Human Molecular Genetics

This Article Abstract FREE Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Search for citing articles in: ISI Web of Science (155) Request Permissions Google Scholar Articles by Lettice, L. A. Articles by de Graaff, E. Search for Related Content PubMed PubMed Citation Articles by Lettice, L. A. Articles by de Graaff, E. Social Bookmarking          What's this?

Human Molecular Genetics, 2003, Vol. 12, No. 14 1725-1735
DOI: 10.1093/hmg/ddg180
© 2003 Oxford University Press

A long-range Shh enhancer regulates expression in the developing limb and fin and is associated with preaxial polydactyly

Laura A. Lettice¹, Simon J.H. Heaney¹, Lorna A. Purdie¹, Li Li², Philippe de Beer³, Ben A. Oostra², Debbie Goode⁴, Greg Elgar⁴, Robert E. Hill^1,* and Esther de Graaff²

¹MRC-Human Genetics Unit, Western General Hospital, Crewe Rd, Edinburgh EH4 2XU, UK, ²Department of Clinical Genetics, Erasmus MC, PO Box 1738, 3000 DR Rotterdam, The Netherlands, ³Centre for Human Genetics, University Hospital Gasthuisberg, University of Leuven, Leuven, Belgium and ⁴Research Division, MRC-HGMP Resource Centre, Hinxton, Cambridge CB10 1SB, UK

Received March 27, 2003; Revised May 5, 2003; Accepted May 14, 2003

	ABSTRACT

TOP ABSTRACT INTRODUCTION RESULTS DISCUSSION MATERIALS AND METHODS REFERENCES

 
Unequivocal identification of the full composition of a gene is made difficult by the cryptic nature of regulatory elements. Regulatory elements are notoriously difficult to locate and may reside at considerable distances from the transcription units on which they operate and, moreover, may be incorporated into the structure of neighbouring genes. The importance of regulatory mutations as the basis of human abnormalities remains obscure. Here, we show that the chromosome 7q36 associated preaxial polydactyly, a frequently observed congenital limb malformation, results from point mutations in a Shh regulatory element. Shh, normally expressed in the ZPA posteriorly in the limb bud, is expressed in an additional ectopic site at the anterior margin in mouse models of PPD. Our investigations into the basis of the ectopic Shh expression identified the enhancer element that drives normal Shh expression in the ZPA. The regulator, designated ZRS, lies within intron 5 of the Lmbr1 gene 1 Mb from the target gene Shh. The ZRS drives the early spatio-temporal expression pattern in the limb of tetrapods. Despite the morphological differences between limbs and fins, an equivalent regulatory element is found in fish. The ZRS contains point mutations that segregate with polydactyly in four unrelated families with PPD and in the Hx mouse mutant. Thus point mutations residing in long-range regulatory elements are capable of causing congenital abnormalities, and possess the capacity to modify gene activity such that a novel gamut of abnormalities is detected.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION RESULTS DISCUSSION MATERIALS AND METHODS REFERENCES

 
The zone of polarising activity (ZPA) resides at the posterior margin of the developing tetrapod limb bud and is required for the anterio-posterior pattern of digits. The role of the ZPA and the significance of the asymmetric posterior location were demonstrated in chick explants. Manipulation of embryonic limb buds placing an additional ZPA source at the anterior margin results in supernumerary anterior-localized (preaxial) digits (1). Production of SHH (Sonic hedgehog) appears to be the ultimate role of the ZPA. Expression of Shh defines the limits of the ZPA in the posterior margin (2,3) and replacement of the ZPA with a source of SHH in explant experiments results in a normal A/P pattern. In addition SHH is sufficient to induce supernumerary digits when ectopically expressed in the anterior mesenchyme (2).

Corresponding to the chick studies, preaxial polydactyly in mouse mutants is attributable to ectopic anterior expression of Shh at early limb bud stages (4–6). One such mutant, Sasquatch (Ssq), arose during the production of transgenic mice and displays a preaxial polydactylous phenotype with no other associated anomalities (7). The transgenic insertion, responsible for the phenotype, carries the human placental alkaline phosphatase (HPAP) reporter gene driven by the Hoxb1 rhombomere 4 enhancer (7). In the Ssq mouse, in addition to HPAP expression in hindbrain rhombomere 4, the transgene acquired expression in the ZPA of the limb bud. HPAP activity is also detected in the anterior limb margin overlapping the ectopic Shh expression responsible for generating the polydactyly phenotype.

Ssq maps to mouse chromosome 5 and corresponds to the preaxial polydactyly (PPD) locus on human chromosome 7q36 (8). PPD in human is one of the most frequently observed congenital hand malformations and patients present with a range of limb phenotypes from triphalangeal thumb to one, two or sometimes three extra digits on hands and/or feet (9–13). Analysis of both a de novo chromosomal translocation breakpoint in a patient with PPD and the site of transgenic insertion in Ssq identified lesions within intron 5 of the Lmbr1 gene (8). Lmbr1 is physically linked to Shh and intron 5 lies at a distance of 1 Mb (a genetic distance of 1.8 cM) upstream from Shh. Genetic analysis confirmed that, despite this distance, a cis-acting regulator is responsible for the preaxial polydactyly phenotype in Ssq and therefore PPD (8).

In our attempt to determine the molecular basis for preaxial polydactyly, we identified the regulatory element that is responsible for the initiation and spatially specific expression of Shh in the ZPA. As predicted by the genetic analysis this regulatory element is located 1 Mb upstream of Shh, embedded in a gene that resides in a cluster of unrelated genes. Point mutations were found that reside in the ZRS in both human and mouse. These mutations modify ZRS activity resulting in ectopic expression of Shh and, consequently, supernumerary preaxial digits.

	RESULTS

TOP ABSTRACT INTRODUCTION RESULTS DISCUSSION MATERIALS AND METHODS REFERENCES

 
Regulatory elements reside near the Ssq insertion site
The transgenic insertion site for the Ssq mutant mouse was isolated previously and was postulated to be near or within a regulatory element that affects expression of Shh (7,8). To investigate the proximity of a potential regulator, transgenic mice were made using cosmid clones from a Ssq genomic library containing the insertion site. The cosmid Cos33S contains at least two complete copies of the transgene construct (carrying the HPAP reporter gene) and 8.5 kb of flanking genomic DNA. G₀ embryos analysed at E10.5 showed expression of HPAP at the posterior margin of the limb contained within the predicted ZPA (Fig. 1). This indicated the presence of at least partial regulatory activity contained within the 8.5 kb of flanking genomic DNA in Cos33S.

View larger version (94K): [in this window] [in a new window]   Figure 1. E10.5 transgenic embryo injected with Cos33S containing the Ssq insertion site and stained for HPAP expression. (A) Lateral view showing staining in rhombomere 4 (white arrow) and within the ZPA of the limb buds. (B) Dorsal side of the hindlimbs showing specific expression at posterior margin (black arrows).

 
Conservation of intronic regions within the Lmbr1 gene
Interspecies conservation of nucleotide sequence may pinpoint important regulatory elements. The sequence of intron 5 of the Lmbr1 gene in several vertebrate species was compared to search for conserved domains which would account for the limb expression displayed by Cos33S. The partial sequence available (accession no. AC0587880) for intron 5 in the mouse was used to further establish high quality sequence for this region and was compared to the available human sequence (accession no. AC007097). Comparison of the 31 kb mouse and 33 kb human intron 5 sequences using VISTA (14,15) showed a number of regions of significant similarity, the largest being a region of 1.3 kb (Fig. 2A). In addition the entire 18.5 kb chick intron 5 was sequenced. Comparison of this sequence to the mouse significantly reduced the overall similarity displayed by the VISTA plot and demonstrated a single conserved region of 800 bp corresponding to the 1.3 kb region predicted in human and mouse (Fig. 2A).

