Human Molecular Genetics, 2003, Vol. 12, No. 14 1755-1765
DOI: 10.1093/hmg/ddg182
© 2003 Oxford University Press
Dimerization of SOX9 is required for chondrogenesis, but not for sex determination


1UCLA Departments of Human Genetics, Pediatrics and Urology, Gonda Center, Room 6357, 695 Charles Young Drive South, Los Angeles, CA 90095-7088, USA and 2Human Molecular Genetics Laboratory, Prince Henry's Institute of Medical Research, Monash Medical Centre, 246 Clayton Road, Melbourne, Victoria 3168, Australia
Received January 13, 2003; Revised March 31, 2003; Accepted May 14, 2003
| ABSTRACT |
|---|
|
|
|---|
The SRY-related SOX9 gene is involved in both chondrogenesis and the early steps of mammalian sex determination. Mutations in the human SOX9 gene cause campomelic dysplasia, a severe skeletal malformation syndrome associated with male-to-female sex reversal in most, but not all, XY individuals. Here we show that SOX9 contains a dimerization domain, and binds co-operatively as a dimer in the presence of the DNA enhancer element in genes involved in chondrocyte differentiation, such as Col11a2 and Col9a2, but binds as a monomer to the regulatory region of the sex-determining gene SF1. Frameshift SOX9 mutations truncate its two activation domains, while all missense mutations reported to date lie in the high mobility group (HMG) DNA-binding domain. We identify a missense mutation (A76E), the first outside the HMG domain, in an XY patient presenting with campomelic dysplasia but without sex reversal. This mutation disrupts the dimerization capability of SOX9, interfering with both the DNA binding and consequent transactivation of both the Col11a2 and Col9a2 enhancers. Consistent with the patient's phenotype, the A76E mutation does not affect DNA binding and activation of the SF1 enhancer. DNA-dependent cooperative dimerization could represent a novel mechanism to achieve tissue-specific regulation of gene expression by a SOX transcription factor. These results establish that SOX9 cooperative dimerization is required for chondrogenesis but not for sex determination and may explain why campomelic dysplasia need not be associated with XY sex reversal.
| INTRODUCTION |
|---|
|
|
|---|
Campomelic dysplasia/autosomal sex reversal (CD/SRA1, MIM no. 114290) is a severe skeletal malformation syndrome associated with XY male-to-female sex reversal caused by mutations in the SOX9 gene. CD/SRA1 is an autosomal-dominant disorder characterized by congenital bowing of the long bones, other skeletal malformations (narrow iliac wings, hypoplastic scapulae, micrognathia) and clinical features including cleft palate, flat face with high forehead, low set ears and depressed nasal bridge, congenital heart defect, tracheobronchomalacia, narrow thoracic cage with hypoplastic lungs, hypotonia and psychomotor disorders (1). Campomelic dysplasia is generally lethal, but a minority of patients survive. A variant of CD, acampomelic CD, has all the clinical and skeletal characteristics of the disorder except the bowing of the long bones, the feature that gives it its name (2,3). Mutations in SOX9 have also been identified in the acampomelic form of CD (4,5).
SOX9 is a member of the large class of SOX (SRY-type HMG BOX) transcription factors (6) related to the testis determining factor, SRY, through their HMG domains that bind and bend DNA in a sequence-specific manner (7,8). SOX9 binds the consensus DNA sequence, (A/T)(A/T)CAA(A/T)G (9), and belongs with its closest homologues, SOX8 and SOX10, to the group E of SOX genes. SOX9 acts as a potent transcriptional activator via the PQS domain, rich in proline, glutamine and serine residues (10,11), and the adjacent PQA region, which consists entirely of proline, glutamine and alanine residues (11). A dimerization domain has been identified in SOX10 in a 40 amino acid region immediately N-terminal to the HMG domain, that allows cooperative binding in the presence of target gene promoters such as the promoter of myelin protein zero (P0), present in Schwann cells (12). This region is highly conserved amongst all other class E members (SOX8 and SOX9) (Fig. 1C).
|
There are four major classes of heterozygous SOX9 mutations causing CD: (i) amino acid substitutions in the HMG domain; (ii) truncations or frameshifts that alter the C terminus; (iii) mutations at splice junctions; and (iv) chromosomal translocations (13). All missense mutations identified thus far cluster in the HMG domain and the majority show altered DNA binding (11,14); in one patient, a nuclear import defect was described (15). Truncations, frameshifts and splice mutations truncate the C-terminus of SOX9, usually resulting in loss of transactivation domains.
Expression of SOX9 in certain cell types at specific stages of development appears to govern cell fate decisions. SOX9 is expressed in a range of tissues that are defective in CD patients, suggesting multiple targets for SOX9 in different tissues. Genes directly regulated by SOX9 have been identified in testis and cartilage.
SOX9 has been demonstrated to be required for normal cartilage development (1618). Cartilage is composed of collagen fibrils assembled from mature type II, type IX and type XI collagen molecules. The normal assembly of cartilage fibrils and their thickness is determined by type XI collagen (19). SOX9 activates the expression of the type II, IX and XI collagen genes, Col2a1, Col9 and Col11a2, as well as Aggrecan and CD-Rap (16,18,2022). A common feature of the SOX9 binding sites in the enhancers of these genes is the presence of multiple SOX binding sequences. Several SOX proteins have been implicated in binding to these multimerized sites. For example, Sox9, Sox5 and Sox6 can bind to four consensus sites in the Col2a1 enhancer (23).
