted of a pedunculated postminimus with no skeletal elements (Fig. 2I), was identified on the forelimbs of 7/26 (32%) of Sc5d-/- and 4/76 (5%) littermate controls (P<0.01, Fisher's exact test). Skeletal preparations demonstrated short, malformed fore and hind limbs (Fig. 2JL) and variable expression of a bifurcation of the fourth medial phalanges of either the fore or hind limbs (Fig. 2M and N). The bifurcation of the fourth medial phalanges was identified in at least one limb, in 56% (5/9) of the Sc5d-/- embryos but in none of 10 control embryos (P=0.01, Fisher's exact test). Other phenotypic findings included gracile ribs (data not shown) and kinked tails (Fig. 2O). Histological examination was notable for decreased glycogen in the liver, decreased zymogen granules in the pancreas, increased vacuolation in brown fat, subcutaneous edema and diffuse atelectasis in the lung. No consistent abnormalities of the spleen, thymus, adrenal, testis/ovary or spinal cord were observed.
Identification of a human lathosterolosis patient
The Sc5d-/- mouse has many phenotypic features found in SLOS. Thus, we obtained a sterol profile on fibroblasts from an atypical SLOS patient who died at 18 weeks of age with intracellular storage (8). This patient resembled SLOS in that he had growth failure, microcephaly, ptosis, cataracts, short nose, micrognathia, prominent aveolar ridges, ambiguous genitalia, 23 toe syndactyly and postaxial hexadactyly of the feet. This patient differed from SLOS in that histopathological examination showed intracellular accumulation of mucopolysaccharides and lipids in tissue macrophages, liver Kupffer cells and in non-neuronal cells of the central nervous system. Compared with a control cell line, GC/MS analysis of sterols from patient fibroblasts grown in cholesterol-deficient media showed the presence of an additional sterol peak (Fig. 3A and B). The retention time of this peak matched that of a lathosterol standard. The mass spectrum of this peak matched both that of a lathosterol standard and published spectra for lathosterol (NIST). Consistent with a deficiency of SC5D activity, patient fibroblasts progressively accumulated lathosterol when grown in cholesterol-deficient medium (Fig. 3C). After 6 days in culture, lathosterol accounted for 35.0±1.3% (mean±SD, n=3) of total sterols in mutant fibroblasts compared with 6.9±0.8% (mean±SD, n=3) in control fibroblasts (P<0.001, unpaired t-test). To establish that deficient SC5D enzymatic activity in patient fibroblasts was due to mutation of the SC5D gene, the SC5D transcript from patient fibroblasts was amplified by RTPCR and sequenced. A single mutation, 137A>C (Y46S), was identified (Fig. 4A). This single mutation was confirmed by genomic sequencing. Both of the proband's parents were heterozygous for this mutation (Fig. 4A). No consanguinity was present; however, both parents are of French Canadian ancestry. The 137A>C allele was not detected in 116 normal chromosomes, and the Y46 position corresponds to a conserved amino acid (Fig. 4B) in the first coding exon. SC5D is encoded on chromosome 11.
|
|
Biochemical characterization of Sc5d-/- mice and fibroblasts
Sterol analysis, using gas chromatography/mass spectroscopy (GC/MS), showed that tissues from E18.5 Sc5d-/- embryos had markedly increased levels of lathosterol (Fig. 5A) and decreased levels of cholesterol (Fig. 5B) compared with tissues from either Sc5d+/+ or Sc5d+/- embryos. In various tissues lathosterol represented 39% (serum), 48% (cortex), 53% (midbrain), 62% (liver), 52% (kidney) or 55% (skeletal muscle) of total sterols. In Sc5d+/+ tissues, lathosterol accounted for 0.11.1% of total sterols, with the highest fractions in cortex (0.9%) and midbrain (1.1%). In cortex and midbrain from E18.5 Sc5d+/- embryos, lathosterol represented 3.5 and 4.2% of total sterols respectively, and in peripheral tissues ranged from 0.2 to 1.9% of total sterols. We characterized the accumulation of lathosterol during embryonic development. In liver tissue from Sc5d-/- embryos the fraction of lathosterol increased from 32% at E12.5 to 61% at E18.5 with a corresponding decrease in cholesterol (Fig. 5C). Analysis of sterol content from E12.5 to E18.5 embryonic brain tissue demonstrated increased lathosterol and markedly decreased cholesterol levels in Sc5d-/- embryos compared with Sc5d+/+ embryos (Fig. 5D). Decreased cholesterol levels in the older Sc5d-/- embryos probably represent a dilution of maternally derived cholesterol from the yolk sac as endogenous synthesis results in accumulation of lathosterol.
|
Desmosterol is a major sterol present in the central nervous system prior to the onset of myelination (9). In the synthesis of desmosterol, Sc5d catalyzes the conversion of cholesta-7,24-diene-3ß-ol to yield 7-dehydrodesmosterol which is then reduced by Dhcr7 to form desmosterol. In cortex tissue from E18.5 Sc5d-/- embryos desmosterol levels were markedly decreased, and there was a 35-fold accumulation of cholesta-7,24-diene-3ß-ol in addition to a 63-fold accumulation of lathosterol (Fig. 5E). Cortex tissue from heterozygous embryos showed a slight increase in both lathosterol (4.2-fold) and cholesta-7,24-diene-3ß-ol (2.2-fold).