View larger version (104K): [in this window] [in a new window]   Figure 2. Interspecific sequence comparison of four vertebrate species for intron 5 of the Lmbr1 gene. (A) Schematic depiction of the genomic organization in mouse from Hlxb9 to Shh, reflecting the transcribed strand (taken from Ensembl and based on the mouse genome assemble V3). Exons 5 and 6 of Lmbr1 are labelled and below a sequence comparison of the intervening intronic DNA (intron 5) predicted by VISTA is depicted. Species used for the comparison (mouse, human, chick and Fugu rubripes) are shown along the left side of the VISTA plot. Annotation along the top shows position of exons and predicted genomic repeats. Mouse was used as the base sequence for all the comparisons and predicted regions of significant identity are shown (50% identity in windows of 100 bp appear on the plot and those above 75% are shaded pink). The conserved region aligned in (B) is bracketed. (B) Alignment of the highly conserved region from all four species. Nucleotides conserved within all four species are shaded black, while those conserved within only three species are shaded grey. The end of the cosmid (Cos33S) is marked with a green arrow. The ends of the 445 bp constructs (constructs ii and iv) are marked with red arrows, and the end of construct iii is indicated with a blue arrow. The locations of the single base pair changes identified in the human PPD families and in the Hx mouse are marked with magenta stars.

 
Mapping the genomic flanking DNA contained in Cos33S (discussed above) established the region of the intron represented by the cosmid clone. Interestingly, the genomic DNA extended upstream and included about 800 bp of the 1.3 kb conserved domain (green arrow at nucleotide 400 in Fig. 2B). The data is consistent with the regulatory activity detected by transgenesis residing within the conserved domain of mouse, human and chick.

Identification of a ZPA-specific enhancer
A 1.7 kb HindIII fragment containing the mouse conserved region was incorporated into transgenic constructs containing the heterologous ß-globin promoter and lacZ reporter gene (construct i in Fig. 3A) (16). Transgenic embryos showed similar ß-gal staining patterns at the posterior margin of both the fore and hindlimbs (Fig. 3B) reminiscent of limb Shh expression in the ZPA. Much of the regulatory information for driving expression in the ZPA appears to be contained within this fragment, thus we refer to this conserved domain as the ZPA regulatory sequence (ZRS).

View larger version (46K): [in this window] [in a new window]   Figure 3. Summary of the constructs used to produce transgenic mice. (A) Schematic representation of the constructs used. The entire 1.7 kb ZRS is depicted by a yellow box, the 445 bp internal fragment by a red box, the end of the cosmid by a green arrow and the end of construct iii by the blue arrow. The region incorporated into each construct is depicted below. The table on the right depicts the number of G0 (transients) embryos and lines as a ratio of expressing/transgenic embryos. (B–E) show ß-gal expression in E10.5 G0 embryos carrying (B) construct i, the 1.7 kb ZRS, (C) construct ii, the 445 bp mouse construct; (D) construct iii, the 305 bp fragment, and (E) construct iv, the 502 bp Fugu construct. Expression of the reporter gene in the posterior margin of the forelimbs indicated with arrowheads and hindlimbs with arrows.

 
In addition to the Lmbr1 sequences in species of land-based tetrapods, we attempted to detect similar ZRS sequences in fish. Cosmid and PAC clones from Fugu rubripes, the pufferfish, were identified. The compact genome of Fugu (17) facilitated the demonstration of the physical linkage of Lmbr1 and Shh (manuscript in preparation). Genomic sequence was established and the region corresponding to intron 5 was compared to human, mouse and chick (the VISTA comparison with mouse sequence is shown in Fig. 2A). This highlighted the presence of a region of 400 bp conserved between all four species. A 445 bp fragment of the mouse ZRS incorporating the Fugu region of similarity (nucleotides 28–568, the region between the red arrows in Fig. 2B) was used in a transgenic construct (construct ii, Fig. 3A). This construct drives lacZ expression within the putative domain of the ZPA of both the developing fore and hindlimb buds (Fig. 3C). Thus the fish sequence comparison has aided in identifying a limited region of activity.

An additional construct was made based on the endpoint (green arrow in Fig. 5B) of the genomic DNA in cosmid Cos33S. The 5' end fragment from the 1.7 kb ZRS domain (5' of the blue arrow in Fig. 2B) incorporating 300 of the 445 bp in construct ii was used (construct iii; Fig. 3A). Construct iii drove expression in the posterior margin of fore and hind limbs (forelimbs shown in Fig. 3D), thus we suggest that most of the spatial activity is contained in a small fragment of 305 bp (nucleotides 20–417 in Fig. 2B).

View larger version (71K): [in this window] [in a new window]   Figure 5. (A, B) Pedigree structure of part of a Belgian family 1 (A) and family 2 (B) with autosomal dominant preaxial polydactyly. Solid symbols represent affected individuals; open symbols represent unaffected individuals. Co-segregation of the A/T mutation in Belgian 1 and the T/C mutation in Belgian 2 with the PPD phenotype is indicated. (C) Normal and X-ray images of the right hand of affected individual IV-2. Note the extra biphalangeal thumb (arrowhead), with metacarpal, connected to a tri-phalangeal thumb (arrow). (D) Normal image of both hands of the affected individual IV-2 of Belgian family 2. Note the triphalangeal thumb on the left hand (arrow). (E) Sequence electropherogram of mutations found in the ZRS. Positions of the heterozygous mutations in the human sequence of the ZRS (Fig. 2B) are indicated above. (F) Schematic representation of Lmbr1 intron5 in wild-type mice and in Ssq. Exons 5 and 6 are depicted by dark and light blue boxes, respectively. The ZRS is shown as a yellow box and the breakpoints of the duplication marked by arrows. In Ssq, the inserted multiple transgene elements are shown as the green box. (G) Sequence electropherogram of a wild-type and an Hx/Hx mouse. The G to A mutation is at position 545 of the mouse sequence of ZRS as indicated in Figure 2B.

 
Identification of the fin bud element
To determine the regulatory capacity of the fish conserved region, a construct containing the 502 bp Fugu DNA (construct iv, Fig. 3A) most similar to the mammalian ZRS was made. The resulting E10.5 transgenic embryos express a spatial pattern indistinguishable from the ZPA-like expression pattern (Fig. 3E) of the mouse (construct ii). The region of similarity predicts a functional regulatory unit in the fish. Since limb and fins are homologous structures and there is broad conservation of synteny in vertebrates (manuscript in preparation), we argue that this regulatory element is responsible for the expression of Shh observed in the posterior of the developing fin bud (18). In addition the basis for conservation of synteny may be a consequence of these distal regulatory elements.

Spatio-temporal activity of the ZRS
In order to examine the time course of activity, permanent transgenic lines were made with both the 1.7 kb, ZRS construct i, and the mouse 445 bp construct ii. Of 11 independent lines carrying construct i; five express ß-gal with a consistent pattern in the limb buds. At E10.5 these lines show an accurate initiation of expression of ß-gal firstly, within a small patch in the fore limb bud and, subsequently, in the hind limb (Fig. 4A). The expression expands into the posterior margin and very closely mimics the endogenous Shh pattern demonstrated by in situ hybridization (Fig. 4B). This correlation between ß-gal activity and the Shh expression pattern continues to E11.5 (Fig. 4C). However, after this stage endogenous Shh expression is reduced and is undetectable in the limb buds at E12.5. In contrast the five ZRS lines continue to express the ß-gal activity to at least E13.5 (Fig. 4E). In situ hybridization to examine lacZ mRNA showed that the transgene was being actively expressed at this stage (Fig. 4F), and that the ß-gal activity does not simply reflect perdurance of the protein. However, the distribution of the ß-gal activity shows some differences with that of the lacZ mRNA since the ß-gal staining extends down the posterior shank of the limb (compare Fig. 4E and F at E13.5, and H and I at E12.5). In addition, at E12.5 while the lacZ RNA is expressed more highly at the limb margin and declines towards the centre of the limb bud (Fig. 4I), the protein has become localized to the developing digits, giving rise to a V-shaped staining pattern (Fig. 4H).