In gonadal tissue, SOX9 is specifically expressed within testicular Sertoli cells following their differentiation from supporting cells in the embryonic gonadal ridge (2426). The sex reversal phenotype of human CD/SRA1 is entirely consistent with a failure of early Sertoli cell differentiation since most sex-reversed patients exhibit a normal female phenotype (27). While inactivating mutations in SOX9 result in XY sex reversal (and CD), SOX9 also has the capability to induce male development in XX humans and mice. An XX male patient was shown to carry a large duplication of chromosome 17 including SOX9 (28). In addition, a mouse mutant named Odsex, in which the insertion of an unrelated transgene 1 Mb upstream of the SOX9 gene leading to the deletion of 150 kb of endogenous sequence, was XX sex-reversed (29). During testicular development, the profile of SOX9 expression overlaps that of Steroidogenic Factor 1 (SF1), an orphan nuclear receptor critical for steroid hormone biosynthesis and gonad development. Evidence that SF1 is a sex-determining gene came from the identification of mutations in XY sex-reversed female patients also affected with Adrenal Hypoplasia Congenita (30,31). Following the onset of expression of Sry, the initial trigger of testis development, at E10.5, Sox9 and Sf1 are up-regulated in male mouse embryos at E12.5 and E13.5, respectively. In a recent study, Sox9 was shown to bind and activate a SOX binding site within the proximal Sf1 promoter (32), suggesting that Sf1 is a key target of Sox9 in triggering sex determination. SOX9 and SF1 also activate the expression of the anti-Müllerian hormone gene (AMH), which leads to the regression of the female reproductive tract (3335).
Curiously, all four SOX9 targets in chondrogenesis comprise multimerized sites, whereas the two known targets in gonadal and reproductive tract development, SF1 and AMH, comprise single sites. On this basis, we hypothesize that the dimerization of SOX9 might be required for normal bone development whereas gonadogenesis would require only a monomeric form of SOX9. In this study, we demonstrate that SOX9 binds as a dimer to both the Col11a2 and Col9a2 enhancers and as a monomer to the SF1 proximal promoter, and that dimerization of SOX9 is DNA-dependent. Further, we identified a novel missense SOX9 mutation, A76E, the first outside the HMG domain, in an XY male patient (i.e. not sex-reversed), presenting with campomelic dysplasia, which occurs in the dimerization domain (Fig. 1B). The mutant SOX9 protein disrupts the dimerization capability of SOX9, thereby interfering with its DNA binding and consequent transactivation of both the Col11a2 and Col9a2 enhancers but does not affect transactivation through the SF1 enhancer.
| RESULTS |
|---|
|
|
|---|
Identification of a novel SOX9 mutation in a campomelic dysplasia patient
The patient was born to non-consanguineous healthy Caucasian parents after 37 weeks of gestation. Patient was hypotonic, had tracheomalacia and Pierre Robin sequence requiring a tracheostomy, macrocephaly, cleft palate, a flat face with broad and depressed nasal root, low set ears, micrognathia and bilateral hip dislocation. There was no congenital heart defect and the external genitalia were normal male, with a normal-sized penis and both testes descended. Skeletal X-rays revealed hypoplastic scapulae (Fig. 1A), as well as narrow iliac wings. Karyotype was 46, XY. The patient subsequently failed to thrive and developed a severe scoliosis. On the basis of characteristic clinical and radiological features, a diagnosis of acampomelic campomelic dysplasia was made.
To screen for a mutation, the entire SOX9 open reading frame was amplified from genomic DNA extracted from blood lymphocytes by polymerase chain reaction (PCR). A novel missense mutation was identified at nucleotide position 227 (A227C) leading to the amino acid substitution alanine 76 to glutamic acid (A76E; Fig. 1A). The patient carried a mutant allele and a normal allele, indicating that the mutation is heterozygous. Neither of the parents carried the mutation, indicating that this is a de novo mutation. The mutation occurred in the dimerization domain (Fig. 1B) at a conserved position, as alanine at position 76 is conserved among all members of class E SOX proteins (Fig. 1C).
The A76E mutant lacks the ability to form dimers in presence of paired SOX sites
Wild-type (WT), A76E mutant and Q312X (a truncated form of wild-type SOX9) proteins were expressed in vitro and analysed by SDSPAGE. All three proteins were soluble, stably expressed and migrated according to their predicted molecular weights (Fig. 2A).
|
Since the A76E mutation is located in the domain which, for SOX10, is involved in cooperative dimer formation at the paired SOX target sites in the P0 promoter (36), we sought first to test the binding of SOX9 to this target site. The P0 DNA probe was labelled and incubated with SOX9 proteins and the complexes analysed by electrophoretic mobility shift assay (EMSA; Fig. 2B). In the presence of DNA, WT SOX9 formed a predominant band corresponding to a dimer (lane 3) as did the truncated form Q312X (lane 2); a mixture of the two resolved (from slowest to fastest migrating) into three complexes: WT/WT dimers, Q312X/WT heterodimers and faint Q312X/Q312X dimers (lane 5). Q312X showed a slight preference for binding to WT SOX9 than to itself. In contrast, the A76E SOX9 mutant showed a faint SOX9 dimer band and a predominant fast migrating band likely to be a SOX9 monomer (lane 4). These results suggest that SOX9 forms dimers in the presence of DNA and that the A76E mutant shows a reduced ability to form dimers.
To test directly if SOX9 can form dimers in the absence or presence of DNA, 35S-radiolabelled SOX9 was incubated in the presence or absence of glutaraldehyde, a cross-linking reagent, and analysed by SDSPAGE (Fig. 2C). SOX9 migrates at a molecular weight of
75 kDa (Fig. 2C, lane 1) and this migration was not affected by the presence of glutaraldehyde except that in the absence of DNA a faint 150 kDa band was observed when SOX9 was incubated with glutaraldehyde (lane 2), which is likely to represent non-specific binding of SOX9 to plasmid DNA. In the presence of DNA, a prominent slower migrating complex of
150 kDa was observed (lane 4, arrowed), suggesting that SOX9 forms homodimers. For A76E, in the presence of DNA and glutaraldehyde, no 150 kDa band was apparent, suggesting that the A76E mutant lacks the ability to form homodimers (lane 8).
