Human Molecular Genetics

This Article Abstract FREE Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Search for citing articles in: ISI Web of Science (57) Request Permissions Google Scholar Articles by Badano, J. L. Articles by Katsanis, N. Search for Related Content PubMed PubMed Citation Articles by Badano, J. L. Articles by Katsanis, N. Social Bookmarking          What's this?

Human Molecular Genetics, 2003, Vol. 12, No. 14 1651-1659
DOI: 10.1093/hmg/ddg188
© 2003 Oxford University Press

Heterozygous mutations in BBS1, BBS2 and BBS6 have a potential epistatic effect on Bardet–Biedl patients with two mutations at a second BBS locus

Jose L. Badano¹, Jun Chul Kim², Bethan E. Hoskins³, Richard Alan Lewis⁴, Stephen J. Ansley¹, David J. Cutler¹, Claudio Castellan⁵, Philip L. Beales³, Michel R. Leroux² and Nicholas Katsanis^1,5,6,*

¹Institute of Genetic Medicine, Johns Hopkins University, 600 North Wolfe Street, Baltimore, MD 21287, USA, ²Department of Molecular Biology and Biochemistry, Simon Fraser University, Burnaby, BC, Canada V5A 1S6, ³Molecular Medicine Unit, Institute of Child Health, University College London, London WC1N 1EH, UK, ⁴Departments of Molecular and Human Genetics, Ophthalmology, Pediatrics, and Medicine, Baylor College of Medicine, One Baylor Plaza, Houston TX 77030, USA, ⁵The Clinical Genetics Service, Bolzano General Hospital, Bolzano 39100, Italy and ⁶Wilmer Eye Institute, Johns Hopkins University, 600 North Wolfe Street, Baltimore, MD 21287, USA

Received March 3, 2003; Accepted May 19, 2003

	ABSTRACT

TOP ABSTRACT INTRODUCTION RESULTS DISCUSSION MATERIALS AND METHODS REFERENCES

 
Bardet–Biedl syndrome (BBS) is a pleiotropic genetic disorder with substantial inter- and intrafamilial variability, that also exhibits remarkable genetic heterogeneity, with seven mapped BBS loci in the human genome. Recent data have demonstrated that BBS may be inherited either as a simple Mendelian recessive or as an oligogenic trait, since mutations at two loci are sometimes required for pathogenesis. This observation suggests that genetic interactions between the different BBS loci may modulate the phenotype, thus contributing to the clinical variability of BBS. We present three families with two mutations in either BBS1 or BBS2, in which some but not all patients carry a third mutation in BBS1, BBS2 or the putative chaperonin BBS6. In each example, the presence of three mutant alleles correlates with a more severe phenotype. For one of the missense alleles, we also demonstrate that the introduction of the mutation in mammalian cells causes a dramatic mislocalization of the protein compared with the wild-type. These data suggest that triallelic mutations are not always necessary for disease manifestation, but might potentiate a phenotype that is caused by two recessive mutations at an independent locus, thus introducing an additional layer of complexity on the genetic modeling of oligogenicity.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION RESULTS DISCUSSION MATERIALS AND METHODS REFERENCES

 
Bardet–Biedl syndrome (BBS; OMIM 209900) is a multisystemic genetic disorder characterized by progressive retinal dystrophy, postaxial polydactyly, obesity, renal malformations and learning delay (1). Traditional linkage and in silico protein motif studies have demonstrated substantial genetic heterogeneity in BBS; at least seven independent loci have been mapped in the human genome (BBS1–BBS7), five of which have been cloned (BBS1, BBS2, BBS4, BBS6 and BBS7) (2–12).

The conceptual translation of these five BBS genes provides few functional clues, since none of these transcripts encodes a protein of known function (reviewed in 13–15). Nonetheless, mutational and genetic analyses have indicated that the historical view that BBS is a Mendelian recessive disorder may be too simplistic, since, at least in some instances, three mutations at two BBS loci (triallelic inheritance) are required to manifest the disease (16–18).

The molecular and genetic bases of oligogenic behavior, exemplified by BBS but also present in several other genetic disorders, are poorly understood (15,19). Initially, it was proposed that the substantial genetic heterogeneity in BBS might contribute to the overall phenotypic variation (16). However, this hypothesis was not supported by mutational and genetic data, since no significant phenotypic differences could be discerned between patients harboring mutations at different loci (20–23). The discovery of triallelic inheritance, in which some affected individuals harbor three mutations at two loci, raised an alternative possibility that the number of mutations might modulate the clinical outcome. However, phenotypic comparisons of triallelic families did not show substantive differences between individuals or families with either two or three mutations; in all cases documented to date, the third mutation was required to develop BBS, as supported by the presence of asymptomatic siblings with two mutations at one locus (16–18).

We present genetic and molecular evidence that suggest that some BBS mutations might exert an epistatic effect on the BBS phenotype by modifying the onset and/or severity of various aspects of the disorder. We report three families with two mutations in either BBS1 or BBS2, in which a third mutation in a second BBS gene is present in some, but not all patients and in each case correlates with a more severe phenotype. The nature, evolutionary conservation and, in one case, immunocytochemical evaluation of these alleles indicate that they have a deleterious effect on the protein and are unlikely to be neutral polymorphisms. Based on these data, we propose that the initial ‘on/off’ model for triallelism (17) might require modification and we suggest that oligogenic mutations may affect either or both the penetrance and the expressivity of the BBS phenotype.