The malformations found in the Sc5d-/- mice are more severe than those observed in Dhcr7-/- mice (7,10). We thus compared a number of biochemical parameters between Sc5d-/- and Dhcr7-/- embryos to determine what may underlie the increased severity in the lathosterolosis mouse model. To exclude either a greater total cholesterol or total sterol deficit in the lathosterolosis mouse model, we compared total cholesterol and total sterol levels in Dhcr7-/- and Sc5d-/- mouse tissues. We confirmed that total sterol levels are decreased in the serum from Dhcr7-/- E18.5 embryos as previously reported by Fitzky et al. (10); however, both total cholesterol and total sterol levels are similar in cortex and liver from Dhcr7-/- and Sc5d-/- E18.5 embryos (Fig. 5F). Total cholesterol measurements do not distinguish between unesterified and esterified cholesterol. Although total cholesterol levels were similar between the two mouse models, a greater deficit of unesterified or free cholesterol could potentially explain the increased phenotypic severity observed in the lathosterolosis mouse model. In E12.5 Sc5d-/- embryos the fraction of free cholesterol was significantly decreased compared to controls; however, a similar free cholesterol deficit was also observed in E12.5 Dhcr7-/- embryos (Fig. 5G). Cholesterol-rich raft fractions play a major role in signal transduction. We thus compared the partitioning of lathosterol and 7DHC into raft fractions. The ratio of either lathosterol or 7DHC to cholesterol in caveolin 1 positive raft fractions from either mouse embryonic fibroblasts or human skin fibroblasts grown in lipoprotein deficient medium was similar to the corresponding whole cell ratio of either lathosterol or 7DHC to cholesterol. Thus, we found no evidence for a difference in the incorporation of either lathosterol or 7DHC in cholesterol rafts.
Intracellular storage defect in lathosterolosis
A unique aspect of the described patient's phenotype was the finding of mucolipidosis. Therefore, we were therefore interested in determining if this aspect of the disorder was replicated in the mouse model. Although liver size was relatively increased in the Sc5d-/- pups (7% of body weight compared with 4% in controls), lysosomal storage was not evident upon histological examination of either liver or brain tissue. The lack of overt lysosomal accumulation may have been due to the early perinatal death of Sc5d-/- animals. We then tested whether this defect could be found in fibroblasts. When human SC5DY46S/Y46S and mouse Sc5d-/- fibroblasts were grown in cholesterol deficient media, enlarged membrane-bound cytoplasmic vacuoles with lamellar inclusions (arrows and insets) were present in cells from the lathosterolosis patient and the Sc5d-/- mouse (Fig. 6AD). Similar intracellular inclusions were not found in control cell lines. By morphological criteria, the intracellular inclusions appeared to be in lysosomes.
|
| DISCUSSION |
|---|
|
|
|---|
In this paper we report the development and characterization of a mutant mouse in which we disrupted Sc5d, and the identification of a human lathosterolosis patient. The development of this mouse model and the identification of a human patient provide further insight into the biological processes which underlie the malformations and clinical problems found in this distinct group of human malformation syndromes.
This is the second lathosterolosis patient to be identified (11). Although the phenotypic spectrum of lathosterolosis is not defined by two cases, similarities between these patients and SLOS led to their identification. Phenotypic findings of ptosis, cataracts, micrognathia with prominent alveolar ridges, ambiguous genitalia, 23 toe syndactyly and postaxial polydactyly found in the patient described in this paper are frequently described in SLOS patients (12). Phenotypic similarities between our patient and the previous patient include microcephaly, high arched palate, postaxial hexadactyly of the feet and toe syndactyly. Although liver disease was present in both patients, no intracellular storage was observed in a liver biopsy of the patient described by Brunetti-Pierri et al. (11). Hepatomegally due to intracellular storage is not reported in SLOS and may help in some cases to clinically separate the two disorders. Sterol analysis by GC/MS, which is the diagnostic test for SLOS, can distinguish between these two inborn errors of cholesterol synthesis. Fibroblasts from both patients accumulate lathosterol when grown in delipidated media. Consistent with the more severe phenotype found in our patient, lathosterol accounted for 35% of the total sterols in fibroblasts after 6 days in culture; whereas, lathosterol accounted for 12.5% of total sterols after 15 days in culture in the initial case.
The Sc5d mutant mouse model replicates many aspects of the human disorder. Biochemically, both the human patient and Sc5d-/- mice have a sterol profile characterized by a marked elevation of lathosterol and decreased cholesterol levels. Fibroblasts from both the human patient and the mouse model developed enlarged membrane-bound cytoplasmic vacuoles with inclusions when grown in cholesterol-deficient medium. Phenotypical similarities include growth failure, abnormal nasal structure, abnormal palate, micrognathia and postaxial polydactyly.
To understand the etiological processes underlying malformations found in the inborn errors of cholesterol biosynthesis and to understand the phenotypic differences observed in Sc5d-/- embryos compared to Dhcr7-/- embryos, one needs to consider a number of possible mechanisms. First, specific malformations could arise due to a cholesterol or sterol deficiency. Second, specific malformations could arise due to a specific teratogenic effect of bioactive cholesterol precursors. One goal of producing the lathosterolosis mouse model described in this manuscript was to compare the Sc5d-/- phenotype to the Dhcr7-/- phenotype. Both mutants have decreased tissue cholesterol levels; however, the accumulating sterol intermediates differ. A third mechanism that needs to be considered is that phenotypic differences could arise due to a functional sterol deficiency. In this case the ability of the accumulating sterol intermediate to functionally substitute for cholesterol could influence phenotypic expression or penetrance due to structural differences between the precursor sterols. Alternatively, cholesterol homeostasis could be perturbed in a manner that would decrease the amount of cholesterol available for biological processes. Specifically, alterations in cholesterol esterification or subcellular localization could lead to a functional cholesterol deficiency. It is unlikely that one of these postulated mechanisms will provide a unifying explanation to explain all of the phenotypic findings. The availability of both genetic and teratogenic mouse models which disrupt cholesterol synthesis at different enzymatic steps provide the tools to address this question. The teratogenic model systems are useful, but are limited by the lack of enzymatic specificity (1315). This paper reports the development of a lathosterolosis mouse model which can be directly compared with our previously reported SLOS mouse model (7).