To test if the A76E mutation affects the ability of SOX9 to localize to the nucleus, we investigated the nuclear localization of the wild-type and the A76E mutant by immunohistochemistry (Fig. 2D). Wild-type and mutant A76E SOX9 protein showed similar and exclusive nuclear localization, in contrast to a control SOX9 mutant, A158T, which has a defect in nuclear import (15), and displayed some cytoplasmic localization (bottom panel).
Cooperative binding of SOX9 is functionally important for chondrogenesis target genes
As the patient exhibits major bone deformities, we tested the effect of SOX9 upon two bona fide SOX9 target chondrogenesis genes, Col11a2 and Col9a2. These genes contain enhancers with paired SOX binding sites (37). A DNA probe containing the Col11a2 enhancer element or the Col9a2 enhancer element was incubated with SOX9 proteins and complexes were analysed by EMSA (Fig. 3A and C). Q312X-truncated SOX9 and WT full-length SOX9 proteins predominantly formed dimer complexes with both Col11a2 and Col9a2 enhancer DNA (lanes 2 and 3). For WT full-length SOX9, the monomer is detected (lane 3), migrating at a position near the Q312X homodimer (lane 2). Q312X is almost half the size of full-length SOX9. A mixture of WT full-length and Q312X truncated SOX9 resolved into Q312X/Q312X dimers, Q312X/WT heterodimers and WT/WT dimers (lane 5). The A76E mutant showed a predominant SOX9 monomer band (lane 4) and, when compared with the WT/Q312X mixture, A76E/Q312X showed a reduction in the intensity of dimer complexes and a concomitant increase in monomer complexes (lanes 5 and 6), suggesting a dimerization defect in the A76E mutant.
|
To investigate the consequences in vivo of SOX9 dimerization upon regulation of Col11a2 and Col9a2, CHO cells were transfected with SOX9 and E1b-CAT reporter plasmid containing the Col11a2 enhancer (Fig. 3B) or the Col9a2 enhancer (Fig. 3D). Wild-type SOX9 transactivates the Col11a2E1bCAT construct 20-fold better than the empty E1bCAT vector. Transactivation by the A76E SOX9 mutant was reduced to 40% of wild-type activity when 20 ng of SOX9 plasmid were transfected (Fig. 3B). At lower levels of SOX9, the mutant was not able to induce CAT activity above basal level. In the Col9a2 enhancer, transactivation by the A76E SOX9 mutant was reduced to 45% of wild-type activity when 50 ng of SOX9 plasmid were transfected (Fig. 3D).
The decreased ability of A76E mutant to activate both Col11a2 and Col9a2 transcription correlates with the defect in cooperative dimerization and DNA binding observed in vitro, suggesting a functional significance for cooperative binding to DNA targets in chondrogenesis.
Since SOX9 dimerization requires DNA, we tested if the spacing of the paired SOX9 sites on the Col11a2 enhancer influences binding of SOX9. WT SOX9 or A76E SOX9 were incubated with two different spacing mutants of Col11a2 probe (Fig. 4A). The percentages of dimer relative to monomer formation for WT SOX9 binding to WT Col11a2 probe, +3 mutant probe, and -3 mutant probe were 64, 51 and 31%, indicating that the addition or deletion of three bases reduces cooperative dimer formation. In contrast, dimer formation by the A76E mutant on the +3 probe was reduced further than that of WT SOX9 (16 versus 51%), suggesting residual cooperative binding by WT SOX9 to this probe. Dimer formation by the A76E mutant on the WT probe was low (34%) and comparable with WT SOX9 on the -3 probe, suggesting loss of cooperativity in both cases. This confirms previous observation that the +3 and -3 spacing alterations completely abolished Coll11a2 enhancer activity in RCS cells (37).
|
To investigate the cooperative nature of dimeric binding, varying amounts of WT or A76E mutant SOX9 were incubated with the Col11a2 enhancer DNA (Fig. 4B). With increasing SOX9 concentration, WT SOX9 dimer formation increases sharply whereas monomer complex formation does not, indicating cooperative binding. With increasing A76E mutant concentration, dimer formation was comparable with mononer formation (Fig. 4B). This confirms that the A76E mutant results in a defect in cooperative binding to the Col11a2 enhancer.
Cooperative binding of SOX9 is inconsequentialfor SF1 activation
In addition to its major role in chondrogenesis, SOX9 plays a key role in sex determination. As the patient exhibits no sex-reversal or gonadal dysgenesis, we investigated the consequence of a defect in SOX9 dimerization on its regulation of a critical gene in the sex determination pathway, steroidogenic factor 1, SF1 (32).