	RESULTS

TOP ABSTRACT INTRODUCTION RESULTS DISCUSSION MATERIALS AND METHODS REFERENCES

 
Atypical segregation of triallelic mutations
As part of our efforts to establish the genotype for all known BBS genes in a large multiethnic cohort, we performed comprehensive sequencing analyses across the coding exons of all five known BBS genes. During these studies, we identified three families, AR768, PB009 and PB061 that segregate two mutations in either BBS1 (AR768, PB009) or BBS2 (PB061), in a pattern consistent with autosomal recessive inheritance. In family AR768, we identified two likely pathogenic coding sequence alterations. The first is a T to G transversion in exon 12, which by conceptual translation results in a missense alteration of a methionine to an arginine at position 390 (M390R; Fig. 1A). This variant has been reported previously as the most common pathogenic alteration in BBS1, since it accounts for 18–32% of all BBS1 mutations (12,16,24). In addition, each affected individual also carries a maternally inherited 1 bp deletion (1650C) in exon 16 of BBS1 that conceptually causes a frameshift at leucine 548 and yields a premature termination at codon 579 (L548fsX579; Fig. 1A). This alteration segregates with the disease in this family and is not present in 192 ethnically matched control chromosomes. In the second family, PB009, we found each of the three affected sibs to be homozygous for the common M390R mutation (Fig. 1B). Finally in the third family, PB061, we identified a homozygous nonsense mutation R275X in BBS2 (Fig. 1C) that has also been associated previously with the disorder (17).

View larger version (51K): [in this window] [in a new window]   Figure 1. Triallelic inheritance in three BBS families. (A) In family AR768, each affected individual has inherited two alterations in BBS1: a heterozygous M390R (paternal) mutation in exon 12 and a 1 bp (maternal) deletion in exon 16. The more severely affected individual, -04, carries a third (paternal) alteration in BBS6, a Thr to Pro substitution at position 325 (T325P). (B) In family PB009, all three affected individuals -03, -04 and -05 have homozygous M390R mutations in BBS1; -03 and -04 have inherited an additional L349W mutation in BBS2 and present a more severe retinal phenotype. (C) Similar pattern of allele distribution in family PB061; both -03 and -04 are homozygous for a nonsense R275X BBS2 mutation, but only the more severely affected sib -04 has an additional heterozygous splice junction mutation (IVS115+2TC) in BBS1. The BBS2 R275X mutation was confirmed by a BslI digest, whereby for the wild-type allele, a 339 bp amplicon was cleaved into two fragments of 141 and 198 bp, respectively, whereas the R275X mutation abolished the BslI site.

 
Recent data have suggested that paired BBS1 mutations may suffice to cause Bardet–Biedl syndrome (12,24), although subsequent analyses revealed that BBS1 also participates in complex inheritance but at a lower frequency than some of the other known BBS loci (16). Our mutational data for each family were initially consistent with autosomal-recessive inheritance. However, our previous data have provided several examples in which apparently recessive mutations are in fact part of a complex inheritance pattern in which three mutant alleles at two loci are necessary for pathogenesis (16–18,25). Consistent with this observation, we found potentially pathogenic alleles at a second BBS locus in each of the three families. However, in each instance, the third mutation did not segregate with the disorder since one affected sib in each family carried only the two BBS1 or BBS2 mutations.

In Caucasian family AR768, we detected a 973 AC transversion in exon 3 of BBS6 that by conceptual translation causes a non-conservative missense alteration from threonine to proline (T325P). The potential structural consequences of this alteration and the evolutionary conservation of the threonine (Fig. 3A) suggest that this mutation is probably pathogenic; consistent with this prediction, we did not find this variant in 192 ethnically matched control chromosomes. This allele, however, does not segregate with the disorder; it is transmitted from the unaffected father (who is thus a double heterozygote for BBS1 and BBS6) to only one of the affected offspring, -04; the other affected sibling, -03, carries the wild type BBS6 allele (Fig. 1A). As such, the T325P alteration cannot cause the phenotype.

View larger version (71K): [in this window] [in a new window]   Figure 3. Conservation of missense mutations. (A) The threonine 325 position is conserved in all recognizable BBS6 orthologs; hs=human, bt=cow, rn=rat, mm=mouse. BBS6 is not readily recognizable in lower organisms. (B) Conservation of the leucine at position 349 of BBS2; cf=dog, gg=chicken, dr=Drosophila, ag=mosquito, sp=sea urchin, xl=Xenopus, ce=flatworm.Light blue denotes amino acid identity; yellow depicts amino acid similarity (conserved substitutions).

 
We observed a similar segregation pattern in Caucasian family PB009, whereby in addition to the two BBS1 M390R alleles (one from each parent), affected sibs -03 and -04 have inherited a paternal heterozygous L349W alteration in BBS2. This allele represents a non-conservative substitution of an evolutionarily conserved residue (Fig. 3B) not present in 192 ethnically matched control chromosomes, and therefore likely to be pathogenic. However, the third affected sib, -05, did not inherit this variant and thus carries only apparently recessive BBS1 mutations (Fig. 1B).

Finally, in family PB061, individual -04 but not the other affected sib -03 has a maternally-inherited mutation in the splice donor site of exon 15 of BBS1 (IVS15+2T>C; Fig. 1C). Like the third mutation in the two previous families, this variant was not present in 192 ethnically matched control chromosomes and probably has profound consequences for the integrity of the BBS1 transcript, since it is predicted to cause a read-through into intron 15, culminating in a premature termination codon after 72 residues.

Families AR768, PB009 and PB061 exhibit intrafamilial phenotypic variability
Our mutational data raised the possibility that the observed third allele in BBS1, BBS2 and BBS6 might have a modifying effect on the phenotype. We hypothesized that in each family the patients with three mutations might exhibit a more severe or extensive phenotype compared with their sibs with two mutations. To investigate this, we examined all available clinical data for each patient (Tables 1–3). To avoid bias, this investigation was performed by RAL, PLB or CC without a priori knowledge of the genotype.