Decreased cholesterol levels likely underlie some of the developmental malformations found in both lathosterolosis and SLOS. In rats, many of the teratogenic effects of AY9944, an inhibitor of both Dhcr7 and the sterol
8-isomerase, can be prevented by provision of cholesterol (1518). Furthermore, Gaoua et al. (18) showed that 7DHC, unlike cholesterol, does not prevent the teratogenic effects of AY9944. Impaired hedgehog function has been proposed as a mechanism underlying malformations found in SLOS (19). Hedgehog family members play diverse roles in embryonic development, and cholesterol is necessary for maturation of these morphogens (2022). Initially it was proposed that the presence of abnormal sterols would inhibit Shh autoprocessing; however, Cooper et al. (23) showed that 27-carbon cholesterol precursors including 7DHC and lathosterol can substitute for cholesterol in this reaction. Recent work has shown that hedgehog signaling is impaired in embryonic fibroblasts derived from both the Sc5d mutant mouse described in this paper and the Dhcr7 mutant mouse. Specifically, hedgehog signaling is impaired at the level of Smoothened, and this inhibition is due to decreased sterol levels (24).
Some of the craniofacial and limb anomalies in the Sc5d-/- mouse and the lathosterolosis patient are consistent with the hypothesis that hedgehog function is impaired during development. Hedgehog signaling is mediated by the receptor Patched, and binding of hedgehog to Patched relieves inhibition of Smoothened by Patched. Activation of Smoothened modulates activity of Gli proteins which regulate transcription of hedgehog related genes. Sonic hedgehog (Shh) is involved in craniofacial morphogenesis, and loss of Shh function results in a narrow frontonasal process, cleft palate and decreased distal development of the mandible (25,26). Consistent with a defect in Shh function, the Sc5d-/- embryos described in this paper had a narrow frontonasal process, a significant incidence of cleft palate, and micrognathia due to hypoplasia of the distal mandible. Mutations in GLI3 cause Greig cephalopolysyndactyly (27), postaxial polydactyly type-A/B (28), and Pallister Hall syndrome (29). These human syndromes include postaxial polydactyly. Postaxial polydactyly was observed in 32% of the Sc5d-/- pups, and in the human lathosterolosis patient identified in this report. Similarities between craniofacial and limb anomalies (post-axial polydactyly and 23 toe syndactyly) found in both SLOS and lathosterolosis are consistent with the hypothesis that hedgehog signaling is impaired due to low cholesterol levels.
Cleft palate is found in 88% of the Sc5d -/- pups. This malformation is also present in 9% of Dhcr7 -/- pups (7), and hemizygous male Tattered mouse embryos with mutation of the 3ß-hydroxysterol
7,
8-isomerase gene (30). 3ß-Hydroxysterol
7,
8-isomerase catalyzes the isomerization of cholesta-8(9)-en-3ß-ol to yield lathosterol in the enzymatic step immediately preceding Sc5d action. In the human syndromes due to inborn errors of cholesterol synthesis, cleft palate is reported in about a third of SLOS patients and has been described in desmosterolosis. Desmosterolosis is due to deficiency of 3ß-hydroxysterol
24-reductase, which catalyzes the reduction of desmosterol to yield cholesterol (31). The presence of cleft palate in two different human inborn errors of cholesterol synthesis and three distinct mouse mutants of this enzymatic pathway suggests that the mechanism underlying the cleft palate phenotype is probably due to decreased cholesterol during development rather than a consequence of a specific teratogenic effect of a precursor sterol. The higher frequency of cleft palate found in Sc5d-/- mice compared with Dhcr7-/- mice cannot be explained based solely on cholesterol or total sterol levels. Both total cholesterol and total sterol levels are decreased to a similar extent in embryonic tissues from these two mouse models. We also measured unesterified cholesterol levels in E12.5 day embryos to determine if a functional cholesterol deficiency could possibly explain differences between the Sc5d-/- and Dhcr7-/- mice. Although the fraction of total cholesterol which was unesterified was significantly decreased in both Sc5d-/- and Dhcr7-/- embryos compared with control embryos, this decrease was similar in both mutants. Decreased unesterified or free cholesterol levels may exacerbate the functional cholesterol deficit found in these two disorders. The increased frequency of cleft palate observed in the Sc5d-/- mice (88%) compared with Dhcr7-/- mice (9%) may be due to differences in the ability of lathosterol compared with 7DHC to substitute for cholesterol during development. Few studies have compared the biophysical properties of both 7DHC and lathosterol to those of cholesterol. Although both 7DHC and lathosterol are less efficient than cholesterol in condensing artificial membranes, the delta 5(6) bond of cholesterol, which is present in 7DHC but absent in lathosterol, is thought to optimize interaction between cholesterol and phospholipids (32). 7DHC has been reported to strongly promote the formation of sphingolipid/sterol raft domains (33); however, similar data on lathosterol is not published. Since both Smoothened and Patched localize to raft domains (34,35), we investigated the sterol composition of caveolin positive raft fractions from both SLOS and lathosterolosis fibroblasts. Although we cannot exclude a functional defect due to differences in sterol composition, both lathosterol and 7DHC are present in caveolin positive raft fractions. Further work is necessary to define the functional ability of 7DHC versus lathosterol to substitute for cholesterol.