To explore the functional consequences of a defect in cooperative binding of SOX9 to the SF1 promoter, the SOX9 enhancer element in the SF1 promoter was labelled and incubated with wild-type and A76E mutant SOX9 proteins and the resultant complexes were analysed by EMSA (Fig. 5A). A single predominant band was evident in both WT and A76E mutant SOX9 lanes, migrating at the position of a SOX9 monomerDNA complex (lanes 3 and 4), consistent with the fact that the SF1 promoter only contains one copy of the SOX9 enhancer element. Intriguingly, A76E SOX9 (lane 4) bound as a monomer to the SF1 promoter with slightly higher affinity than the wild-type protein (lane 3). Mixtures of truncated SOX9 with full-length wild-type or mutant SOX9 showed only the presence of monomerDNA binary complexes, with the mutant again binding slightly more strongly (lanes 5 and 6). Increasing concentrations of WT and A76E SOX9 only led to increasing monomerDNA complex formation but no dimer formation was observed (Fig. 5B).
|
To compare the relative strength of DNA binding activity of wild-type and A76E SOX9 proteins, we competed complex formation with increasing amounts of unlabelled SF1 DNA probe using 1 nM of SOX9 protein (Fig. 5C). With increasing competitor DNA, complex formation was inhibited by WT and A76E mutant to a similar extent (see EMSAs left panel and quantitation, right panel), suggesting that the A76E mutation has no intrinsic effect upon DNA binding activity by the HMG domain on a single DNA binding site. This also suggests that the differences in binding affinity observed between wild-type and A76E mutant in Fig. 5B were probably due to differences in protein quantities loaded onto the gel.
To analyse the apparent near wild-type DNA binding activity of the A76E SOX9 mutant on the SF1 promoter in vivo, CHO cells were transfected with SOX9 and a CAT reporter containing the SF1 promoter (Fig. 5D). Transactivation by the A76E SOX9 mutant was not significantly different from that of wild-type SOX9 (P>0.1). These results, together with the patient's normal sexual phenotype, suggest that the defect in cooperative dimerization of SOX9 does not affect its function on the sex determination gene, SF1, nor processes downstream of SF1 in the sex determination pathway.
| DISCUSSION |
|---|
|
|
|---|
The embryonic development of tissues is controlled by the cross-talk of signalling pathways leading to the tissue-specific regulation of transcription factors. Campomelic dysplasia is a good model to understand how a single transcription factor controls the development of several organs. This severe defect of cartilage development is associated, in
75% of the cases, with a disruption of testicular differentiation. Both the skeletal dysplasia and the XY sex reversal are caused by mutations in SOX9. All mutations in SOX9 result in CD, with or without sex reversal (38), whereas no mutation in SOX9 has been associated with isolated sex reversal (39). Since SOX9 is expressed in the developing cartilage and testis, how does one explain the different functional consequences of mutations? The type and localization of mutations in SOX9 has not provided an explanation to date. All missense and most nonsense and frameshift mutations are localized in the HMG domain, with no clear correlation with the patients' phenotypes (Fig. 1B). In this study, we have investigated the function of SOX9 on target genes involved in chondrogenesis and sex determination. We report that SOX9 binds cooperatively as a dimer to the paired SOX sites controlling the expression of Col11a2 and Col 9a2, critical factors for cartilage differentiation. In contrast, we show that SOX9 binds as a monomer to the single SOX site in SF1, a key gene for sex determination, suggesting that co-operative dimerization is not a requirement for SOX9 function in gonadal development. Moreover, we identify the first missense mutation (A76E) outside of the HMG box, in an XY patient with campomelic dysplasia but no sex reversal. Functional studies show that the A76E mutation does not affect the ability of SOX9 to bind DNA or to translocate to the nucleus, but disrupts the cooperative dimerization capacity of SOX9 and consequently its transactivation of both Col11a2 and Col9a2 enhancers. Taken together, these data suggest that cooperative binding of SOX9 is essential for activation of key chondrogenesis genes but not for activation of the sex-determining gene SF1 and may explain why campomelic dysplasia need not be associated with XY sex reversal. Clearly deletions and missense mutations outside the dimerization domain observed in CD males may indirectly affect cooperative dimerization, but the mechanisms are less clear.
The patient's phenotype is mild (non-lethal, with acampomelic CD). Mild forms of CD are most often associated with chromosomal rearrangements of chromosome 17, rather than mutations within the SOX9 open reading frame (40), suggesting that disruption of cis-regulatory elements does not result in a complete loss of SOX9 activity, rather leading to a reduction of expression of SOX9 from the translocated allele, such that the effective dose of SOX9 is less than the normal diploid dose. However, missense mutations (all within the HMG box until the description of our patient) have also been described in acampomelic CD. Although no clear phenotype/genotype correlation can be established, it is possible to speculate that missense mutations associated with acampomelic CD are associated with some residual activity of SOX9. In the case of the A76E mutation, the disruption of SOX9 dimerization is not complete, and may not have completely impaired its transactivation function.
SOX9 belongs to the group E of SOX proteins, with SOX8 and SOX10. SOX10 was shown to bind to DNA both as a monomer and a dimer (12). A 40 amino acid domain immediately N-terminal to the HMG domain has been shown to be essential for co-operative binding of SOX10, and to be conserved only in Sox8 and Sox9 (36). The A76E mutation described here resides within this 40 amino acid region. Co-operation between this domain and the HMG box is essential for dimerization and also involves key amino acids in the HMG box (36). In vitro and in vivo studies of the regulation of SOX10 targets show that dimerization is important for SOX10 function, independently of its effect on DNA bending. SOX9, like SOX10, was previously shown to bind both as a dimer and a monomer to the P0 promoter (12). Our results show that this is the case also in the physiological context of the enhancers of SOX9 target genes, but more importantly, that requirements for dimeric or monomeric binding may specify the function of SOX9 during development. Our results suggest that DNA-dependent cooperative binding is essential to SOX9 function in chondrogenesis (e.g. the activation of chondrogenic target genes such as Col11a2 and Col9a2), and paired SOX sites seem to be a feature of SOX9 targets in chondrogenesis as these are present in enhancers of not only Col11a2 and Col9a2, studied here, but also those of Col2a1, Col9a1, aggrecan and CD-rap (16,18,2022). In contrast, we show that dimerization of SOX9 is not required to activate the sex-determining gene SF1. Furthermore, the mutant shows that wild-type binding activity as a monomer is localized in the nucleus in transfected cells and transactivates SF1 enhancer to levels similar to wild-type. In addition to well-established mechanisms that permit specificity of action, such as temporal, spatial and quantitative profile of expression, or binding to tissue-specific cofactors, dimerization seems to provide an additional level of complexity and flexibility to achieve functional specificity, at least for SOX9. Moreover, in tissues where more than one group E SOX protein is present, additional versatility may be achieved through cooperative heterodimerization.