View larger version (109K): [in this window] [in a new window]   Figure 4. Analysis of spatio-temporal patterns in embryos from permanent transgenic lines. Embryos from lines carrying construct i (A–F, H and I) and construct ii (J–M). (A) Increasingly older embryos (from left to right, harvested at E10.5 and staged relative to each other by size of hindlimb bud) stained for ß-gal expression show accurate activation of the transgene. The early hindlimb bud is indicated with a square bracket, hindlimb expression with an arrow and forelimb expression with an arrowhead. (B) Expression of Shh (by in situ hybridization at E10.5) for comparison. Later embryos at E11.5 (C) show ß-gal expression comparable to Shh, whereas, embryos at E12.5 (D) and E13.5 (E) show persistence of ß-gal staining. (F) lacZ mRNA in situ hybridisation on a transgenic littermate of (E) demonstrates that the transgene continues to be expressed. Forelimbs from E12.5 embryos are shown in (G and H). (G) A Ssq/+ mutant embryo stained for the HPAP reporter gene displays the posterior digital expression pattern. Expression from the transgene analysing for ß-gal staining (H) and lacZ mRNA (I) shows that the transgene mRNA and HPAP staining are similar but that the protein perdures extending proximally down the shank. (J–M) ß-gal staining in embryos carrying the 445 bp mouse construct ii at E10.5 (J), E11.5 (K), E12.5 (L) and E13.5 (M). Persistance of expression down the shank of the limb bud is indicated with an open arrowhead (D, E, L, M).

 
In contrast, the 445 bp element appears to be a weaker regulator in transgenics. Whereas in the transient transgenic embryos expression from the 445 bp construct ii is detectable at E10.5, the ß-gal was difficult to detect until E11.5 in the two stable lines. Once again, as with the 1.7 kb construct, expression is then maintained through E12.5 (Fig. 4L) until at least E13.5 (Fig. 4M). This anomalous late-stage digit expression reflects the pattern observed for the HPAP activity reported for the Ssq mutant (Fig. 4G) (7), demonstrating that ZRS contains most, if not all, the activity detected by the Ssq HPAP reporter inserted in the Lmbr1 gene.

Point mutations within the conserved domain associated with preaxial polydactyly
Having identified the functional ZRS domain, a total of seven families with preaxial polydactyly, mapping to chromosome 7q36, were analysed. A large Dutch family (9,12) was tested and the 96 affected individuals were all found to be heterozygous for a C/G transversion at position 105 (Fig. 5E) of the human sequence as shown in Figure 2B. This in contrast to the 117 unaffected individuals (sibs or partners), who are homozygous C/C. As the large Dutch family is from a genetically isolated village, we tested 249 unaffected individuals from this village using ASO hybridization. In addition, we tested 128 controls from around the village, as well as 183 controls from The Netherlands (giving a total of 1354 tested control chromosomes) and all were found to lack this mutation.

In addition, we identified a DNA alteration in three smaller families. Two of these families were identified in Belgium and are designated as the Belgian 1 and Belgian 2 families (Fig. 5). In the Belgian 1 family, an A/T transversion (Fig. 5E) at position 305 of the human ZRS sequence segregated with the PPD phenotype (seven affected A/T, six unaffected A/A; pedigree shown in Fig. 5A) and was found to be absent in 183 Dutch and 95 Belgian controls. A T/C transition at position 323 of the human ZRS sequence (three affected T/C, four unaffected T/T, Fig. 5E), segregating with the PPD phenotype in the Belgian 2 family (pedigree shown in Fig. 5B), was absent in the same 183 Dutch and 95 Belgian controls. Finally, a G/A transition at position 404 (Fig. 5E) was detected in all six affected individuals in a Cuban family (12) and was absent in six unaffected relatives as well as 45 Cuban and 183 Dutch unaffected individuals. The sequence analysis also resulted in the identification of four other sequence alterations (C/G at position 3, C/T at position 236, T/C at position 295 and G/C at position 507 of the human ZRS sequence), which were detected in unaffected individuals (with frequencies of 10–30% in both Dutch controls and families), suggesting these are polymorphisms. We therefore suggest that the base pair differences found in the Dutch, Belgian and Cuban families are the pathogenic mutations leading to the PPD phenotype in these families. In the remaining three families we only found the C/G polymorphism at position 3 also present in unaffected individuals.

Previously, we showed that a region of 24 kb of intron 5 of Lmbr1 was duplicated in the Ssq genome (8). Here we show that the transgenic insertion is situated between the duplication endpoints with copies of the ZRS on each side (Fig. 5F); however, it is unclear how this contributes to ectopic expression. A second allelic mutation was examined and proved more informative. The hemimelic extra toes (Hx) mutation has a similar phenotype to Ssq (19) and a critical region that includes Lmbr1 and the downstream Rnf32 gene. No mutations were found in the coding region of these genes (20). The ZRS and three other highly conserved domains (data not shown) located within the critical genetic region were sequenced. A G to A transition was found at position 545 of the mouse ZRS sequence of the Hx mutant (Fig. 5G); all other regions sequenced were unaffected. The Hx mutation arose on the congenic line B10.D2/nSn (21) derived from the inbred strain C57BL/10Sn and the donor partner DBA/2J. Thus the ZRS regions from the B10.D2/nSn, C57BL/10Sn and DBA2J strains plus seven other control inbred strains (C57BL/6, C3H, CBA, AKR, 129SV, FVB and A/J) were sequenced and found to lack this G/A alteration. In addition, no other DNA alterations were found in these strains.

The base pair changes detected in mouse and human occur at highly conserved nucleotides. All are conserved in the ZRS of mouse, human and chick and all except the mutation found in the Belgian 1 family also include conservation with fish.

	DISCUSSION

TOP ABSTRACT INTRODUCTION RESULTS DISCUSSION MATERIALS AND METHODS REFERENCES

 
ZRS and polydactyly
Examples of suspected regulatory elements that operate over extreme distances are increasingly being recognized. A series of chromosomal aberrations that are purportedly regulatory mutations for the developmental genes Sox9 (22) and MAF (23) lie at distances of about 1 Mb from the affected genes. In addition a number of studies indicate an association between chromosomal aberrations and congenital abnormalities in which the aberrations reside at moderate distances (reviewed in 24). In many of these cases the abnormalities are suggested to be due to chromosomal position effects. Here, we show that single basepair mutations residing within the ZRS regulatory element are associated with the congenital abnormality PPD. These mutations are located at a dramatic distance from the target gene, Shh. The identification of such subtle regulatory mutations is, of course, problematic. In the case of preaxial polydactyly the critical genetic region defined for both mouse and human lies at a significant distance from the target gene and, in fact, the Shh gene and both the Ssq and Hx mouse mutations are at an approximate genetic distance of 1.8 cM (8,20). The task of identifying distantly located regulatory mutations required an initial search for functional regulatory elements within the critical region by a process of sequence comparisons in diverse species, and subsequent experimental verification of enhancer activity. Preaxial polydactyly is unlikely to be unique among congenital dysmorphologies and we suggest that a number of long-range regulatory mutations will be uncovered using similar approaches.

In mammals the ZRS is contained within a highly conserved 1.3 kb region. The minimal region required for driving ZPA expression in the transgenic constructs is found in a sequence of about 300 bp. The mutations associated with polydactyly are scattered through a region of 450 bases of the ZRS and map both inside and outside the minimal region required for expression activity. The lack of clustering of the mutations in the ZRS suggests there is no single subdomain responsible for mis-expression. In addition the mutations effect mis-expression of the Shh gene without disrupting the normal production at the posterior limb bud margin. Maintenance of normal ZRS regulatory activity is supported by studies in both mouse mutants, Ssq and Hx, in which posterior Shh expression in the homozygous mutants and patterning of the posterior digits is similar to wild-type. Thus we suggest that normal posterior activity is unaffected by ZRS mutations which, however, affect spatial specificity causing anterior, ectopic expression.