Some malformations found in the inborn errors of cholesterol synthesis are probably due to specific teratogenic effects of bioactive precursor sterols. Precursor sterols may have bioactive properties themselves or could give rise to bioactive products. 4,4-dimethyl-5
-cholesta-8,24-diene-3ß-ol and 4,4-dimethyl-5
-cholesta-8,14,24-triene-3ß-ol are meiosis activating sterols (36) and are able to activate LXR
nuclear receptors (37). Both 7DHC and 8-DHC give rise to unsaturated bile acids (38) and unsaturated steroid hormone precursors (39,40). It is yet to be determined whether the resulting aberrant unsaturated steroids have agonistic or antagonistic properties; however, it is plausible that their presence may affect developmental processes. Chevy et al. (41) have recently postulated that limb abnormalities not found in AY9944 treated, but found in triparanol treated rat embryos are likely due to effects of desmosterol,
8-cholesten-3ß-ol and zymosterol rather than decreased cholesterol levels. Triparanol inhibits both sterol
24-reductase and sterol
8-isomerase. In vitro culture of rat embryos with photooxidized 7DHC impairs development of the embryos (42). 7DHC has been shown to disturb cholesterol homeostasis. Fitzky et al. (10) have shown that 7DHC induces the degradation of HMG-CoA reductase, and have proposed that this mechanism underlies the decreased total sterol levels found in SLOS. Wassif et al. (43) have shown that 7DHC impairs LDL-cholesterol metabolism in SLOS fibroblasts. Hemizygous male tattered mice (Td ), which have a mutation of the 3ß-hydroxysterol
7,
8-isomerase gene, have agenesis of the intestines (30). Hemizygous male bare patches (Bpa) and striated mice (Str), which have a mutation of the 3ß-hydroxysterol dehydrogenase gene, die early in gestation (44). These abnormalities are not observed in either Sc5d-/- or Dhcr7-/- embryos, and thus may represent a specific teratogenic defect due to accumulation of cholesta-8(9)-en-3ß-ol or 4,4-dimethylcholesta-8-en-3ß-ol in Td or Bpa/Str embryos, respectively. The bifurcation of the fourth medial phalanges found in Sc5d-/- embryos has not been reported in other inborn errors of cholesterol synthesis, and thus may be due to a specific teratogenic effect of lathosterol accumulation.
The multiple malformations and clinical problems encountered in SLOS and other inborn errors of cholesterol synthesis probably arise due to a combined effect of increased precursor levels, decreased cholesterol levels and variable ability of the precursor sterols to functionally substitute for cholesterol. Comparison of phenotypic findings found in the human disorders, the teratogenic rat models, and genetic mouse models should provide insight into the genesis of a specific malformation.
Histochemical staining showed the storage of both lipid and mucopolysaccharides and lysosomal inclusions were identified by electron microscopy in tissue samples from the lathosterolosis patient (8). Intracellular LDL cholesterol transport is perturbed in SLOS fibroblasts (43). In both DHCR7 and SC5D mutant fibroblasts we have observed transient increased filipin staining. This suggests that LDL-cholesterol metabolism may be impaired in both disorders. Altered intracellular cholesterol levels have been shown to modulate membrane and lipid trafficking in normal and sphingolipid-storage disease fibroblasts (45,46). Based on the histochemical findings reported for the human patient and the replication of the intracellular storage defect in both human and murine fibroblasts when grown in cholesterol deficient medium, we postulate that accumulation of lathosterol may disrupt normal intracellular membrane and lipid trafficking.
This paper describes the identification of a human lathosterolosis patient and characterization of a lathosterolosis mouse model. The lathosterolosis mouse which replicates many of the defects described in the lathosterolosis patient will permit further investigation of the pathophysiological processes that underlie this human malformation syndrome. The lysosomal storage defects reported in the human lathosterolosis patient and the identification of an intracellular storage defect in Sc5d-/- fibroblasts raises the question of whether other unclassified mucolipidosis or lysosomal storage patients have mutations in SC5D. Identification of additional patients will be important to delineate the full phenotypic spectrum of lathosterolosis and to determine if less severely affected patients exist. Based on the clinical experience with SLOS, dietary cholesterol supplementation may benefit these patients.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Targeting of embryonic stem cells, generation of chimeric mice and mouse manipulation
Two bacterial artificial chromosomes (BAC) containing Sc5d were identified by hybridization to a mouse EST (AA245978) (Genome Systems). Prior to constructing the targeting vector, a 14.5 kb HindIII/EcoRI fragment containing exons 16 was cloned into pBS (Stratagene), a restriction endonuclease map was obtained, and the intronexon structure of the gene was delineated. The targeting vector was constructed in pBS and consisted of a 4.3 kb EcoRV/PstI5'-flank, a 2.5 kb BglII/HindIII3'-flank and a PGKneo® cassette (Stratagene). A 2.2 kb PstI/BglII fragment encoding exon 5 and most of exon 6 was deleted. The negative selectable marker, DTA, was cloned into a SalI site. The targeting vector was linearized on the 5' end of the targeting construct with NotI. Electroporation and cell culture conditions were as previously described (7). Screening of G418-resistant clones was performed by Southern blot of an EcoRI genomic digest probed with a 600 bp PstI/HindIII genomic fragment (probe A). The endogenous fragment was 7 kb and the targeted allele fragment was 13 kb. Positive clones were confirmed by long-range PCR (Expand kit, Roche) with primers internal to the neomycin resistance gene and external to the targeting flanks: 5'-flankprimer A-5'-CAGCTGGACAGCCGCGAGTG-3' and primer B-5'-TGACGAGTTCTTC TGAGGGG-3'; 3'-flankprimer C-5-'CCCCTCAGAAGAA CTCGTCA-3' and primer D-5'-GGTTTGACTTAGGAGTTC ACTGC-3'. Four PCR primers were used in a combined reaction for genotyping. These were mutantG-5'-CTGTGCTCGAC GTTGTCACTG-3' and H-5'-GATCCCCTCAGAAGAACTC GT-3', which amplify a 600 bp fragment of the neomycin phosphotransferase geneand wild-typeE-5'-ATGCTTTTC ACCCTGTGGAC-3' and F-5'-GTGGTGGTCTGTGTGGT GAG-3', which amplify a 200 bp product of exon 6. PCR cycling conditions consisted of 5 min denaturation at 94°C followed by 35 cycles of 30 s at 94°C, 60 s at 63°C, 60 s at 72°C and a final extension of 10 min at 72°C. For timed matings, the identification of a copulatory plug was considered to be E0.5 and embryonic age was confirmed by inspection. Animal work was performed under an NICHD approved animal study protocol.