View this table: [in this window] [in a new window]   Table 1. Phenotypic differences between AR768-03 and -04. Each individual was ascertained for both major and minor aspects of the BBS phenotype. Although each sibling has been examined over the course of several years, whenever possible the phenotype was compared at the same age

 

View this table: [in this window] [in a new window]   Table 2. Summary of phenotypic differences between PB009-03, -04 and -05

 

View this table: [in this window] [in a new window]   Table 3. Phenotypic differences between PB061-03 and -04

 
Family AR768.
Family AR768 is a non-consanguineous family of northern European ancestry. However, although both sibs manifest features typical of BBS, the patient carrying three mutations, -04, presents a significantly more severe form of BBS compared with her older sister (Table 1). AR768-03 developed normally and, despite declining visual acuity, she has maintained good grades in elementary school, has a tested IQ of 110, has no speech or learning disabilities, and is not obese. By contrast her sister, -04, became obese in the first year of life and had notable hypotonia, fine motor incoordination, and has always been larger than her age-matched norms. She first put two words together after age 3 years, and at 5.5 years could converse with speech that was interpretable only by her parents. Her IQ is 92. Although her gross motor milestones were normal, mild hypotonia persisted. At age 5.5 her head circumference (54 cm) was >97th centile (and 50th centile for a 14-year-old), her height was 122.1 cm (>97th centile, 50th centile for a 7.5-year-old), and her weight 37.4 kg (>97th centile, and 50th centile for an 11-year-old).

Family PB009.
Family PB009 is a northern European, non-consanguineous family in which all affected sibs also manifest features of classic BBS, yet there are also striking phenotypic differences in weight, retinal phenotype and some behavioral aspects (Table 2; Fig. 2A and B). The first sibling (PB009-03), now 32 years old, became obese soon after weaning to solid foods and her body mass index (BMI) is now 33. She developed nyctalopia at age 17 and later presented to ophthalmologists at 20 years with ‘retinitis pigmentosa’, a visual acuity of 6/12 and a drusen of the left optic disk. By age 27 her acuity declined to 6/24 and she is now registered blind. The next sibling (PB009-04), now 35, also became obese in infancy and, like his sister, his BMI now stands at 33. He developed nyctalopia at age 13 and by 15 his visual acuity score was 6/18. At that time sparse retinal pigmentation with Fuch's spots were noted at fundoscopy. Significant field defects and pale waxy disks were noted at an examination at age 22. Registration as legally blind was completed by 24 years. By contrast, the eldest sister (PB009-05), now 37 years, is the least overweight of the three siblings (BMI 29), did not report any nyctalopia until she was 32 years old and only early signs of retinopathy were detected at 34 years. She continues to enjoy near perfect visual acuity by day.

View larger version (16K): [in this window] [in a new window]   Figure 2. The retinal phenotype of PB009. (A, B) Age of onset of retinopathy and relative visual acuity in family PB009; note the differences between ‘triallelic’ sibs -03 and -04 with -05, who has two BBS1 mutations but is wild-type for BBS2. (C) Distribution of the intrafamilial variability in the age of onset of retinopathy. The age of onset was established for each affected individual in 10 families with two or more affected sibs carrying at least one M390R mutation in BBS1 and no evidence for pathogenic variants at other loci. By contrast to a mean variance of 2.3 years, a maximum variance of 19 years was observed in family PB009.

 
Family PB061.
The third family, PB061, is a non-consanguineous family from the mountainous region of northern Italy. Like the previous two families, both sibs exhibit classic BBS. However, detailed clinical evaluation indicated significant differences between the two affected sibs in development and body weight management. The psychomotor development of PB061-03 was mildly delayed but within the normal range: sat at 9 months, walked at 15 months, first words spoken at 12 months, but first sentences not formed until 3 years. Currently, she is succeeding well at secondary school with minor support for visual impairment. Her BMI is 24.9 and weight gain has not been a major issue at any stage of her life. By contrast, PB061-02 (male) experienced major delay in developmental milestones: sat at 11 months, walked at 21 months, first words spoken at 2 years. Owing to considerable learning difficulties, continuous educational support was required throughout the school years. Furthermore, PB061-03 has experienced long-term weight gain since 3 years of age; his current BMI is successfully maintained at 25, but only with strict diet.

The retinal phenotype of the BBS1 M390R mutation
Our mutational and phenotypic data indicate that in each family the third mutation coincides with a marked increase in disease severity of specific phenotypic features. However, the documented clinical variability in BBS (1,13,14,21,26,27), suggests that some of these differences might be due to stochastic events or alleles at other, non-BBS loci. We queried whether the variability seen in our families was typical of BBS. We focused on the retinal phenotype for two reasons. First, retinopathy is the most consistent feature of BBS and, in contrast to obesity and learning/behavioral phenotypes, its quantification is more objective and the environmental influence is probably less pronounced. Second, the family with the distinct retinal phenotype presentation, PB009, is homozygous M390R for BBS1. This allele is the commonest BBS1 mutation (12,16,24), affording us the opportunity to study a significant number of patients with the same or similar genotypes. We determined the age of onset in 37 BBS patients from 23 families who carried at least one M390R mutation with no evidence for a third mutation at another locus. Consistent with previous epidemiological studies, we found a wide distribution of the onset of retinopathy, ranging from 1.5 to 23 years, although the mean age of onset in family PB009 was atypical for the syndrome at 23 years, due mainly to the significantly late age of onset of PB009-05 (34 years). We next investigated the variation in age of onset by selecting all families with ‘recessive’ BBS and one or two M390R mutations in BBS1. In the 10 families available, the mean difference in age of onset was 2.3 years with a standard deviation of 1.7, whereas in family PB009 the difference in age of onset was as much as 19 years and five standard deviations away from the highest value (Fig. 2C). Notably, the difference in age of onset between PB009-03 and -04 was 5 years and within the normal variation range. Even when we restrict our analyses to families with BBS1 genotypes identical to PB009 (i.e. M390R/M390R), we still observe a strong discordance in the mean age of onset. Despite the small sample sizes, we were able to test the hypothesis that the means of these two groups of patients are identical using a heteroscedastic (unequal variances) two-tailed t-test, and obtained a P-value of 0.052, providing suggestive statistical evidence. When we tested whether PB009 exhibits significantly increased variance in age of onset with an F-test (F=16.0; 2 and 5 d.f.), we also obtained relatively strong statistical evidence for such an increased variance (P<0.014). The difference in phenotypic variance became highly significant when all recessive BBS1 families with one M390R mutation were included (P<0.05).