In our analysis multiple regulatory functions were assigned to the ZRS. The ZRS is responsible, firstly, for initiation of Shh expression at the appropriate time in limb bud development and, secondly, for driving the appropriate posteriorly restricted spatial expression pattern. However ZRS activity seems acutely sensitive to structural perturbations since single base pair changes appear to result in loss of expression asymmetry. The mechanism in which the base pair changes participate remains to be resolved. One approach to investigate this mechanism may entail the production of mutations or deletions in the ZRS/reporter gene constructs to generate ectopic reporter gene expression. However, preliminary evidence suggests expression levels of the reporter gene are not sufficiently high enough to be detected (data not shown). Based on the previous observation (8) that ZRS mutations (as in the Ssq mutation) when linked to an inactive Shh null allele suppress the ectopic extra digit, we suggest that the process of ectopic tissue expansion is requisite for the detection of anterior expression. Therefore straightforward ZRS/reporter constructs carrying mutations may not provide the experimental route to understand ectopic activity and further analysis incorporating Shh expression will be required.

A number of genetic resources are available to investigate the action of the ZRS in both normal posterior expression and anterior ectopic expression of Shh. The frequency of PPD in the human population opens the possibility of detecting a number of other mutations in the ZRS (currently under investigation), which may eventually aid in pinpointing functional domains within the ZRS. In addition in mouse other unlinked mutations, lx, Dh, Rim4, Xpl and lst, are known to produce preaxial polydactyly with associated ectopic Shh expression (4–6). These mutations are postulated to act by de-repressing Shh expression in the anterior margin and thus may function through the ZRS. The lst mutation is a particularly attractive candidate. The gene responsible is the Alx4 gene (25,26), which is expressed in the anterior margin of the early limb bud. Examination of these polydactylous mouse mutations may be instrumental in pinpointing interacting genes which act at the ZRS.

Regulation at a distance
Chromatin or chromosomal structural elements are expected to play a part in regulating gene expression at such a distance. Here, we find that at least one major component of a long-range regulator is a distance-independent enhancer. Our data, however, question the necessity for the long-range separation of regulator and the target gene. Clearly, the genomic configuration of the ZRS situated inside the Lmbr1 gene at a considerable distance from Shh is conserved over a significant evolutionary period. Does this long-distance separation play a role in the regulation? The transgenic approach poses an answer by effectively eliminating the long distance upon which the ZRS must act. The transgenes were constructed such that the enhancer abuts the ß-globin heterologous promoter driving the reporter gene. The ZRS containing transgene initiates expression at a stage similar to that of endogenous Shh, and the subsequent spatial pattern is indistinguishable. Therefore, neither genomic distance nor chromosomal context appears to be important in defining the early parameters of Shh expression. In contrast, the transgenic lines do not ‘turn off’ expression at the normal endpoint (3). Resolution of the temporal pattern requires further input, leaving open the possibility that distance of the ZRS may play a crucial role in the appropriate resolution of the expression pattern.

Long-distance gene regulation must overcome a number of inherent problems. For example, local gene expression appears unperturbed by the presence of the ZRS. The ZRS lies within intron 5 of the ubiquitously expressed Lmbr1. In addition, Lmbr1 is situated among a cluster of genes including Rnf32 a testes specific gene (27) positioned between the ZRS and Shh and C7orf3, a widely expressed gene (13) and Hlxb9, a gene involved in neural tube closure (28) and pancreatic development (29) positioned directly upstream. The ZRS appears, therefore, to be a component of a complex of regulators that together drive the spatial and temporal pattern in the ZPA, while insulating the surrounding genes, and seeking out the Shh promoter specifically.

Evolution of Shh expression
The tetrapod limb was an essential morphological adaptation in vertebrate evolution that facilitated the transition from an aquatic to a land-based lifestyle. Expression of teleost HoxA and HoxD genes, orthologues of genes expressed in tetrapod limbs, suggest that the fin is homologous to proximal limb structures (30). Additional anatomical data supports the notion that in the fin-to-limb transformation advent of the autopodium (structure which gives rise to the carpus/tarsus and digits) was the distinguishing innovation (reviewed in 31). Generally in tetrapod limbs, Shh expression has acquired a function in the autopod to pattern the chondrogenic elements. In teleosts, fin structure differs quite dramatically from limb and Shh, although expressed in the posterior margin, differs from the mouse pattern in that it does not extend to the distal edge (18). Given the substantial differences, is the fin Shh expression domain equivalent to the ZPA? Initially, the ZPA was defined functionally in chick explant studies (1). Since the characteristic ZPA properties are mediated by SHH (2,3), the ZPA has become synonymous with the limb expression pattern of Shh. At the molecular level much of the information for the specific Shh expression is contained in the ZRS. The data presented here strongly suggest that fin and limb Shh expression are under the same regulatory influences and thus the fish expression domain of Shh and the ZPA are equivalent.

Elaboration of Shh activity in producing the pattern particular to each type of appendage is different. Clearly, the ZRS of the fish, although driving a posterior but proximal pattern in the fin, has the capacity to regulate expression in a pattern remarkably similar to that of the mouse limb. Hence, within the vertebrate evolutionary scheme the ZRS regulatory element is ancient, having arisen prior to the fin-to-limb transition. The evolutionary period in which fin expression arose may have been subsequent to chondrichthyes since dogfish do not express Shh in the fin (32). The ZRS and consequently the ZPA arose, but not as part of a mechanism to pattern digits and therefore predate the advent of the tetrapod specific autopod. With the basic regulatory mechanism for Shh expression in place, it appears that the role of Shh changed within the context of the evolving limb bud to define digit number and pattern.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION RESULTS DISCUSSION MATERIALS AND METHODS REFERENCES

 
Sequencing and analysis
High quality mouse intron 5 sequence was assembled from available unordered HTGS sequence of clone RP23-284A9 (accession no. AC0587880), in combination with and cosmid clone sequence containing the Ssq insertion site. This led to an ordered array of intron 5 sequences, and gaps were subsequently filled by PCR and sequencing. Finished human sequence was available in the database (accession no. AC007097). Database searching identified chicken Lmbr1 ESTs (ChEST294A11, 382F7 and 771N8), which were used to screen the chicken BAC library filters (HGMP). Two clones were identified (10P15 and 75K5); subsequent characterization showed that 75K5 contained the entire Lmbr1 gene and this was used as a template for long-range PCR (Roche) using primers from exons 5 and 6 (CTTGGAGTCGGAAGGATTTGC and TCTCCAGAATGCGTGCTCTG). The resultant PCR product was shotgun sequenced using standard methods. Fugu Lmbr1 intron 5 sequence was obtained from a Shh containing PAC that was completely sequenced.

Initial sequence comparison was conducted using VISTA (www-gsd.lbl.gov/vista) (14,15) and the sequence displayed using PileUp (The GCG Wisconsin Package at the HGMP, Hinxton, UK) and ClustalX (HGMP) (33). The alignment in Figure 2 was prepared using GeneDoc (www.psc.edu/biomed/genedoc).

Transgenic analysis
The cosmid Cos33S containing the Ssq transgene and flanking DNA was digested with NotI to release the insert. Both insert and vector were injected. All other transgenic constructs made use of a ß-globin minimal promoter and the bacterial lacZ reporter gene (16) (vector p1230, a kind gift from Robb Krumlauf). Construct i (1.7 kb, ZRS construct) was made by subcloning the 1.7 kb HindIII genomic fragment. Sub-fragments of this were generated by PCR and sequenced to ensure the absence of PCR errors. The Fugu construct iv, used Fugu cosmid 16E21 (HGMP) as a template. All PCR primers used had HindIII sites for ease of cloning and vectors were made with the PCR products in both orientations relative to lacZ. In all cases, the vector fragment was removed by NotI/SalI digestion. Transgenic mice were made by pronuclear injection using standard protocols. G₀ embryos were harvested at E10.5 (assuming the day of transfer to be E0.5) or allowed to develop to term. Transgenic males were subsequently used as studs with CD1 females. All embryos harvested had their yolk sacs retained to allow for PCR genotyping.