The reduced cooperative dimerization observed in the A76E SOX9 mutant resembles that observed for both wild-type SOX10 on a paired P0 site with a five nucleotide insertion mutation between paired SOX binding sites and the three nucleotide insertion mutation in the Coll11a2 shown here. The orientation of the mutant protein on DNA or the positioning of the paired SOX sites could underlie the co-operativity defect (36). Co-operativity may change the DNA architecture since changes in DNA bending by SOX10 have been reported. Perhaps more importantly, co-operative dimerization may dictate which transcriptional components are recruited to a given enhancer.
Do other SOX genes share this functionally important binding versatility? So far, SOX9 represents the only example of a SOX protein for which different binding modes occur on different target genes. The dimerization domain is present only in the class E of SOX proteins (36), one of the most recently diverged SOX classes (41). In this group of SOX factors, an extra level of flexibility of transcriptional control may have been provided by the acquisition of cooperative binding property. On the basis of similarity between the binding sites of a number of SOX proteins, it was argued that SOX factors co-evolve with their DNA targets to achieve specificity (9). Gene duplication is a powerful driving force of evolution and variation in the sequence of DNA targets may have been the evolutionary trigger for dimerization, as the binding complex that SOX9 forms is likely to be dictated by whether the target site is single or paired. This is consistent with our observation that dimerization clearly depends on DNA binding. We speculate that cooperative binding-related specificity is a recently evolved mechanism and that dimerization may have allowed SOX9 to acquire a novel function (chondrogenesis) during evolution. The recent evolution of dimerization capacity in SOX9 is consistent with the fact that bone formation is a more recent evolutionary phenomenon than gonadogenesis.
Functional specificity by cooperative binding is a novel mechanism which allows more versatility in the developmental mechanism of SOX9 action. At present, due to lack of identified target sequences, it is impossible to generalize our results to other transcription factors, but one can predict that at least other members of the class E of SOX proteins may function in a similar fashion.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmids
The reporter constructs, pSF1CAT, pCol11a2CAT and pCol9a2CAT were constructed by cloning the human SF1 proximal promoter element [Sox-BS1 (32)]: 5'-GAATGAAGAGAAACACCAACAAAGAAGGCGAGAGGCCTGCCTGCA-3'; Col11a2 enhancer element [D/E (21)]: 5'-GGCGGCTGCTTTTCAAAGGCGCCTTGTTTGCCGGTCTGCA-3'; and Col9a2 enhancer element (37): 5'-GACTATGCATTGTGGTGTTTGATAGTCTAAGGGACACTTTTCATAGTGCA into the pE1bCAT reporter vector (42). The core SOX9 binding sites are shown in bold. pCMVlac, which encodes the reporter enzyme ß-galactosidase (ß-gal), pcDNA3SOX9 (full-length), and A158TpCDNA3SOX9 have been previously described (15).
The QuikChange Site-Directed Mutagenesis Kit (Stratagene) was used to introduce the desired point mutation (A76E) into the pCDNA3SOX9 construct using the oligonucleotide primers: forward, 5'-CGTGTGCATCCGCGAGGAGGTCAGCCAGGTGCTC-3'; reverse, 5'-GAGCACCTGGCTGACCTCCTCGCGGATGCACACG-3'. Sequences were verified by automated DNA sequencing (ABI Prism Tm 373, Perkin-Elmer). The Q312X truncated SOX9 protein was obtained after digestion of pcDNA3.1-SOX9 plasmid with the restriction enzyme BstEII.
PCR amplification and DNA sequencing
After informed consent of the patient's parents, blood samples were collected from the patient and the patient's parents. Genomic DNA was obtained by standard extraction methods (Gentra). The subsequent DNA analysis was part a research protocol approved by the UCLA Institutional Review Board. The entire SOX9 open reading frame (ORF) was amplified by PCR from the patient's genomic DNA. Oligonucleotide primer sets chosen (13) were used to amplify 17 small (124364 bp) overlapping fragments of the SOX9 gene and intron/exon junctions. All PCR reactions were carried out in a Puregene DNA thermal cycler. PCR products were either directly purified using standard methods (BD Bioscience) or gel-extracted using the Nucleospin Extraction kit (BD Bioscience). DNA sequencing was carried out on an automated DNA sequence analyzer (ABI Prism Tm 373, Perkin-Elmer).
In vitro transcription/translation
Full-length wild-type, mutant and truncated SOX9 proteins were produced by in vitro transcription and translation using the TNT Quick Coupled Transcription/Translation kit (Promega). Yields of protein were estimated from the incorporation of 35S-methionine in reactions which were performed in parallel with non-radiolabelled syntheses. The 35S-radiolabelled wild-type, mutant, truncated SOX9 proteins, and negative control pcDNA3.1 were run on a 12% SDSPAGE gel. The gel was dried, exposed and developed using Kodak X-Omat film.