The cellular phenotype of the BBS6 T325P variant
Despite the potential correlation between the clinical severity and the number of mutant alleles in each of the three families, as well as the non-conservative nature of the missense mutations and their absence from ethnically matched control chromosomes, the formal possibility remains that the L349W BBS2 and T325P BBS6 alleles are benign polymorphisms. For the BBS2 mutation, the lack of information on the protein currently precludes its functional evaluation. By contrast, establishment of the cellular distribution of the wild-type BBS6 protein (JCK and MRL, unpublished observations) enabled us to assay any potential localization defects in BBS6 caused by BBS6 mutations.

BBS6 is a widely expressed gene whose conceptual translation shows homology to type-II chaperonins (28). These cylindrical, ATP-dependent molecular chaperones have been implicated in the folding of a wide variety of cellular proteins (29) and chaperones have been involved in several human disorders (30). However, both the functional significance of this similarity and the cellular role of the BBS6 protein remain undetermined and thus frustrate efforts to assay the pathogenic potential of BBS6 sequence variants.

When considering the possible influence of the T325P allele on BBS6, we hypothesized that the nature of the alteration might affect the structure and/or the ability of the protein to fold correctly, which might in turn lead to either the degradation or the mislocalization of mutant BBS6. To assess this possibility, we transfected HeLa cells with plasmid constructs that express Myc-tagged wild-type (wt) BBS6 or Myc-tagged T325P mutant BBS6. Western blot analysis of the transfected cells showed that both proteins are produced at similar levels and exhibit the expected size of 60 kDa (Fig. 4A). These observations suggest that the mutant BBS6 protein is not particularly prone to degradation. The cellular localization patterns of the Myc-BBS6 (wt) and Myc-BBS6 (T325P) proteins were then determined by immunocytochemistry on HeLa cells with a primary antibody specific for the 13 amino acid Myc tag and a secondary antibody coupled with a green fluorescent dye.

View larger version (28K): [in this window] [in a new window]   Figure 4. Cellular mislocalization of the BBS6 (T325P) mutant protein. (A) Western blot analysis of HeLa cells that were either untransfected, or transfected with Myc-BBS6 wild-type (wt) or Myc-BBS6 (T325P) mutant constructs using an anti-Myc monoclonal antibody. (B) Immunocytochemistry of cells expressing Myc-BBS6 (wt) or myc-BBS6 (T325P) constructs using an anti-Myc primary monoclonal antibody and a secondary antibody coupled to Alexa Fluor 488 dye. Myc-BBS6 signals are green, and nuclei are stained with DAPI (blue). Untransfected cells displayed only prominent DAPI staining (no green staining), as can be seen in some of the cells present in the two panels.

 
Immunofluorescence signals from the Myc-BBS6 (wt) protein showed a distinctive cytosolic staining pattern that extended out from the nucleus (stained blue with DAPI) and became noticeably filamentous near the cell periphery (Fig. 4B, top panel). This localization pattern is indistinguishable from that of wild-type BBS6 devoid of a tag, and differs significantly from that of the closely related cytosolic chaperonin, CCT (manuscript in preparation). In contrast, all cells expressing Myc-BBS6 (T325P) protein showed a radically different localization pattern (Fig. 4B, bottom panel). BBS6 filaments were no longer discernible, and most of the protein appeared to form clumps or aggregates at various positions in the cytoplasm in all cells examined.

	DISCUSSION

TOP ABSTRACT INTRODUCTION RESULTS DISCUSSION MATERIALS AND METHODS REFERENCES

 
BBS is a pleiotropic disorder of substantial clinical and molecular complexity. Phenotypic evaluations have revealed wide inter- and intrafamilial variability (1,21–23,26,27,31). Attempts at correlating genotypes with the phenotype based on locus heterogeneity have been inconclusive, as have studies that took into consideration the presence of triallelic mutations, thereby suggesting a more complex pattern of phenotypic modulation (17,18).

We have reported here three families in which some, but not all, patients have inherited three mutations in two BBS genes. This pattern of inheritance for the third mutation is incompatible with causality and the current ‘on/off’ model of triallelism. We therefore considered three alternative and mutually exclusive possibilities: (i) that the third allele detected in each of the two families is a benign polymorphism; (ii) that the third allele is pathogenic but fortuitously present in these patients; or (iii) that the third allele is not causal in these families but exerts a modifying effect.

The first possibility cannot be excluded, but we propose that it is not likely based on three lines of evidence. First, each mutation is a non-conservative substitution that is predicted to have a significant impact on the protein: the L349W BBS2 change replaces a highly conserved aliphatic residue with an aromatic ring, potentially affecting solubility, the T325P BBS6 allele is predicted to insert a kink in the protein and thus alter its three-dimensional structure and the splice mutation in BBS1 introduces a premature stop codon and probably eliminates the BBS1 mRNA by nonsense-mediated decay. Second, none of these changes were present in 192 ethnically matched control chromosomes and both alterations involve highly conserved residues (Fig. 3). Finally, although the cellular phenotype of the L349W could not be ascertained due to ambiguous cellular distribution of wild-type BBS2, when we introduced BBS6 protein expressing the proline 325 variant into mammalian cells, we observed a striking cellular phenotype, whereby the protein loses its ability to localize correctly in the cell and instead forms apparent aggregates in the cytoplasm. This is likely to be deleterious to normal function.

Given that the BBS6 T325P , BBS2 L349W and BBS1 splice junction variants are probably detrimental to the protein, the question becomes whether such non-segregating pathogenic variants in a BBS gene affect the phenotype caused by two mutations at another BBS locus. That the reported patients are coincidental carriers of a BBS1, BBS2 or BBS6 mutation respectively is unlikely, given that paired mutations in each of BBS1, BBS2 and BBS6 have been shown to cause BBS (4,8,10,12,16,24) and to participate in triallelic inheritance (16–18,25). Furthermore, we have shown previously that the low incidence of BBS in Caucasians (1 : 100 000–1 : 160 000) coupled with the relatively small contribution of BBS2 and BBS6 mutations to the syndrome (18 and 6%, respectively) render the possibility of these individuals being fortuitous carriers negligible (17). Even for BBS1, the most common BBS locus in Caucasians, the chance of fortuitous carriers is small (1 : 380–1 : 430 based on a range of disease frequency between 1 : 100 000–1 : 125 000). More importantly, within the limits of our ability to measure the phenotype accurately, the observed intrafamilial variability that is potentially caused by a third mutation is significantly greater than the intrafamilial variability in BBS in general. Naturally, the precise contribution of the third allele at a second locus to the phenotype cannot be determined with certainty. It is likely that some of the observed variation in expressivity is the product of the rest of the genome, as well as the environment. However, it is unlikely that in all the families in our cohort, the correlation between the presence of a third mutation and a more severe phenotype is coincidental, although additional families will be required to understand and delineate the precise effect of such alleles.