HPAP, ß-gal staining and in situ hybridizations were carried out using standard techniques (7,34,35 respectively). The probes used for in situ hybridization were Shh (a kind gift from Andy McMahon) or lacZ, transcribed from vector p1230.

Mutation detection
The Dutch and Cuban families were previously mapped to chromosome 7q36 (9,12). Affected individuals from the Belgian 1 family (Fig. 5A) display preaxial polydactyly II, with an extra thumb attached to the triphalangeal thumb (Fig. 5B). The phenotype of the Belgian 2 family (Fig. 5C) included triphalangeal thumbs with or without an additional biphalangeal thumb (Fig. 5B). The phenotype in both families was linked to chromosome 7q36.

Mouse strains tested for mutation analysis were: B10.D2/nSn-Hx/Hx (and Hx/+), B10.D2/nSn, C57BL/10SnJ, DBA2J, C57BL/6, C3H, CBA, AKR, 129SV, FVB and A/J (Jackson labs).

Genomic DNA was isolated from peripheral blood from affected and unaffected individuals according to standard procedures (36). For mutation analysis of the ZRS in both human and mouse, PCR reactions were performed in 50 µl containing 1xGibcoBRL PCR buffer, 1.5 mM MgCl₂, 200 µm dNTPs, 200 µm primers, 2.5 units of Taq DNA polymerase (GibcoBRL) and 50 ng of genomic DNA. Cycling conditions were: 3 min at 94°C, 35 cycles of 15 s at 94°C, 15 s at 56°C and 35 s at 72°C followed by 5 min at 72°C. PCR products were purified using Amersham GFX purification columns, according to the products instructions.

Direct sequencing of both strands was performed using Big Dye Terminator version 3.0 chemistry (Applied Biosystems). Fragments were loaded on an automated sequencer and analysed with DNA Sequencing Analysis (version 3.7) and SeqScape (version 1.1) packages (Applied Biosystems). To ensure high quality sequencing we divided the ZRS and 200 nt up- and downstream in three overlapping regions: Hi5f/R1, Hi5f/R2 and Hi5f/R3 for human and mi5f/R1, mi5f/R2, mi5f/R3 for mouse. The primers used for amplification were also used for sequencing and are given in Table 1. For Allele Specific Oligo (ASO) hybridization, PCR products similar to those sequenced were blotted onto Hybond-N+ membranes (Amersham Biosiences). Blots were hybridized for 1 h at 37°C in 5xSSPE, 1% SDS and 50 µg/ml single-strand salmon sperm DNA with either the normal or mutated oligo, labelled with P³²-ATP. Filters were washed at 37°C until a final stringency of 0.3xSSC/1% SDS. Oligonucleotides used for hybridization for the mutations can be found in Table 2.

View this table: [in this window] [in a new window]   Table 1. Primers used for sequence analysis

 

View this table: [in this window] [in a new window]   Table 2. Primers used for allele specific oligo hybridization

 

	ACKNOWLEDGEMENTS

 
We would like to thank the families for participating and M. Joosse, H. van der Linde, C. Huysmans, B. Doe, S. Rhodes and T. Chapman for expert technical assistance. We greatly appreciate the help of J. Zguricas, Professor S.E.R. Hovius, E. Morales-Peralta, M. Holvoet, E. Pykelsin and F. Stockmans in collecting blood samples and ascertaining family members and D. Lambrechts for collecting Belgian control samples. We also thank Professor Nick Hastie for critically reading the manuscript.

	FOOTNOTES

 
^* To whom correspondence should be addressed. Tel: +44 1314678410; Fax: +44 1314678456; Email: bob.hill{at}hgu.mrc.ac.uk

	REFERENCES

TOP ABSTRACT INTRODUCTION RESULTS DISCUSSION MATERIALS AND METHODS REFERENCES

 

1. Sanders, J.W. Jr and Gasseling, M.T. (1968) Ectodermal–mesenchymal interactions in the origin of limb symmetry. In Fleischmajar, R. and Billingham, R.F. (eds), Ectodermal–Mesenchymal Interactions. Williams and Wilkins, Baltimore, MD, pp. 78–97.

2. Riddle, R.D., Johnson, R.L., Laufer, E. and Tabin, C. (1993) Sonic hedgehog mediates the polarizing activity of the ZPA. Cell, 75, 1401–1416.[CrossRef][Web of Science][Medline]

3. Echelard, Y., Epstein, D.J., St-Jacques, B., Shen, L., Mohler, J., McMahon, J.A. and McMahon, A.P. (1993) Sonic hedgehog, a member of a family of putative signalling molecules, is implicated in the regulation of CNS polarity. Cell, 75, 1417–1430.[CrossRef][Web of Science][Medline]

4. Masuya, H., Sagai, T., Wakana, S., Moriwaki, K. and Shiroishi T. (1995) A duplicated zone of polarizing activity in polydactylous mouse mutants. Genes Dev., 9, 1845–1853.

5. Masuya, H., Sagai, T., Moriwaki, K. and Shiroishi, T. (1997) Multigenic control of the localization of the zone of polarizing activity in limb morphogenesis in the mouse Dev. Biol., 182, 42–51.[CrossRef][Web of Science][Medline]

6. Lettice, L., Hecksher-Sørenson, J. and Hill, R.E. (1999) The dominant hemimelia mutation uncouples epithelial–mesenchymal interactions and disrupts anterior mesenchyme formation in mouse hindlimbs. Development, 126, 4729–4736.[Abstract]

7. Sharpe, J., Lettice, L., Hecksher-Sorensen, J., Fox, M., Hill, R.E. and Krumlauf, R. (1999) Identification of Sonic hedgehog as a candidate gene responsible for the polydactylous mouse mutant Sasquatch. Curr. Biol., 9, 97–100.[CrossRef][Web of Science][Medline]

8. Lettice, L.A., Horikoshi, T., Heaney, S.J.H., Van Baren, M.J., van der Linde, H.C., Breedveld, G.J., Joosse, M., Akarsu, N., Oostra, B.A., Endo, N. et al. (2002) Disruption of a long range cis-acting regulator for Shh causes preaxial polydactyly. Proc. Natl Acad. Sci. USA, 99, 7548–7553.[Abstract/Free Full Text]

9. Heutink, P., Zguricas, J., van Oosterhout, L., Breedveld, G.J., Testers, L., Sandkuijl, L.A., Snijders, P.J., Weissenbach, J., Lindhout, D., Hovius, S.E. et al. (1994) The gene for triphalangeal thumb maps to the subtelomeric region of chromosome 7q. Nat. Genet., 6, 287–292.[CrossRef][Web of Science][Medline]

10. Hing, A.V., Helms C., Slaugh R., Burgess A., Wang J.C., Herman, T., Dowton, S.B. and Donis-Keller, H. (1995) Linkage of preaxial polydactyly type 2 to 7q36. Am. J. Med. Genet., 58, 128–135.[CrossRef][Web of Science][Medline]

11. Tsukurov, O., Boehmer, A., Flynn, J., Nicolai, J.P., Hamel, B.C., Traill, S., Zaleske, D., Mankin, H.J., Yeon, H., Ho, C. et al. (1994) A complex bilateral polysyndactyly disease locus maps to chromosome 7q36. Nat. Genet., 6, 282–286.[CrossRef][Web of Science][Medline]