Electromobility shift assay
The oligonucleotide sequences of the upper strands used were: P0 DNA probe, 5'-GCCTACACAAAGCCCTCTGTGTAAGACTGCA-3'; SF1, 5'-GAATGAAGAGAAACACCAACAAAGAAGGCGAGAGGCCTGCC-3'; Col11a2, 5'-GGCGGCTGCTTTTCAAAGGCGCCTTGTTTGCCGGTC-3'; and Col9a2, 5'-GACTATGCATTGTGGTGTTTGATAGTCTAAGGGACACTTTTCATAG-3'. The core SOX9 binding sites are shown in bold. To prepare probes, complementary oligonucleotides were annealed, end-labelled with [
-32P] ATP using T4 polynucletoide kinase, and purified on Bio-Gel P4 spin columns (Stratagene). Reaction mixtures with final volumes of 20 µl contained the labelled probe, SOX9 protein, 8 µg poly(dIdC), salmon sperm DNA, and 1x binding buffer [25 mM HEPES (pH 7.5), 5 mM MgCl2, 1 mM EDTA, 10% glycerol, 40 mM KCl, 1 mM DTT]. These samples were incubated at 4°C for 20 min. The products were separated on 4% polyacrylamide gels [19 : 1 (w/w) acrylamide/bisacrylamide] in 0.5x TBE for 1 h at 25 mA. Gels were dried and exposed for autoradiography at -80°C using Kodak X-OMAT AR films.
Glutaraldehyde cross-linking of full-length SOX9
In vitro translated proteins (0.025 mg) were incubated in presence or absence of P0 DNA probe in 1x binding buffer without glycerol in a final volume of 10 µl for 20 min on ice. Cross-linking reagent, 0.01% glutaraldehyde (Sigma Aldrich) was added to the mixture and the reactions were incubated for 20 min at room temperature followed by inactivation with SDS sample buffer at 95°C. Proteins were resolved by SDSPAGE (7.5%) and detected by autoradiography.
Cell culture
Chinese hamster ovary (CHO-K1) cells were a kind gift from Dr Guck Ooi. Cells were cultured in HAMS-F12 medium, 5% fetal calf serum supplemented with non-essential amino acids (2 mM) and 3.7 g/l sodium bicarbonate. Cells were split at 7080% confluence and the medium was replaced every 24 days. Twenty-four hours prior to transfection, cells were plated at a density of 0.25x106 cells per well in six-well plates.
Transient transfections
One microgram of the various reporter constructs (pSF1CAT, pCol11a2CAT, pCol9a2CAT and pE1bCAT), 20 ng pCMVlac (internal control), and indicated amounts of either pcDNA3SOX9 wild-type, pcDNA3SOX9 A76E or pcDNA3 vector were transfected into CHO cells using FuGENE6 (Roche). Total DNA transfected was kept at 1.25 µg between transfections with pUC18 DNA. Cells were transfected 24 h after plating and the FuGENE6DNA precipitate was left on the cells for 48 h during which the medium was replaced at 24 h after transfection.
Immunohistochemistry
COS-7 cells, grown on coverslips, were transiently transfected with 1.5 µg of either pcDNA3SOX9 or mutant or pcDNA3.1 empty vector, using FUGENE6 (Roche) according to the manufacturer's instructions. SOX9 has a haemagglutinin (HA) epitope tag engineered at its N-terminal part for detection of HASOX9 fusion protein with an anti-HA antibody. Cells were fixed with 4% paraformaldehyde/PBS for 7 min at room temperature and blocked in 3% BSA in 1x PBS containing 0.7% Triton X-100 for 1 h at 37°C. Cells were then incubated with HA-Tag 262K monoclonal antibody (1 : 400; Cell Signaling Technology) for 1 h at 37°C. Cells were washed three times with PBS0.2% Tween-20 before incubation with Alexa Fluor 488 goat anti-mouse IgG1 (Molecular Probes).
After three 10 min washes with PBS0.2% Tween-20, DNA was stained with 0.1 µg/ml of 4', 6-diamidino-2-phenylindole (DAPI) and cells were mounted on glass slides in Vectorshield (Vector Laboratories). Immunofluorescence was visualized using a fluorescent microscope (Olympus BX50) and cells were captured with a digital camera (FUJIX HC-2000) at 40x magnification. Images were processed using PhotoShop 5.0 (Adobe Systems Inc.).
CAT and ß-galactosidase assays
Cells were washed twice with 1x phosphate buffered saline and lysed 48 h after transfection using 1x reporter lysis buffer (Promega). CAT and ß-gal assays were performed on the soluble cell extracts, with a CAT ELISA kit (Roche) and the ß-galactosidase Enzyme Assay System kit (Promega). CAT activity was normalized to ß-galactosidase activity. Transfection data represent at least three independent experiments.
| ACKNOWLEDGEMENTS |
|---|
The authors wish to acknowledge Dr Helena Sim for her help with the immunofluorescence assays, Dr Michael Clarkson for helpful discussions and comments, Dr Emmanuèle Délot for her insightful comments and Mandy Curd for secretarial assistance. This work was supported in part by grants from the American Foundation for Urologic Diseases and the Swiss National Science Foundation (to P.B.), the March of Dimes foundation (to E.V.) and the NHMRC, Australia, grant no. 198713 (to V.R.H.).
| FOOTNOTES |
|---|
* To whom correspondence should be addressed. Tel: +1 3102672455; Fax: +1 3107945446; Email: evilain{at}ucla.edu
The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors ![]()
| REFERENCES |
|---|
|
|
|---|
-
Mansour, S., Hall, C.M., Pembrey, M.E. and Young, I.D. (1995) A clinical and genetic study of campomelic dysplasia. J. Med. Genet., 32, 415420.