Based on our observations, we propose that a model whereby such non-segregating BBS alleles exert a modifying effect on the phenotype is the most plausible explanation of our data. In an already sensitized genetic background, additional mutations at an independent BBS locus can contribute to the observed substantial intrafamilial variability seen in BBS. For instance, in family PB009, each of the three affected sibs manifests BBS. However, the two sibs with three mutations have a markedly more severe retinal phenotype with fundi exhibiting typical ‘retinitis pigmentosa’ pathology, whereas the eldest third sib has only minimal fundal changes at 37 years of age. Comparisons of the visual acuity of the three sibs are also consistent with this difference, since both PB009-03 and -04 are legally blind, whereas -05 has normal vision. More importantly, the variation in the onset of retinopathy in that family is significantly greater than the observed variation in 10 other families with apparently recessive BBS1 mutations, at least one of which is M390R.

Based on these observations, we suggest that an additional layer of complexity may exist in the genetics of BBS. The initial triallelic hypothesis in which three mutations are necessary for pathogenesis may oversimplify the true contribution of each locus to the phenotype. Within the limitations of the present three-family study, our findings are consistent with the notion that non-Mendelian mutations at one BBS locus may contribute to the modulation of the BBS phenotype caused by mutations at another locus. As such, ‘pure’ triallelism, in which individuals with two mutations at one locus are asymptomatic but individuals with three mutations are affected, would define one end of a spectrum in which a mutant allele at one BBS locus could have variable or even extreme effects on the expressivity of paired mutations at another locus (Fig. 5).

View larger version (22K): [in this window] [in a new window]   Figure 5. Conceptual (idealized) representation of the effect of mutant alleles on the phenotype. Within a patient population, two mutations at a single locus will result in a range of phenotypes, from asymptomatic/subclinical to severe BBS. The introduction of a third causal allele (blue dotted line) reduces or eliminates the number of asymptomatic individuals but does not affect the overall severity distribution of the disorder. By contrast, the introduction of a modifying mutation (red dashed line) increases the overall severity of the disorder and might also cause some individuals who would otherwise be asymptomatic to manifest a mild form of the disorder.

 
The above ‘gradient’ model for interactions of triallelic mutations is consistent with the observation that among the triallelic BBS families reported to date (17,18), there are more patients with three mutations at two loci than unaffected individuals with two mutations at a single locus. Although we have no reason to suspect that this distribution is due to any conscious bias of ascertainment or recruitment (except for those influenced by clinical presentation), the most plausible explanation is that not all triallelic mutations are necessary for pathogenesis; instead, some may exacerbate aspects of the phenotype.

Elucidation of the relative effect of each mutation at each locus on any aspect of the BBS phenotype will be challenging, since: (i) the mapped loci account for only about 40% of all BBS families, indicating that several more BBS loci remain uncloned; (ii) many factors regulating the phenotype are not yet identified; and (iii) the relationships between and interactions of the known genetic components of this disorder are not yet understood. Thus, both the identification of additional genes causing BBS and detailed phenotype–genotype studies on large cohorts will be critical to model the molecular mechanism(s) of oligogenicity, a type of trait transmission relevant for understanding both Mendelian and complex human traits.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION RESULTS DISCUSSION MATERIALS AND METHODS REFERENCES

 
Bardet–Biedl families
Individuals with BBS were ascertained by previously established criteria (1). In all cases, detailed interviews were conducted by an experienced investigator (R.A.L., C.C. or P.L.B.); all available medical records were requested and reviewed to ascertain diagnostic criteria. All affected members of each family were examined by a single examiner (R.A.L., C.C. or P.L.B.), who was masked to the genotypic data. These studies are approved by the Institutional Review Board for Human Subject Research at Baylor College of Medicine and the Ethics Review Committee of the Institute of Child Health, University College London.

Mutation screening
Blood was extracted and DNA prepared from lymphocytes according to published methods (16). All exons from each BBS gene were amplified and each amplicon included both the exon as well as intronic splice junctions as described (4). PCR products amplified from the DNA of patients and relatives were purified with the Exo-SAP cleanup kit (USB) and sequenced with dye-primer or dye-terminator chemistry on an ABI 377 (Applied Biosystems) or MegaBACE 1000 (Amersham Biosciences) automated sequencer. Resulting sequences were aligned and analyzed with the Sequencher sequence alignment program (Gene Codes). For PB061, in addition to sequencing, a restriction digest of BBS2 exon 8 was carried out. The R275X mutation abolishes a BslI site 141 bp into the 339 bp fragment.

Preparation of constructs
The entire coding region of human BBS6 cDNA was amplified by polymerase chain reaction (PCR) with a 5' primer containing a SalI site (GTCGACCATGTCTCGTTTGGAAGCTAAG) and a 3' primer harboring a NotI site (GCGGCCGCTTAGTTTTTATCTTCAATAAC). The product was digested with SalI and NotI, and subcloned into pCMV-Myc vector (BD Biosciences). The T325P BBS6 point mutant was generated with the Quick-change site directed mutagenesis kit (Stratagene). Both constructs were verified by double-strand sequencing.