12. Zguricas, J., Heus, H., Morales-Peralta, E., Breedveld, G., Kuyt, B., Mumcu, E.F., Bakker, W., Akarsu, N., Kay, S.P., Hovius, S.E. et al. (1999) Clinical and genetic studies on 12 preaxial polydactyly families and refinement of the localisation of the gene responsible to a 1.9 cM region on chromosome 7q36. J. Med. Genet., 36, 32–40.[Web of Science][Medline]

13. Heus, H.C., Hing, A., van Baren, M.J., Joosse, M., Breedveld, G.J., Wang, J.C., Burgess, A., Donnis-Keller, H., Berglund, C., Zguricas, J. et al. (1999) A physical and transcriptional map of the preaxial polydactyly locus on chromosome 7q36. Genomics, 57, 342–351.[CrossRef][Web of Science][Medline]

14. Dubchak, I., Brudno, M., Loots, G.G., Mayor, C., Pachter L., Rubin, E.M. and Frazer K.A. (2000) Active conservation of non-coding sequences revealed by 3-way species comparisons. Genome Res., 10, 1304–1306.[Abstract/Free Full Text]

15. Mayor, C., Brudno, M., Schwartz, J.R., Poliakov, A., Rubin, E.M., Frazer, K.A., Pachter, L.S. and Dubchak, I. (2000) VISTA: visualizing global DNA sequence alignments of arbitrary length. Bioinformatics, 16, 1046–1047.[Abstract/Free Full Text]

16. Yee, S.P. and Rigby, P.W. (1993) The regulation of myogenin gene expression during the embryonic development of the mouse. Genes Dev., 7, 1277–1289.[Abstract/Free Full Text]

17. Elgar, G., Sandford, R., Aparicio, S., Macrae, A., Venkatesh, B. and Brenner, S. (1996) Small is beautiful: comparative genomics with the pufferfish (Fugu rubripes). Trends Genet., 12, 145–150.[CrossRef][Web of Science][Medline]

18. Krauss, S., Concordet, J.P. and Ingham, P.W. (1993) A functionally conserved homolog of the Drosophila segment polarity gene hh is expressed in tissues with polarizing activity in zebrafish embryos. Cell, 75, 1431–1444.[CrossRef][Web of Science][Medline]

19. Knudsen, T.B. and Kochhar, D.M. (1981) The role of morphogenetic cell death during abnormal limb bud outgrowth in mice heterozygous for the dominant mutation Hemimelic-extra toes (Hmx). J. Embryol. Exp. Morphol., 65 (suppl.) 289–307.

20. Clark, R.M., Marker, P.C. and Kingsley, D.M. (2000) A novel candidate gene for mouse and human preaxial polydactyly with altered expression in limbs of Hemimelic extra-toes mutant mice. Genomics, 67, 19–27.[CrossRef][Web of Science][Medline]

21. Dickie, M.M. (1968) Mouse News Letter, 38, 24.

22. Bishop, C.E., Whitworth, D.J., Qin, Y., Agoulnik, A.I., Agoulnik, I.U., Harrison, W.R., Behringer, R.R. and Overbeek, P.A. (2000) A transgenic insertion upstream of sox9 is associated with dominant XX sex reversal in the mouse. Nat. Genet., 26, 490–494.[CrossRef][Web of Science][Medline]

23. Jamieson, R.V., Perveen, R., Kerr, B., Carette, M., Yardley, J., Heon, E., Wirth, M.G., van Heyningen, V., Donnai, D., Munier, F. and Black, G.C. (2002) Domain disruption and mutation of the bZIP transcription factor, MAF, associated with cataract, ocular anterior segment dysgenesis and coloboma. Hum. Mol. Genet., 11, 33–42.[Abstract/Free Full Text]

24. Kleinjan D.J. and van Heyningen, V. (1998) Position effect in human genetic disease. Hum. Mol. Genet., 7, 1611–1618.[Abstract/Free Full Text]

25. Qu, S., Niswender, K.D., Ji, Q., van der Meer, R., Keeney, D., Magnuson, M.A. and Wisdom, R. (1997) Polydactyly and ectopic ZPA formation in Alx-4 mutant mice. Development, 124, 3999–4008.[Abstract]

26. Qu, S., Tucker, S.C., Ehrlich, J.S., Levorse, J.M., Flaherty, L.A., Wisdom, R. and Vogt, T.F. (1998) Mutations in mouse Aristaless-like4 cause Strong's luxoid polydactyly. Development, 125, 2711–2721.[Abstract]

27. van Baren, M.J., van der Linde, H.C., Breedveld, G.J., Baarends, W.M., Rizzu, P., de Graaff, E., Oostra, B.A. and Heutink, P. (2002) A double RING-H2 domain in RNF32, a gene expressed during sperm formation. Biochem. Biophys. Res. Commun., 292, 58–65.[CrossRef][Web of Science][Medline]

28. Ross, A.J., Ruiz-Perez, V., Wang, Y., Hagan, D.M., Scherer, S., Lynch, S.A., Lindsay, S., Custard, E., Belloni, E., Wilson, D.I. et al. (1998) A homeobox gene, HLXB9, is the major locus for dominantly inherited sacral agenesis. Nat. Genet., 20, 358–361.[CrossRef][Web of Science][Medline]

29. Li, H., Arber, S., Jessell, T.M. and Edlund, H. (1999) Selective agenesis of the dorsal pancreas in mice lacking homeobox gene Hlxb9. Nat. Genet., 23, 67–70.

30. Sordino, P., van der Hoeven, F. and Duboule, D. (1995) Hox gene expression in teleost fins and the origin of vertebrate digits. Nature, 375, 678–681.[CrossRef][Medline]

31. Wagner, G.P., and Chui, C.-H. (2001) The tetrapod limb: a hypothesis on its origin. J. Exp. Zool., 291, 226–240.[CrossRef][Web of Science][Medline]

32. Tanaka, M., Munsterberg, A., Anderson, W.G., Prescott, A.R., Hazon, N. and Tickle, C. (2002) Fin development in a cartilaginous fish and the origin of vertebrate limbs. Nature, 416, 527–531.[CrossRef][Medline]

33. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F. and Higgins, D.G. (1997) The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucl. Acids Res., 24, 4876–4882.

34. Mackenzie, M.A., Jordan, S.A., Budd, P.S. and Jackson, I.J. (1997) Activation of the receptor tyrosine kinase Kit is required for the proliferation of melanoblasts in the mouse embryo. Dev. Biol., 192, 99–107.[CrossRef][Web of Science][Medline]

35. Hechsher-Sørensen, J., Hill, R.E. and Lettice, L.A. (1998) Double labelling for wholemount in situ hybridization in mouse. Biotechniques, 24, 914.[Web of Science][Medline]

36. Miller, S.A., Dykes, D.D. and Polesky, H.F. (1988) A simple salting out procedure for extracting DNA from human nucleated cells. Nucl. Acids Res., 16, 121.

CiteULike    Connotea    Del.icio.us    What's this?