Sterol analysis
For sterol analysis, cell pellets were homogenized and saponified for 1 h with 4% KOH in ethanol at 60°C. Five micrograms of coprostanol were added as an internal standard. The samples were then extracted in an equal volume of ethyl acetate, dried under nitrogen and derivitized with BSFTA plus 1% TMCS (Pierce). Samples were analyzed by both gas chromatography/flame ionization detection (Agilent 6890) and gas chromatography/mass spectrometry (Trace Thermo Finnigan) using a Phenomenex ZB-1701 column (30 mx0.32 mmx0.25 µm). Cholesterol, coprostanol, 7-dehydrocholesterol, and lathosterol standards were obtained from Sigma. For free sterol analysis, the sample was divided and half was analyzed without saponification.
Histological analysis
Tissues were fixed using buffered formalin (Sigma), paraffin-embedded, and stained with hematoxylin and eosin. Skeletal staining with alcian blue and alizarin red S was performed as described by McLeod (47). For electron microscopy, cell pellets or tissues were fixed in 2.5% glutaraldehyde in PBS (pH 7.4), postfixed in OsO4, and embedded in Maraglas 655 (Ladd Research Industries). Sections were stained with uranyl acetatelead citrate and examined in a Philips CM10 electron microscope.
Cell culture
Mouse and human fibroblasts were grown (37°C, 5% CO2) in DMEM supplemented with 10% fetal bovine serum. 3T3-like mouse embryo fibroblasts were derived as previously described (48). Cholesterol-deficient culture was done in McCoy's 5A media supplemented with 7.5% lipoprotein deficient serum (49). Caveolin-positive membrane fractions were purified from embryonic fibroblasts as previously described (50).
Mutation and molecular biology analysis
RNA for RTPCR was isolated using an RNeasy mini kit (Qiagene), and DNA was isolated using a Gentra kit. Sequencing was performed using Beckmann Coulter's CEQ2000 sequencer and reagents. Primers used for RTPCR were: C5h1-5'-GGGCTAAGTGATGGATCTTG-3' and C5h6-5'-CCACGATGCTGATTTCCAA-3' ( product size, 1 kb). RTPCR was performed using SuperScript RTPCR One Step (Invitrogen) with the following cycling conditions: 30 min at 50°C, 2 min at 94°C, 35 cycles of 94°C for 15 s, 60°C for 30 s and 72°C for 90 s with a final extension at 72°C for 10 min. The RTPCR product was gel-purified (GeneClean II) and sequenced using primers C5h1, C5h6, C5h2-5'ATGAAGGCCTCTGTGAATCC, C5h3-5'-TGATGACCTAGGAGAGTTTCCA-3', C5h4-5'-GCCAATCCTATCCCACAAAG-3' and C5h5-5'-TCATGACGGTGA TTTTCGTG-3'. The SC5D coding sequence was identified in Genbank (XP_033679) and used to search the human genome sequence (www.ncbi.nlm.nih.gov/genome/seq/page.cgi?F=HsBlast.html&&ORG=Hs). Individual exons were amplified by PCR, gel purified, and sequenced. Genomic DNA was sequenced using intronic primers: exon 1 (405 bp) C5he1F (-54) 5'-GCCTGGAAAAATAGAGACATGG3', C5he1R (+131) 5'-ACCCATTTGTGGTTGGTCTC-3', exon 2 (410 bp) C5he2Fa (-119) 5'-GTTTGGAGGTAAGCCCCTTC-3', C5he2Ra (+155) 5'-GCAAGACATGAACACATGAAAA-3', exon 3 (246 bp) C5he3F (-47) 5'-CCCAGGAGCTGAGTTTTGAT-3', C5he3R (+97) 5'-TGGGTAGAGGAAATTCTTGGAA-3', exon 4 (390 and 401 bp) C5he4Fa (-80) 5'-TCCAACATGAG TGTGAGAAGC-3', C5he4Ra (c834as) 5'-GCCAATCCTAT CCCACAAAG-3', C5he4Fb (c717as) 5'-ATTTTCGTGT CCCCCAAATC-3', C5he4Rb (c1116as) 5'-CCACGATGC TGATTTCCAA. Genomic PCR was performed using Invitrogen's Platinum Taq DNA polymerase with a final magnesium concentration of 2.0 mM. Cycling conditions were: 94°C for 2 min followed by 35 cycles of 94°C for 30 s, 62°C for 30 s, 72°C for 30 s and a final extension at 72°C for 10 min. Homology alignments were performed using BoxShade (http://molbio.info.nih.gov/molbio/gcglite/boxshade.html).
| ACKNOWLEDGEMENTS |
|---|
We would like to thank Sing-Ping Huang, Dr Heiner Westphal, Dr Diana Hanes and Dr Jerrold Ward for their assistance with this project. We would like to acknowledge the contribution of Peter Carolan in performing the whole mount in situ experiments and the efforts of Mones Abu-Asab. The 8(9)-cholestenol was a gift from the Schroepfer laboratory. We would like to thank Brooke Wright, Dr Lina Cerro-Correa, Dr Janice Chou and Dr William Gahl for their input on this manuscript, and acknowledge the assistance of Todd Hunter for searching through dusty attic files to track down patient records. Finally, we would like to express our gratitude to the parents of the child described in this paper for their continued help and understanding.
| FOOTNOTES |
|---|
* To whom correspondence should be addressed at: HDB, NICHD, NIH, Bld. 10, Rm 9S241, 10 Center Dr., Bethesda, MD 20892, USA. Tel: +1 3014354432; Fax: +1 3014805791; Email: fdporter{at}helix.nih.gov
| REFERENCES |
|---|
|
|
|---|
-
Tint, G.S., Irons, M., Elias, E.R., Batta, A.K., Frieden, R., Chen, T.S. and Salen, G. (1994) Defective cholesterol biosynthesis associated with the SmithLemliOpitz syndrome. New Engl. J. Med., 330, 107113.
[Abstract/Free Full Text] - Kelley, R.I. (2000) Inborn errors of cholesterol biosynthesis. Adv. Pediatr., 47, 153.[Medline]
- Kelley, R.I. and Herman, G.E. (2001) Inborn errors of sterol biosynthesis. A. Rev. Genomics Hum. Genet., 2, 299341.