Western blot and immunohistochemistry analysis
HeLa cells were cultured on 18 mm coverslips to 80% confluency and transiently transfected with Myc-tagged wild-type or T325P mutant BBS6 expression vectors with Polyfect Transfection Reagent (Qiagen). Sixteen hours after transfection, cells were fixed in -20°C methanol, permeablized in 0.1% Triton X-100, and blocked with Tris-buffered saline (TBS) containing 5.5% goat serum. The cells were incubated with anti-Myc mouse monoclonal antibody (Clontech), washed in TBS, and then incubated with a secondary antibody conjugated to Alexa Fluor 488 dye (Molecular Probes). Cells were stained with DAPI and mounted in Prolong Antifade reagent (Molecular Probes), for observation under an Olympus Vanox AHBS3 microscope. Captured images were processed with Adobe Photoshop software.

	ACKNOWLEDGEMENTS

 
We thank all BBS families for their willing and continued participation in our studies and Dr Alan Fryer for providing DNA and clinical details for family PB009. We thank James R. Lupski and Erica Eichers for their critical evaluation of this manuscript and Dr Andrew McCallion for helpful discussions. This study was supported in part by a National Institute of Child Health and Development, National Institutes of Health grant HD04260 and the March of Dimes (N.K.), the Foundation Fighting Blindness, MD, USA (R.A.L.), the Research to Prevent Blindness Inc., New York (R.A.L.), the National Cancer Institute of Canada and the Heart and Stroke Foundation of BC and Yukon (M.R.L.), the National Kidney Research Fund (B.E.H.) and the Wellcome Trust (P.L.B.). M.R.L. is the recipient of CIHR and MSFHR scholar awards.

	FOOTNOTES

 
^* To whom correspondence should be addressed at: Institute of Genetic Medicine, 2-127 Jefferson Street Building, Johns Hopkins University, 600 North Wolfe Street, Baltimore, MD 21287, USA. Tel: +1 4105026660; Fax: +1 4105027544; Email: katsanis{at}jhmi.edu

	REFERENCES

TOP ABSTRACT INTRODUCTION RESULTS DISCUSSION MATERIALS AND METHODS REFERENCES

 

1. Beales, P.L., Elcioglu, N., Woolf, A.S., Parker, D. and Flinter, F.A. (1999) New criteria for improved diagnosis of Bardet-Biedl syndrome: results of a population survey. J. Med. Genet., 36, 437–446.[Abstract/Free Full Text]

2. Badano, J.L., Ansley, S.J., Leitch, C.C., Lewis, R.A., Lupski, J.R. and Katsanis, N. (2003) Identification of a novel Bardet-Biedl syndrome protein, BBS7, that shares structural features with BBS1 and BBS2. Am. J. Hum. Genet., 72, 650–658.[CrossRef][Web of Science][Medline]

3. Carmi, R., Rokhlina, T., Kwitek-Black, A.E., Elbedour, K., Nishimura, D., Stone, E.M. and Sheffield, V.C. (1995) Use of a DNA pooling strategy to identify a human obesity syndrome locus on chromosome 15. Hum. Mol. Genet., 4, 9–13.[Abstract/Free Full Text]

4. Katsanis, N., Beales, P.L., Woods, M.O., Lewis, R.A., Green, J.S., Parfrey, P.S., Ansley, S.J., Davidson, W.S. and Lupski, J.R. (2000) Mutations in MKKS cause obesity, retinal dystrophy and renal malformations associated with Bardet–Biedl syndrome. Nat. Genet., 26, 67–70.[CrossRef][Web of Science][Medline]

5. Kwitek-Black, A.E., Carmi, R., Duyk, G.M., Buetow, K.H., Eldebour, K., Parvati, R., Yandava, C.N., Stone, E.M. and Sheffield, V.C. (1993) Linkage of Bardet–Biedl syndrome to chromosome 16q and evidence for non-allelic genetic heterogeneity. Nat. Genet., 5, 392–396.[CrossRef][Web of Science][Medline]

6. Leppert, M., Baird, L., Anderson, K.L., Otterud, B., Lupski, J.R. and Lewis, R.A. (1994) Bardet-Biedl syndrome is linked to DNA markers on chromosome 11q and is genetically heterogeneous. Nat. Genet., 7, 108–112.[CrossRef][Web of Science][Medline]

7. Mykytyn, K., Braun, T., Carmi, R., Haider, N.B., Searby, C.C., Shastri, M., Beck, G., Wright, A.F., Iannaccone, A., Elbedour, K. et al. (2001) Identification of the gene that, when mutated, causes the human obesity syndrome BBS4. Nat. Genet., 28, 188–191.[CrossRef][Web of Science][Medline]

8. Nishimura, D.Y., Searby, C.C., Carmi, R., Elbedour, K., Maldergem, L.V., Fulton, A.B., Lam, B.L., Powell, B.R., Swiderski, R.E., Bugge, K.E. et al. (2001) Positional cloning of a novel gene on chromosome 16q causing Bardet–Biedl syndrome (BBS2). Hum. Mol. Genet., 10, 865–874.[Abstract/Free Full Text]

9. Sheffield, V.C., Carmi, R., Kwitek-Black, A., Rokhlina, T., Nishimura, D., Duyk, G.M., Elbedour, K., Sunden, S.L. and Stone, E.M. (1994) Identification of a Bardet-Biedl syndrome locus on chromosome 3 and evaluation of an efficient approach to homozygosity mapping. Hum. Mol. Genet., 3, 1331–1335.[Abstract/Free Full Text]

10. Slavotinek, A.M., Stone, E.M., Mykytyn, K., Heckenlively, J.R., Green, J.S., Heon, E., Musarella, M.A., Parfrey, P.S., Sheffield, V.C. and Biesecker, L.G. (2000) Mutations in MKKS cause Bardet-Biedl syndrome. Nat. Genet., 26, 15–16.[CrossRef][Web of Science][Medline]

11. Young, T.-L., Penney, L., Woods, M.O., Parfrey, P.S., Green, J.S., Hefferton, D. and Davidson, W.S. (1999) A fifth locus for Bardet–Biedl syndrome maps to 2q31. Am. J. Hum. Genet., 64, 900–904.[CrossRef][Web of Science][Medline]