This article has been cited by other articles:

				D Furniss, S-h Kan, I B Taylor, D Johnson, P S Critchley, H P Giele, and A O M Wilkie Genetic screening of 202 individuals with congenital limb malformations and requiring reconstructive surgery J. Med. Genet., November 1, 2009; 46(11): 730 - 735. [Abstract] [Full Text] [PDF]

				C T Gordon, T Y Tan, S Benko, D FitzPatrick, S Lyonnet, and P G Farlie Long-range regulation at the SOX9 locus in development and disease J. Med. Genet., October 1, 2009; 46(10): 649 - 656. [Abstract] [Full Text] [PDF]

				J. Zhao, J. Ding, Y. Li, K. Ren, J. Sha, M. Zhu, and X. Gao HnRNP U mediates the long-range regulation of Shh expression during limb development Hum. Mol. Genet., August 15, 2009; 18(16): 3090 - 3097. [Abstract] [Full Text] [PDF]

				D. J. Epstein Cis-regulatory mutations in human disease Brief Funct Genomic Proteomic, July 29, 2009; (2009) elp021v1. [Abstract] [Full Text] [PDF]

				D.-J. Kleinjan and P. Coutinho Cis-ruption mechanisms: disruption of cis-regulatory control as a cause of human genetic disease Brief Funct Genomic Proteomic, July 13, 2009; (2009) elp022v1. [Abstract] [Full Text] [PDF]

				P. Navratilova and T. S. Becker Genomic regulatory blocks in vertebrates and implications in human disease Brief Funct Genomic Proteomic, July 1, 2009; 8(4): 333 - 342. [Abstract] [Full Text] [PDF]

				G. Elgar Pan-vertebrate conserved non-coding sequences associated with developmental regulation Brief Funct Genomic Proteomic, July 1, 2009; 8(4): 256 - 265. [Abstract] [Full Text] [PDF]

				P. R. Manske and K. C. Oberg Classification and Developmental Biology of Congenital Anomalies of the Hand and Upper Extremity J. Bone Joint Surg. Am., July 1, 2009; 91(Supplement_4): 3 - 18. [Full Text] [PDF]

				E. de Graaff and S. H. Kozin Genetics of Radial Deficiencies J. Bone Joint Surg. Am., July 1, 2009; 91(Supplement_4): 81 - 86. [Full Text] [PDF]

				T. Sagai, T. Amano, M. Tamura, Y. Mizushina, K. Sumiyama, and T. Shiroishi A cluster of three long-range enhancers directs regional Shh expression in the epithelial linings Development, May 15, 2009; 136(10): 1665 - 1674. [Abstract] [Full Text] [PDF]

				L. Xiong, H. Catoire, P. Dion, C. Gaspar, R. G. Lafreniere, S. L. Girard, A. Levchenko, J.-B. Riviere, L. Fiori, J. St-Onge, et al. MEIS1 intronic risk haplotype associated with restless legs syndrome affects its mRNA and protein expression levels Hum. Mol. Genet., March 15, 2009; 18(6): 1065 - 1074. [Abstract] [Full Text] [PDF]

				L. Taher and I. Ovcharenko Variable locus length in the human genome leads to ascertainment bias in functional inference for non-coding elements Bioinformatics, March 1, 2009; 25(5): 578 - 584. [Abstract] [Full Text] [PDF]

				E. Schneider, T. Marker, A. Daser, G. Frey-Mahn, V. Beyer, R. Farcas, B. Schneider-Ratzke, N. Kohlschmidt, B. Grossmann, K. Bauss, et al. Homozygous disruption of PDZD7 by reciprocal translocation in a consanguineous family: a new member of the Usher syndrome protein interactome causing congenital hearing impairment Hum. Mol. Genet., February 15, 2009; 18(4): 655 - 666. [Abstract] [Full Text] [PDF]

				H. Miura, Y. Tomaru, M. Nakanishi, S. Kondo, Y. Hayashizaki, and M. Suzuki Identification of DNA regions and a set of transcriptional regulatory factors involved in transcriptional regulation of several human liver-enriched transcription factor genes Nucleic Acids Res., February 1, 2009; 37(3): 778 - 792. [Abstract] [Full Text] [PDF]

				K. A. Fantauzzo, M. Tadin-Strapps, Y. You, S. E. Mentzer, F. A.M. Baumeister, S. Cianfarani, L. Van Maldergem, D. Warburton, J. P. Sundberg, and A. M. Christiano A position effect on TRPS1 is associated with Ambras syndrome in humans and the Koala phenotype in mice Hum. Mol. Genet., November 15, 2008; 17(22): 3539 - 3551. [Abstract] [Full Text] [PDF]

				M. Varjosalo and J. Taipale Hedgehog: functions and mechanisms Genes & Dev., September 15, 2008; 22(18): 2454 - 2472. [Abstract] [Full Text] [PDF]

				M Sun, F Ma, X Zeng, Q Liu, X-L Zhao, F-X Wu, G-P Wu, Z-F Zhang, B Gu, Y-F Zhao, et al. Triphalangeal thumb-polysyndactyly syndrome and syndactyly type IV are caused by genomic duplications involving the long range, limb-specific SHH enhancer J. Med. Genet., September 1, 2008; 45(9): 589 - 595. [Abstract] [Full Text] [PDF]

				D. Furniss, L. A. Lettice, I. B. Taylor, P. S. Critchley, H. Giele, R. E. Hill, and A. O.M. Wilkie A variant in the sonic hedgehog regulatory sequence (ZRS) is associated with triphalangeal thumb and deregulates expression in the developing limb Hum. Mol. Genet., August 15, 2008; 17(16): 2417 - 2423. [Abstract] [Full Text] [PDF]

				K. Park, J. Kang, K. Pd. Subedi, J.-H. Ha, and C. Park Canine Polydactyl Mutations With Heterogeneous Origin in the Conserved Intronic Sequence of LMBR1 Genetics, August 1, 2008; 179(4): 2163 - 2172. [Abstract] [Full Text] [PDF]

				E Klopocki, C-E Ott, N Benatar, R Ullmann, S Mundlos, and K Lehmann A microduplication of the long range SHH limb regulator (ZRS) is associated with triphalangeal thumb-polysyndactyly syndrome J. Med. Genet., June 1, 2008; 45(6): 370 - 375. [Abstract] [Full Text] [PDF]

				C. A. Salinas, E. Kwon, C. S. Carlson, J. S. Koopmeiners, Z. Feng, D. M. Karyadi, E. A. Ostrander, and J. L. Stanford Multiple Independent Genetic Variants in the 8q24 Region Are Associated with Prostate Cancer Risk Cancer Epidemiol. Biomarkers Prev., May 1, 2008; 17(5): 1203 - 1213. [Abstract] [Full Text] [PDF]

				Y. Feng, A. Vetro, E. Kiss, K. Kapornai, G. Daroczi, L. Mayer, Z. Tamas, I. Baji, J. Gadoros, N. King, et al. Association of the Neurotrophic Tyrosine Kinase Receptor 3 (NTRK3) Gene and Childhood-Onset Mood Disorders Am J Psychiatry, May 1, 2008; 165(5): 610 - 616. [Abstract] [Full Text] [PDF]

				L. A. Lettice, A. E. Hill, P. S. Devenney, and R. E. Hill Point mutations in a distant sonic hedgehog cis-regulator generate a variable regulatory output responsible for preaxial polydactyly Hum. Mol. Genet., April 1, 2008; 17(7): 978 - 985. [Abstract] [Full Text] [PDF]

				D. M. McGaughey, R. M. Vinton, J. Huynh, A. Al-Saif, M. A. Beer, and A. S. McCallion Metrics of sequence constraint overlook regulatory sequences in an exhaustive analysis at phox2b Genome Res., February 1, 2008; 18(2): 252 - 260. [Abstract] [Full Text] [PDF]

				S. Nagel, M. Scherr, A. Kel, K. Hornischer, G. E. Crawford, M. Kaufmann, C. Meyer, H. G. Drexler, and R. A.F. MacLeod Activation of TLX3 and NKX2-5 in t(5;14)(q35;q32) T-Cell Acute Lymphoblastic Leukemia by Remote 3'-BCL11B Enhancers and Coregulation by PU.1 and HMGA1 Cancer Res., February 15, 2007; 67(4): 1461 - 1471. [Abstract] [Full Text] [PDF]

				L. A. Pennacchio, G. G. Loots, M. A. Nobrega, and I. Ovcharenko Predicting tissue-specific enhancers in the human genome Genome Res., February 1, 2007; 17(2): 201 - 211. [Abstract] [Full Text] [PDF]

				N. Sabherwal, F. Bangs, R. Roth, B. Weiss, K. Jantz, E. Tiecke, G. K. Hinkel, C. Spaich, B. P. Hauffa, H. van der Kamp, et al. Long-range conserved non-coding SHOX sequences regulate expression in developing chicken limb and are associated with short stature phenotypes in human patients Hum. Mol. Genet., January 15, 2007; 16(2): 210 - 222. [Abstract] [Full Text] [PDF]