[Abstract/Free Full Text] - Macpherson, R.I., Skinner, S.A. and Donnenfeld, A.E. (1989) Acampomelic campomelic dysplasia. Pediatr. Radiol., 20, 9093.[CrossRef][Web of Science][Medline]
- Friedrich, U., Schaefer, E. and Meinecke, P. (1992) Campomelic dysplasia without overt campomelia. Clin. Dysmorphol., 1, 172178.[Medline]
- Thong, M.K., Scherer, G., Kozlowski, K., Haan, E. and Morris, L. (2000) Acampomelic campomelic dysplasia with SOX9 mutation. Am. J. Med. Genet.. 93, 421425.[CrossRef][Web of Science][Medline]
- Moog, U., Jansen, N.J., Scherer, G. and Schrander-Stumpel, C.T. (2001) Acampomelic campomelic syndrome. Am. J. Med. Genet., 104, 239245.[CrossRef][Web of Science][Medline]
- Koopman, P. (1999) Sry and Sox9: mammalian testis-determining genes. Cell. Mol. Life Sci., 55, 839856.[Web of Science][Medline]
-
Harley, V.R., Jackson, D.I., Hextall, P.J., Hawkins, J.R., Berkovitz, G.D., Sockanathan, S., Lovell-Badge, R. and Goodfellow, P.N. (1992) DNA binding activity of recombinant SRY from normal males and XY females. Science, 255, 453456.
[Abstract/Free Full Text] - Pontiggia, A., Rimini, R., Harley, V.R., Goodfellow, P.N., Lovell-Badge, R. and Bianchi, M.E. (1994) Sex-reversing mutations affect the architecture of SRY-DNA complexes. EMBO J., 13, 61156124.[Web of Science][Medline]
-
Mertin, S., McDowall, S.G. and Harley, V.R. (1999) The DNA-binding specificity of SOX9 and other SOX proteins. Nucl. Acids Res., 27, 13591364.
[Abstract/Free Full Text] - Sudbeck, P., Schmitz, M.L., Baeuerle, P.A. and Scherer, G. (1996) Sex reversal by loss of the C-terminal transactivation domain of human SOX9. Nat. Genet., 13, 230232.[CrossRef][Web of Science][Medline]
-
McDowall, S., Argentaro, A., Ranganathan, S., Weller, P., Mertin, S., Mansour, S., Tolmie, J. and Harley, V. (1999) Functional and structural studies of wild type SOX9 and mutations causing campomelic dysplasia. J. Biol. Chem., 274, 2402324030.
[Abstract/Free Full Text] -
Peirano, R.I. and Wegner, M. (2000) The glial transcription factor Sox10 binds to DNA both as monomer and dimer with different functional consequences. Nucl. Acids Res., 28, 30473055.
[Abstract/Free Full Text] - Kwok, C., Weller, P.A., Guioli, S., Foster, J.W., Mansour, S., Zuffardi, O., Punnett, H.H., Dominguez-Steglich, M.A., Brook, J.D., Young, I.D. et al. (1995) Mutations in SOX9, the gene responsible for campomelic dysplasia and autosomal sex reversal. Am. J. Hum. Genet., 57, 10281036.[Web of Science][Medline]
-
Meyer, J., Sudbeck, P., Held, M., Wagner, T., Schmitz, M.L., Bricarelli, F.D., Eggermont, E., Friedrich, U., Haas, O.A., Kobelt, A.et al. (1997) Mutational analysis of the SOX9 gene in campomelic dysplasia and autosomal sex reversal: lack of genotype/phenotype correlations. Hum. Mol. Genet., 6, 9198.
[Abstract/Free Full Text] -
Preiss, S., Argentaro, A., Clayton, A., John, A., Jans, D.A., Ogata, T., Nagai, T., Barroso, I., Schafer, A.J. and Harley, V.R. (2001) Compound effects of point mutations causing campomelic dysplasia/autosomal sex reversal upon SOX9 structure, nuclear transport, DNA binding, and transcriptional activation. J. Biol. Chem., 276, 2786427872.
[Abstract/Free Full Text] - Bell, D.M., Leung, K.K., Wheatley, S.C., Ng, L.J., Zhou, S., Ling, K.W., Sham, M.H., Koopman, P., Tam, P.P. and Cheah, K.S. (1997) SOX9 directly regulates the type-II collagen gene. Nat. Genet., 16, 174178.[CrossRef][Web of Science][Medline]
- Bi, W., Deng, J.M., Zhang, Z., Behringer, R.R. and de Crombrugghe, B. (1999) Sox9 is required for cartilage formation. Nat. Genet., 22, 8589.[CrossRef][Web of Science][Medline]
- Lefebvre, V., Huang, W., Harley, V.R., Goodfellow, P.N. and de Crombrugghe, B. (1997) SOX9 is a potent activator of the chondrocyte-specific enhancer of the pro alpha1(II) collagen gene. Mol. Cell. Biol., 17, 23362346.[Abstract]
-
Blaschke, U.K., Eikenberry, E.F., Hulmes, D.J., Galla, H.J. and Bruckner, P. (2000) Collagen XI nucleates self-assembly and limits lateral growth of cartilage fibrils. J. Biol. Chem., 275, 1037010378.
[Abstract/Free Full Text] - Ng, L.J., Wheatley, S., Muscat, G.E., Conway-Campbell, J., Bowles, J., Wright, E., Bell, D.M., Tam, P.P., Cheah, K.S. and Koopman, P. (1997) SOX9 binds DNA, activates transcription, and coexpresses with type II collagen during chondrogenesis in the mouse. Dev. Biol., 183, 108121.[CrossRef][Web of Science][Medline]
-
Bridgewater, L.C., Lefebvre, V. and de Crombrugghe, B. (1998) Chondrocyte-specific enhancer elements in the Col11a2 gene resemble the Col2a1 tissue-specific enhancer. J. Biol. Chem., 273, 1499815006.