12. Mykytyn, K., Nishimura, D.Y., Searby, C.C., Shastri, M., Yen, H.J., Beck, J.S., Braun, T., Streb, L.M., Cornier, A.S., Cox, G.F. et al. (2002) Identification of the gene (BBS1) most commonly involved in Bardet–Biedl syndrome, a complex human obesity syndrome. Nat. Genet., 31, 435–438.[Web of Science][Medline]

13. Sheffield, V.C., Nishimura, D. and Stone, E.M. (2001) The molecular genetics of Bardet-Biedl syndrome. Curr. Opin. Genet. Dev., 11, 317–321.[CrossRef][Web of Science][Medline]

14. Katsanis, N., Lupski, J.R. and Beales, P.L. (2001) Exploring the molecular basis of Bardet–Biedl syndrome. Hum. Mol. Genet., 10, 2293–2299.[Abstract/Free Full Text]

15. Badano, J.L. and Katsanis, N. (2002) Beyond Mendel: an evolving view of human genetic disease transmission. Nat. Rev. Genet., 3, 779–789.[Web of Science][Medline]

16. Beales, P.L., Badano, J.L., Ross, A.J., Ansley, S.J., Hoskins, B.E., Kirsten, B., Mein, C.A., Froguel, P., Scambler, P.J., Lewis, R.A. et al. (2003) Genetic interaction of BBS1 mutations with alleles at other BBS loci can result in non-Mendelian Bardet-Biedl syndrome. Am. J. Hum. Genet., 72, 1187–1199.[CrossRef][Web of Science][Medline]

17. Katsanis, N., Ansley, S.J., Badano, J.L., Eichers, E.R., Lewis, R.A., Hoskins, B.E., Scambler, P.J., Davidson, W.S., Beales, P.L. and Lupski, J.R. (2001) Triallelic inheritance in Bardet–Biedl syndrome, a mendelian recessive disorder. Science, 293, 2256–2259.[Abstract/Free Full Text]

18. Katsanis, N., Eichers, E.R., Ansley, S.J., Lewis, R.A., Kayserili, H., Hoskins, B.E., Scambler, P.J., Beales, P.L. and Lupski, J.R. (2002) BBS4 is a minor contributor to Bardet-Biedl syndrome and may also participate in triallelic inheritance. Am. J. Hum. Genet., 71, 22–29.[CrossRef][Web of Science][Medline]

19. Ming, J.E. and Muenke, M. (2002) Multiple hits during early embryonic development: digenic diseases and holoprosencephaly. Am. J. Hum. Genet., 71, 1017–1032.[CrossRef][Web of Science][Medline]

20. Young, T.-L., Woods, M.O., Parfrey, P.S., Green, J.S., O'Leary, E., Hefferton, D. and Davidson, W.S. (1998) Canadian Bardet-Biedl syndrome family reduces the critical region of BBS3 (3p) and present with a variable phenotype. Am. J. Med. Genet., 78, 461–467.[CrossRef][Web of Science][Medline]

21. Beales, P.L., Warner, A.M., Hitman, G.A., Thakker, R. and Flinter, F.A. (1997) Bardet-Biedl syndrome: a molecular and phenotypic study of 18 families. J. Med. Genet., 34, 92–98.[Abstract/Free Full Text]

22. Bruford, E.A., Riise, R., Teague, P.W., Porter, K., Thomson, K.L., Moore, A.T., Jay, M., Warburg, M., Schinzel, A., Tommerup, N. et al. (1997) Linkage mapping in 29 Bardet–Biedl syndrome families confirms loci in chromosomal regions 11q13, 15q22.3–q23, and 16q21. Genomics, 41, 93–99.[CrossRef][Web of Science][Medline]

23. Carmi, R., Elbedour, K., Stone, E.M. and Sheffield, V.C. (1995) Phenotypic differences among patients with Bardet-Biedl syndrome linked to three different chromosome loci. Am. J. Med. Genet., 59, 199–203.[CrossRef][Web of Science][Medline]

24. Mykytyn, K., Nishimura, D.Y., Searby, C.C., Beck, G., Bugge, K., Haines, H.L., Cornier, A.S., Cox, G.F., Fulton, A.B., Carmi, R. et al. (2003) Evaluation of complex inheritance involving the most common Bardet–Biedl syndrome locus (BBS1). Am. J. Hum. Genet., 72, 429–437.[CrossRef][Web of Science][Medline]

25. Badano, J.L., Ansley, S.J., Leitch, C.C., Lewis, R.A., Lupski, J.R. and Katsanis, N. (2003) Identification of a novel Bardet-Biedl syndrome protein, BBS7, that shares structural features with BBS1 and BBS2. Am. J. Hum. Genet., 72, 650–658.[CrossRef][Web of Science][Medline]

26. Green, J.S., Parfrey, P.S., Harnett, J.D., Farid, N.R., Cramer, B.C., Johnson, G., Heath, O., McManamon, P.J., O'Leary, E. and Pryse-Phillips, W. (1989) The cardinal manifestations of Bardet-Biedl syndrome, a form of Lawrence–Moon–Bardet–Biedl syndrome. New Engl. J. Med., 321, 1002–1009.[Abstract]

27. Schachat, A.P. and Maumenee, I.H. (1982) Bardet–Biedl syndrome and related disorders. Arch. Ophthal., 100, 285–288.[Abstract/Free Full Text]

28. Stone, D.L., Slavotinek, A., Bouffard, G.G., Banerjee-Basu, S., Baxevanis, A.D., Barr, M. and Biesecker, L.G. (2000) Mutation in a gene encoding a putative chaperonin causes McKusick-Kaufman syndrome. Nat. Genet., 25, 79–82.[CrossRef][Web of Science][Medline]

29. Leroux, M.R. and Hartl, F.U. (2000) Protein folding: versatility of the cytosolic chaperonin TRiC/CCT. Curr. Biol., 10, R260–264.[CrossRef][Web of Science][Medline]

30. Slavotinek, A.M. and Biesecker, L.G. (2001) Unfolding the role of chaperones and chaperonins in human disease. Trends Genet., 17, 528–535.[CrossRef][Web of Science][Medline]

31. Riise, R., Andreasson, S., Borgastrom, M.K., Wright, A.F., Tommerup, N., Rosenberg, T. and Tornqvist, K. (1997) Intrafamilial variation of the phenotype in Bardet-Biedl syndrome. Br. J. Ophthal., 81, 378–385.[Abstract/Free Full Text]

CiteULike    Connotea    Del.icio.us    What's this?