- Opitz, J.M., Gilbert-Barness, E., Ackerman, J. and Lowichik, A. (2002) Cholesterol and development: the RSH (SmithLemliOpitz) syndrome and related conditions. Pediatr. Pathol. Mol. Med., 21, 153181.[CrossRef][Web of Science][Medline]
- Waterham, H.R., Koster, J., Mooyer, P., Noort Gv, G., Kelley, R.I., Wilcox, W.R., Wanders, R.J., Hennekam, R.C. and Oosterwijk, J.C. (2003) Autosomal recessive HEM/Greenberg skeletal dysplasia is caused by 3beta- hydroxysterol delta14-reductase deficiency due to mutations in the lamin B receptor gene. Am. J. Hum. Genet., 72, 10131017.[CrossRef][Web of Science][Medline]
- Nowaczyk, M.J., McCaughey, D., Whelan, D.T. and Porter, F.D. (2001) Incidence of SmithLemliOpitz syndrome in Ontario, Canada. Am. J. Med. Genet., 102, 1820.[CrossRef][Medline]
-
Wassif, C.A., Zhu, P., Kratz, L., Krakowiak, P.A., Battaile, K.P., Weight, F.F., Grinberg, A., Steiner, R.D., Nwokoro, N.A., Kelley, R.I. et al. (2001) Biochemical, phenotypic and neurophysiological characterization of a genetic mouse model of RSH/SmithLemliOpitz syndrome. Hum. Mol. Genet., 10, 555564.
[Abstract/Free Full Text] - Parnes, S., Hunter, A.G., Jimenez, C., Carpenter, B.F. and MacDonald, I. (1990) Apparent SmithLemliOpitz syndrome in a child with a previously undescribed form of mucolipidosis not involving the neurons. Am. J. Med. Genet., 35, 397405.[CrossRef][Medline]
- Dennick, R.G., Worthington, K.J., Abramovich, D.R. and Dean, P.D. (1974) Sterol content and squaline-2(3)-epoxide-lanosterol cyclase activity in human foetal brain during early and mid-gestation. J. Neurochem., 22, 10191025.[Medline]
- Fitzky, B.U., Moebius, F.F., Asaoka, H., Waage-Baudet, H., Xu, L., Xu, G., Maeda, N., Kluckman, K., Hiller, S., Yu, H. et al. (2001) 7-Dehydrocholesterol-dependent proteolysis of HMG-CoA reductase suppresses sterol biosynthesis in a mouse model of SmithLemliOpitz/RSH syndrome. J. Clin. Invest., 108, 905915.[CrossRef][Web of Science][Medline]
- Brunetti-Pierri, N., Corso, G., Rossi, M., Ferrari, P., Balli, F., Rivasi, F., Annunziata, I., Ballabio, A., Russo, A.D., Andria, G. et al. (2002) Lathosterolosis, a novel multiple-malformation/mental retardation syndrome due to deficiency of 3beta-hydroxysteroid-delta5-desaturase. Am. J. Hum. Genet., 71, 952958.[CrossRef][Web of Science][Medline]
-
Kelley, R.I. and Hennekam, R.C. (2000) The SmithLemliOpitz syndrome. J. Med. Genet., 37, 321335.
[Abstract/Free Full Text] - Rahier, A. and Taton, M. (1996) Sterol biosynthesis: strong inhibition of maize delta 5,7-sterol delta 7-reductase by novel 6-aza-B-homosteroids and other analogs of a presumptive carbocationic intermediate of the reduction reaction. Biochemistry, 35, 70697076.[CrossRef][Medline]
-
Popjak, G., Meenan, A., Parish, E.J. and Nes, W.D. (1989) Inhibition of cholesterol synthesis and cell growth by 24(R,S),25-iminolanosterol and triparanol in cultured rat hepatoma cells. J. Biol. Chem., 264, 62306238.
[Abstract/Free Full Text] - Llirbat, B., Wolf, C., Chevy, F., Citadelle, D., Bereziat, G. and Roux, C. (1997) Normal and inhibited cholesterol synthesis in the cultured rat embryo. J. Lipid Res., 38, 2234.[Abstract]
- Roux, C., Horvath, C. and Dupuis, R. (1979) Teratogenic action and embryo lethality of AY9944. Prevention by a hypercholesterolemia-provoking diet. Teratology, 19, 3538.[CrossRef][Web of Science][Medline]
-
Barbu, V., Roux, C., Lambert, D., Dupuis, R., Gardette, J., Maziere, J.C., Maziere, C., Elefant, E. and Polonovski, J. (1988) Cholesterol prevents the teratogenic action of AY 9944: importance of the timing of cholesterol supplementation to rats. J. Nutr., 118, 774779.
[Abstract/Free Full Text] -
Gaoua, W., Wolf, C., Chevy, F., Ilien, F. and Roux, C. (2000) Cholesterol deficit but not accumulation of aberrant sterols is the major cause of the teratogenic activity in the SmithLemliOpitz syndrome animal model. J. Lipid Res., 41, 637646.
[Abstract/Free Full Text] - Kelley, R.L., Roessler, E., Hennekam, R.C., Feldman, G.L., Kosaki, K., Jones, M.C., Palumbos, J.C. and Muenke, M. (1996) Holoprosencephaly in RSH/SmithLemliOpitz syndrome: does abnormal cholesterol metabolism affect the function of Sonic Hedgehog? Am. J. Med. Genet., 66, 478484.[CrossRef][Web of Science][Medline]
- Porter, J.A., von Kessler, D.P., Ekker, S.C., Young, K.E., Lee, J.J., Moses, K. and Beachy, P.A. (1995) The product of hedgehog autoproteolytic cleavage active in local and long-range signalling. Nature, 374, 363366.[CrossRef][Medline]
- Porter, J.A., Ekker, S.C., Park, W.J., von Kessler, D.P., Young, K.E., Chen, C.H., Ma, Y., Woods, A.S., Cotter, R.J., Koonin, E.V. et al. (1996) Hedgehog patterning activity: role of a lipophilic modification mediated by the carboxy-terminal autoprocessing domain. Cell, 86, 2134.[CrossRef][Web of Science][Medline]
-
Porter, J.A., Young, K.E. and Beachy, P.A. (1996) Cholesterol modification of hedgehog signaling proteins in animal development. Science, 274, 255259.