				H. Sun, G. Skogerbo, and R. Chen Conserved distances between vertebrate highly conserved elements Hum. Mol. Genet., October 1, 2006; 15(19): 2911 - 2922. [Abstract] [Full Text] [PDF]

				S. Prabhakar, F. Poulin, M. Shoukry, V. Afzal, E. M. Rubin, O. Couronne, and L. A. Pennacchio Close sequence comparisons are sufficient to identify human cis-regulatory elements Genome Res., July 1, 2006; 16(7): 855 - 863. [Abstract] [Full Text] [PDF]

				J. Liu and U. Francke Identification of cis-regulatory elements for MECP2 expression Hum. Mol. Genet., June 1, 2006; 15(11): 1769 - 1782. [Abstract] [Full Text] [PDF]

				T. D. Capellini, G. Di Giacomo, V. Salsi, A. Brendolan, E. Ferretti, D. Srivastava, V. Zappavigna, and L. Selleri Pbx1/Pbx2 requirement for distal limb patterning is mediated by the hierarchical control of Hox gene spatial distribution and Shh expression Development, June 1, 2006; 133(11): 2263 - 2273. [Abstract] [Full Text] [PDF]

				G. K. McEwen, A. Woolfe, D. Goode, T. Vavouri, H. Callaway, and G. Elgar Ancient duplicated conserved noncoding elements in vertebrates: A genomic and functional analysis Genome Res., April 1, 2006; 16(4): 451 - 465. [Abstract] [Full Text] [PDF]

				Y. Jeong, K. El-Jaick, E. Roessler, M. Muenke, and D. J. Epstein A functional screen for sonic hedgehog regulatory elements across a 1 Mb interval identifies long-range ventral forebrain enhancers Development, February 15, 2006; 133(4): 761 - 772. [Abstract] [Full Text] [PDF]

				T. Hiroki, Y.-H. Song, S. A. Liebhaber, and N. E. Cooke The human vitamin D-binding protein gene contains locus control determinants sufficient for autonomous activation in hepatic chromatin. Nucleic Acids Res., January 1, 2006; 34(8): 2154 - 2165. [Abstract] [Full Text] [PDF]

				C. D. McCabe and J. W. Innis A genomic approach to the identification and characterization of HOXA13 functional binding elements Nucleic Acids Res., November 30, 2005; 33(21): 6782 - 6794. [Abstract] [Full Text] [PDF]

				N. Ahituv, S. Prabhakar, F. Poulin, E. M. Rubin, and O. Couronne Mapping cis-regulatory domains in the human genome using multi-species conservation of synteny Hum. Mol. Genet., October 15, 2005; 14(20): 3057 - 3063. [Abstract] [Full Text] [PDF]

				M. Sironi, G. Menozzi, G. P. Comi, R. Cagliani, N. Bresolin, and U. Pozzoli Analysis of intronic conserved elements indicates that functional complexity might represent a major source of negative selection on non-coding sequences Hum. Mol. Genet., September 1, 2005; 14(17): 2533 - 2546. [Abstract] [Full Text] [PDF]

				R. W Lawrence, D. M Evans, and L. R Cardon Prospects and pitfalls in whole genome association studies Phil Trans R Soc B, August 29, 2005; 360(1460): 1589 - 1595. [Abstract] [Full Text] [PDF]

				A. Hawwari and M. S. Krangel Regulation of TCR {delta} and {alpha} repertoires by local and long-distance control of variable gene segment chromatin structure J. Exp. Med., August 15, 2005; 202(4): 467 - 472. [Abstract] [Full Text] [PDF]

				G. G. Loots and I. Ovcharenko Dcode.org anthology of comparative genomic tools Nucleic Acids Res., July 1, 2005; 33(suppl_2): W56 - W64. [Abstract] [Full Text] [PDF]

				G. G. Loots, M. Kneissel, H. Keller, M. Baptist, J. Chang, N. M. Collette, D. Ovcharenko, I. Plajzer-Frick, and E. M. Rubin Genomic deletion of a long-range bone enhancer misregulates sclerostin in Van Buchem disease Genome Res., July 1, 2005; 15(7): 928 - 935. [Abstract] [Full Text] [PDF]

				A. G. West and P. Fraser Remote control of gene transcription Hum. Mol. Genet., April 15, 2005; 14(suppl_1): R101 - R111. [Abstract] [Full Text] [PDF]

				T. Sagai, M. Hosoya, Y. Mizushina, M. Tamura, and T. Shiroishi Elimination of a long-range cis-regulatory module causes complete loss of limb-specific Shh expression and truncation of the mouse limb Development, February 15, 2005; 132(4): 797 - 803. [Abstract] [Full Text] [PDF]

				I. Ovcharenko, G. G. Loots, B. M. Giardine, M. Hou, J. Ma, R. C. Hardison, L. Stubbs, and W. Miller Mulan: Multiple-sequence local alignment and visualization for studying function and evolution Genome Res., January 1, 2005; 15(1): 184 - 194. [Abstract] [Full Text] [PDF]

				A. Boccia, M. Petrillo, D. di Bernardo, A. Guffanti, F. Mignone, S. Confalonieri, L. Luzi, G. Pesole, G. Paolella, A. Ballabio, et al. DG-CST (Disease Gene Conserved Sequence Tags), a database of human-mouse conserved elements associated to disease genes Nucleic Acids Res., January 1, 2005; 33(suppl_1): D505 - D510. [Abstract] [Full Text] [PDF]

				T. L. Wise and D. D. Pravtcheva Oligosyndactylism Mice Have an Inversion of Chromosome 8 Genetics, December 1, 2004; 168(4): 2099 - 2112. [Abstract] [Full Text] [PDF]

				V. van Heyningen and P. L. Yeyati Mechanisms of non-Mendelian inheritance in genetic disease Hum. Mol. Genet., October 1, 2004; 13(suppl_2): R225 - R233. [Abstract] [Full Text] [PDF]

				N. Ahituv, E. M. Rubin, and M. A. Nobrega Exploiting human-fish genome comparisons for deciphering gene regulation Hum. Mol. Genet., October 1, 2004; 13(suppl_2): R261 - R266. [Abstract] [Full Text] [PDF]

				I. Ovcharenko, M. A. Nobrega, G. G. Loots, and L. Stubbs ECR Browser: a tool for visualizing and accessing data from comparisons of multiple vertebrate genomes Nucleic Acids Res., July 1, 2004; 32(suppl_2): W280 - W286. [Abstract] [Full Text] [PDF]

				B. T. MacDonald, M. Adamska, and M. H. Meisler Hypomorphic expression of Dkk1 in the doubleridge mouse: dose dependence and compensatory interactions with Lrp6 Development, June 1, 2004; 131(11): 2543 - 2552. [Abstract] [Full Text] [PDF]

This Article Abstract FREE Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Search for citing articles in: ISI Web of Science (155) Request Permissions Google Scholar Articles by Lettice, L. A. Articles by de Graaff, E. Search for Related Content PubMed PubMed Citation Articles by Lettice, L. A. Articles by de Graaff, E. Social Bookmarking          What's this?

Online ISSN 1460-2083 - Print ISSN 0964-6906

Copyright © 2009 Oxford University Press

Oxford Journals Oxford University Press

• Site Map
• Privacy Policy
• Frequently Asked Questions

Other Oxford University Press sites: Oxford University Press Oxford Journals China Oxford Journals Japan American National Biography Booksellers' Information Service Children's Fiction and Poetry Children's Reference Corporate & Special Sales Dictionaries Dictionary of National Biography Digital Reference English Language Teaching Higher Education Textbooks Humanities International Education Unit Law Medicine Music Online Products Oxford English Dictionary Reference Rights and Permissions Science School Books Social Sciences Very Short Introductions World's Classics