This article has been cited by other articles:

				Q. Liu, A. Saveliev, and E. A. Pierce The Severity of Retinal Degeneration in Rp1h Gene-Targeted Mice Is Dependent on Genetic Background Invest. Ophthalmol. Vis. Sci., April 1, 2009; 50(4): 1566 - 1574. [Abstract] [Full Text] [PDF]

				T D. Hjortshoj, K Gronskov, K Brondum-Nielsen, and T Rosenberg A novel founder BBS1 mutation explains a unique high prevalence of Bardet-Biedl syndrome in the Faroe Islands Br J Ophthalmol, March 1, 2009; 93(3): 409 - 413. [Abstract] [Full Text] [PDF]

				F. Hildebrandt, M. Attanasio, and E. Otto Nephronophthisis: Disease Mechanisms of a Ciliopathy J. Am. Soc. Nephrol., January 1, 2009; 20(1): 23 - 35. [Abstract] [Full Text] [PDF]

				M. K. Tayeh, H.-J. Yen, J. S. Beck, C. C. Searby, T. A. Westfall, H. Griesbach, V. C. Sheffield, and D. C. Slusarski Genetic interaction between Bardet-Biedl syndrome genes and implications for limb patterning Hum. Mol. Genet., July 1, 2008; 17(13): 1956 - 1967. [Abstract] [Full Text] [PDF]

				M Adams, U M Smith, C V Logan, and C A Johnson Recent advances in the molecular pathology, cell biology and genetics of ciliopathies J. Med. Genet., May 1, 2008; 45(5): 257 - 267. [Abstract] [Full Text] [PDF]

				J. Hoefele, M. T.F. Wolf, J. F. O'Toole, E. A. Otto, U. Schultheiss, G. Deschenes, M. Attanasio, B. Utsch, C. Antignac, and F. Hildebrandt Evidence of Oligogenic Inheritance in Nephronophthisis J. Am. Soc. Nephrol., October 1, 2007; 18(10): 2789 - 2795. [Abstract] [Full Text] [PDF]

				A. A. Azari, T. S. Aleman, A. V. Cideciyan, S. B. Schwartz, E. A. M. Windsor, A. Sumaroka, A. Y. Cheung, J. D. Steinberg, A. J. Roman, E. M. Stone, et al. Retinal Disease Expression in Bardet-Biedl Syndrome-1 (BBS1) Is a Spectrum from Maculopathy to Retina-Wide Degeneration Invest. Ophthalmol. Vis. Sci., November 1, 2006; 47(11): 5004 - 5010. [Abstract] [Full Text] [PDF]

				A. S. Woolf Renal Hypoplasia and Dysplasia: Starting to Put the Puzzle Together J. Am. Soc. Nephrol., October 1, 2006; 17(10): 2647 - 2649. [Full Text] [PDF]

				P. Hanlon, W. A. Lorenz, Z. Shao, J. M. Harper, A. T. Galecki, R. A. Miller, and D. T. Burke Three-locus and four-locus QTL interactions influence mouse insulin-like growth factor-I Physiol Genomics, September 14, 2006; 26(1): 46 - 54. [Abstract] [Full Text] [PDF]

				N. Smaoui, M. Chaabouni, Y. V. Sergeev, H. Kallel, S. Li, N. Mahfoudh, F. Maazoul, H. Kammoun, N. Gandoura, A. Bouaziz, et al. Screening of the Eight BBS Genes in Tunisian Families: No Evidence of Triallelism. Invest. Ophthalmol. Vis. Sci., August 1, 2006; 47(8): 3487 - 3495. [Abstract] [Full Text] [PDF]

				M. N. A. Mandal, J. R. Heckenlively, T. Burch, L. Chen, V. Vasireddy, R. K. Koenekoop, P. A. Sieving, and R. Ayyagari Sequencing Arrays for Screening Multiple Genes Associated with Early-Onset Human Retinal Degenerations on a High-Throughput Platform Invest. Ophthalmol. Vis. Sci., September 1, 2005; 46(9): 3355 - 3362. [Abstract] [Full Text] [PDF]

				J R Porter and T G Barrett Acquired non-type 1 diabetes in childhood: subtypes, diagnosis, and management Arch. Dis. Child., December 1, 2004; 89(12): 1138 - 1144. [Abstract] [Full Text] [PDF]

				N. Katsanis The oligogenic properties of Bardet-Biedl syndrome Hum. Mol. Genet., April 1, 2004; 13(90001): R65 - 71. [Abstract] [Full Text] [PDF]

This Article Abstract FREE Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Search for citing articles in: ISI Web of Science (57) Request Permissions Google Scholar Articles by Badano, J. L. Articles by Katsanis, N. Search for Related Content PubMed PubMed Citation Articles by Badano, J. L. Articles by Katsanis, N. Social Bookmarking          What's this?

Online ISSN 1460-2083 - Print ISSN 0964-6906

Copyright © 2009 Oxford University Press

Oxford Journals Oxford University Press

• Site Map
• Privacy Policy
• Frequently Asked Questions

Other Oxford University Press sites: Oxford University Press Oxford Journals China Oxford Journals Japan American National Biography Booksellers' Information Service Children's Fiction and Poetry Children's Reference Corporate & Special Sales Dictionaries Dictionary of National Biography Digital Reference English Language Teaching Higher Education Textbooks Humanities International Education Unit Law Medicine Music Online Products Oxford English Dictionary Reference Rights and Permissions Science School Books Social Sciences Very Short Introductions World's Classics