[Abstract/Free Full Text] -
Cooper, M.K., Porter, J.A., Young, K.E. and Beachy, P.A. (1998) Teratogen-mediated inhibition of target tissue response to Shh signaling. Science, 280, 16031607.
[Abstract/Free Full Text] - Cooper, M.K., Wassif, C.A., Krakowiak, P.A., Taipale, J., Gong, R., Kelley, R.I., Porter, F.D. and Beachy, P.A. (2003) A defective response to Hedgehog signaling in disorders of cholesterol biosynthesis. Nat. Genet., 33, 508513.[CrossRef][Web of Science][Medline]
- Hu, D. and Helms, J.A. (1999) The role of sonic hedgehog in normal and abnormal craniofacial morphogenesis. Development, 126, 48734884.[Abstract]
-
ten Berge, D., Brouwer, A., Korving, J., Reijnen, M.J., van Raaij, E.J., Verbeek, F., Gaffield, W. and Meijlink, F. (2001) Prx1 and Prx2 are upstream regulators of sonic hedgehog and control cell proliferation during mandibular arch morphogenesis. Development, 128, 29292938.
[Abstract/Free Full Text] - Vortkamp, A., Gessler, M. and Grzeschik, K.H. (1991) GLI3 zinc-finger gene interrupted by translocations in Greig syndrome families. Nature, 352, 539540.[CrossRef][Medline]
- Radhakrishna, U., Bornholdt, D., Scott, H.S., Patel, U.C., Rossier, C., Engel, H., Bottani, A., Chandal, D., Blouin, J.L., Solanki, J.V. et al. (1999) The phenotypic spectrum of GLI3 morphopathies includes autosomal dominant preaxial polydactyly type-IV and postaxial polydactyly type-A/B; no phenotype prediction from the position of GLI3 mutations. Am. J. Hum. Genet., 65, 645655.[CrossRef][Web of Science][Medline]
- Kang, S., Graham, J.M., Jr., Olney, A.H. and Biesecker, L.G. (1997) GLI3 frameshift mutations cause autosomal dominant PallisterHall syndrome. Nat. Genet., 15, 266268.[CrossRef][Web of Science][Medline]
- Derry, J.M., Gormally, E., Means, G.D., Zhao, W., Meindl, A., Kelley, R.I., Boyd, Y. and Herman, G.E. (1999) Mutations in a delta 8-delta 7 sterol isomerase in the tattered mouse and X-linked dominant chondrodysplasia punctata. Nat. Genet., 22, 286290.[CrossRef][Web of Science][Medline]
- Waterham, H.R., Koster, J., Romeijn, G.J., Hennekam, R.C., Vreken, P., Andersson, H.C., FitzPatrick, D.R., Kelley, R.I. and Wanders, R.J. (2001) Mutations in the 3beta-hydroxysterol Delta24-reductase gene cause desmosterolosis, an autosomal recessive disorder of cholesterol biosynthesis. Am. J. Hum. Genet., 69, 685694.[CrossRef][Web of Science][Medline]
- Ranadive, G.N. and Lala, A.K. (1987) Sterol-phospholipid interaction in model membranes: role of C5-C6 double bond in cholesterol. Biochemistry, 26, 24262431.[CrossRef][Medline]
-
Xu, X., Bittman, R., Duportail, G., Heissler, D., Vilcheze, C. and London, E. (2001) Effect of the structure of natural sterols and sphingolipids on the formation of ordered sphingolipid/sterol domains (rafts). Comparison of cholesterol to plant, fungal, and disease-associated sterols and comparison of sphingomyelin, cerebrosides, and ceramide. J. Biol. Chem., 276, 3354033546.
[Abstract/Free Full Text] -
Rietveld, A., Neutz, S., Simons, K. and Eaton, S. (1999) Association of sterol- and glycosylphosphatidylinositol-linked proteins with Drosophila raft lipid microdomains. J. Biol. Chem., 274, 1204912054.
[Abstract/Free Full Text] -
Karpen, H.E., Bukowski, J.T., Hughes, T., Gratton, J.P., Sessa, W.C. and Gailani, M.R. (2001) The sonic hedgehog receptor patched associates with caveolin-1 in cholesterol-rich microdomains of the plasma membrane. J. Biol. Chem., 276, 1950319511.
[Abstract/Free Full Text] - Byskov, A.G., Andersen, C.Y., Nordholm, L., Thogersen, H., Xia, G., Wassmann, O., Andersen, J.V., Guddal, E. and Roed, T. (1995) Chemical structure of sterols that activate oocyte meiosis. Nature, 374, 559562.[CrossRef][Medline]
- Janowski, B.A., Willy, P.J., Devi, T.R., Falck, J.R. and Mangelsdorf, D.J. (1996) An oxysterol signalling pathway mediated by the nuclear receptor LXR alpha. Nature, 383, 728731.[CrossRef][Medline]
-
Honda, A., Salen, G., Shefer, S., Batta, A.K., Honda, M., Xu, G., Tint, G.S., Matsuzaki, Y., Shoda, J. and Tanaka, N. (1999) Bile acid synthesis in the SmithLemliOpitz syndrome: effects of dehydrocholesterols on cholesterol 7alpha-hydroxylase and 27- hydroxylase activities in rat liver. J. Lipid Res., 40, 15201528.
[Abstract/Free Full Text] - Shackleton, C.H., Roitman, E., Guo, L.-W., Wilson, W.K. and Porter, F.D. (2002) Identification of 7(8) and 8(9) unsaturated adrenal steroid metabolites produced by patients with 7-dehydrocholesterol-delta7-reductase deficiency (SmithLemliOpitz syndrome). J. Steroid Biochem. Mol. Biol., 82, 225232.[CrossRef][Web of Science][Medline]
-
Shackleton, C.H., Roitman, E., Kratz, L.E. and Kelley, R.I. (1999) Equine type estrogens produced by a pregnant woman carrying a SmithLemliOpitz syndrome fetus. J. Clin. Endocrinol. Metab., 84, 11571159.
[Abstract/Free Full Text] -
Chevy, F., Illien, F., Wolf, C. and Roux, C. (2002) Limb malformations of rat fetuses exposed to a distal inhibitor of cholesterol biosynthesis. J. Lipid Res., 43, 11921200.
[Abstract/Free Full Text] -
Gaoua, W., Chevy, F., Roux, C. and Wolf, C. (1999) Oxidized derivatives of 7-dehydrocholesterol induce growth retardation in cultured rat embryos: a model for antenatal growth retardation in the SmithLemliOpitz syndrome. J. Lipid Res., 40, 456463.
[Abstract/Free Full Text] - Wassif, C.A., Vied, D., Tsokos, M., Connor, W.E., Steiner, R.D. and Porter, F.D. (2002) Cholesterol storage defect in RSH/SmithLemliOpitz syndrome fibroblasts. Mol. Genet. Metab., 75, 325334.[CrossRef][Web of Science][Medline]
- Liu, X.Y., Dangel, A.W., Kelley, R.I., Zhao, W., Denny, P., Botcherby, M., Cattanach, B., Peters, J., Hunsicker, P.R., Mallon, A.M. et al. (1999) The gene mutated in bare patches and striated mice encodes a novel 3beta-hydroxysteroid dehydrogenase. Nat. Genet., 22, 182187.[CrossRef][Web of Science][Medline]
- Puri, V., Watanabe, R., Dominguez, M., Sun, X., Wheatley, C.L., Marks, D.L. and Pagano, R.E. (1999) Cholesterol modulates membrane traffic along the endocytic pathway in sphingolipid-storage diseases. Nat. Cell Biol., 1, 386388.[CrossRef][Web of Science][Medline]
-
Puri, V., Watanabe, R., Singh, R.D., Dominguez, M., Brown, J.C., Wheatley, C.L., Marks, D.L. and Pagano, R.E. (2001) Clathrin-dependent and -independent internalization of plasma membrane sphingolipids initiates two Golgi targeting pathways. J. Cell Biol., 154, 535547.
[Abstract/Free Full Text] - McLeod, M.J. (1980) Differential staining of cartilage and bone in whole mouse fetuses by alcian blue and alizarin red S. Teratology, 22, 299301.[CrossRef][Web of Science][Medline]
- Aaronson, S.A. and Todaro, G.J. (1968) Development of 3T3-like lines from a Balb/c mouse embryo cultures: Transformation susceptibility to SV40. J. Cell. Physiol., 72, 141148.[CrossRef][Web of Science][Medline]
- Cham, B.E. and Knowles, B.R. (1976) A solvent system for delipidation of plasma or serum without protein precipitation. J. Lipid Res., 17, 176181.[Abstract]
-
Kovarova, M., Tolar, P., Arudchandran, R., Draberova, L., Rivera, J. and Draber, P. (2001) Structure-function analysis of Lyn kinase association with lipid rafts and initiation of early signaling events after Fcepsilon receptor I aggregation. Mol. Cell. Biol., 21, 83188328.
[Abstract/Free Full Text]
This article has been cited by other articles:
![]() |
K. Schmidt, C. Hughes, J. A. Chudek, S. R. Goodyear, R. M. Aspden, R. Talbot, T. E. Gundersen, R. Blomhoff, C. Henderson, C. R. Wolf, et al. Cholesterol Metabolism: the Main Pathway Acting Downstream of Cytochrome P450 Oxidoreductase in Skeletal Development of the Limb Mol. Cell. Biol., May 15, 2009; 29(10): 2716 - 2729. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Honda, K. Yamashita, H. Miyazaki, M. Shirai, T. Ikegami, G. Xu, M. Numazawa, T. Hara, and Y. Matsuzaki Highly sensitive analysis of sterol profiles in human serum by LC-ESI-MS/MS J. Lipid Res., September 1, 2008; 49(9): 2063 - 2073. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Wassif, K. E. Brownson, A. L. Sterner, A. Forlino, P. M. Zerfas, W. K. Wilson, M. F. Starost, and F. D. Porter HEM dysplasia and ichthyosis are likely laminopathies and not due to 3{beta}-hydroxysterol {Delta}14-reductase deficiency Hum. Mol. Genet., May 15, 2007; 16(10): 1176 - 1187. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. S. Tint, H. Yu, Q. Shang, G. Xu, and S. B. Patel The use of the Dhcr7 knockout mouse to accurately determine the origin of fetal sterols J. Lipid Res., July 1, 2006; 47(7): 1535 - 1541. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Gondre-Lewis, H. I. Petrache, C. A. Wassif, D. Harries, A. Parsegian, F. D. Porter, and Y. P. Loh Abnormal sterols in cholesterol-deficiency diseases cause secretory granule malformation and decreased membrane curvature. J. Cell Sci., May 1, 2006; 119(Pt 9): 1876 - 1885. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. S. Correa-Cerro, C. A. Wassif, L. Kratz, G. F. Miller, J. P. Munasinghe, A. Grinberg, S. J. Fliesler, and F. D. Porter Development and characterization of a hypomorphic Smith-Lemli-Opitz syndrome mouse model and efficacy of simvastatin therapy Hum. Mol. Genet., March 15, 2006; 15(6): 839 - 851. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A Woollett Maternal cholesterol in fetal development: transport of cholesterol from the maternal to the fetal circulation Am. J. Clinical Nutrition, December 1, 2005; 82(6): 1155 - 1161. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||