[Abstract/Free Full Text] - Xie, W.F., Zhang, X., Sakano, S., Lefebvre, V. and Sandell, L.J. (1999) Trans-activation of the mouse cartilage-derived retinoic acid-sensitive protein gene by Sox9. J. Bone Miner. Res., 14, 757763.[CrossRef][Web of Science][Medline]
- Lefebvre, V., Li, P. and de Crombrugghe, B. (1998) A new long form of Sox5 (L-Sox5), Sox6 and Sox9 are coexpressed in chondrogenesis and cooperatively activate the type II collagen gene. EMBO J., 17, 57185733.[CrossRef][Web of Science][Medline]
- Morais da Silva, S., Hacker, A., Harley, V., Goodfellow, P., Swain, A. and Lovell-Badge, R. (1996) Sox9 expression during gonadal development implies a conserved role for the gene in testis differentiation in mammals and birds. Nat. Genet., 14, 6268.[CrossRef][Web of Science][Medline]
- Kent, J., Wheatley, S.C., Andrews, J.E., Sinclair, A.H. and Koopman, P. (1996) A male-specific role for SOX9 in vertebrate sex determination. Development, 122, 28132822.[Abstract]
- de Santa Barbara, P., Moniot, B., Poulat, F. and Berta, P. (2000) Expression and subcellular localization of SF-1, SOX9, WT1, and AMH proteins during early human testicular development. Dev. Dyn., 217, 293298.[CrossRef][Web of Science][Medline]
- Schafer, A.J. (2001) Campomelic Dysplasia/Autosomal Sex Reversal/SOX9, 8th edn McGraw-Hill, New York.
- Huang, B., Wang, S., Ning, Y., Lamb, A.N. and Bartley, J. (1999) Autosomal XX sex reversal caused by duplication of SOX9. Am. J. Med. Genet., 87, 349353.[CrossRef][Web of Science][Medline]
- Bishop, C.E., Whitworth, D.J., Qin, Y., Agoulnik, A.I., Agoulnik, I.U., Harrison, W.R., Behringer, R.R. and Overbeek, P.A. (2000) A transgenic insertion upstream of sox9 is associated with dominant XX sex reversal in the mouse. Nat. Genet., 26, 490494.[CrossRef][Web of Science][Medline]
-
Achermann, J.C., Ito, M., Silverman, B.L., Habiby, R.L., Pang, S., Rosler, A. and Jameson, J.L. (2001) Missense mutations cluster within the carboxyl-terminal region of DAX-1 and impair transcriptional repression. J. Clin. Endocrinol. Metab., 86, 31713175.
[Abstract/Free Full Text] -
Achermann, J.C., Ozisik, G., Ito, M., Orun, U.A., Harmanci, K., Gurakan, B. and Jameson, J.L. (2002) Gonadal determination and adrenal development are regulated by the orphan nuclear receptor steroidogenic factor-1, in a dose-dependent manner. J. Clin. Endocrinol. Metab., 87, 18291833.
[Abstract/Free Full Text] -
Shen, J.H. and Ingraham, H.A. (2002) Regulation of the orphan nuclear receptor steroidogenic factor 1 by Sox proteins. Mol. Endocrinol., 16, 529540.
[Abstract/Free Full Text] -
de Santa Barbara, P., Bonneaud, N., Boizet, B., Desclozeaux, M., Moniot, B., Sudbeck, P., Scherer, G., Poulat, F. and Berta, P. (1998) Direct interaction of SRY-related protein SOX9 and steroidogenic factor 1 regulates transcription of the human anti-Mullerian hormone gene. Mol. Cell. Biol., 18, 66536665.
[Abstract/Free Full Text] - Shen, W.H., Moore, C.C., Ikeda, Y., Parker, K.L. and Ingraham, H.A. (1994) Nuclear receptor steroidogenic factor 1 regulates the mullerian inhibiting substance gene: a link to the sex determination cascade. Cell, 77, 651661.[CrossRef][Web of Science][Medline]
- Arango, N.A., Lovell-Badge, R. and Behringer, R.R. (1999) Targeted mutagenesis of the endogenous mouse Mis gene promoter: in vivo definition of genetic pathways of vertebrate sexual development. Cell, 99, 409419.[CrossRef][Web of Science][Medline]
-
Schlierf, B., Ludwig, A., Klenovsek, K. and Wegner, M. (2002) Cooperative binding of Sox10 to DNA: requirements and consequences. Nucl. Acids Res., 30, 55095516.
[Abstract/Free Full Text] -
Bridgewater, L.C., Walker, M.D., Miller, G.C., Ellison, T.A., Holsinger, L.D., Potter, J.L., Jackson, T.L., Chen, R.K., Winkel, V.L., Zhang, Z. et al. (2003) Adjacent DNA sequences modulate Sox9 transcriptional activation at paired Sox sites in three chondrocyte-specific enhancer elements. Nucl. Acids Res., 31, 15411553.
[Abstract/Free Full Text] - Cameron, F.J. and Sinclair, A.H. (1997) Mutations in SRY and SOX9: testis-determining genes. Hum. Mutat., 9. 388395.[CrossRef][Web of Science][Medline]
-
Kwok, C., Tyler-Smith, C., Mendonca, B.B., Hughes, I., Berkovitz, G.D., Goodfellow, P.N. and Hawkins, J.R. (1996) Mutation analysis of the 2 kb 5' to SRY in XY females and XY intersex subjects. J. Med. Genet., 33, 465468.
[Abstract/Free Full Text] - Pfeifer, D., Kist, R., Dewar, K., Devon, K., Lander, E.S., Birren, B., Korniszewski, L., Back, E. and Scherer, G. (1999) Campomelic dysplasia translocation breakpoints are scattered over 1 Mb proximal to SOX9: evidence for an extended control region. Am. J. Hum. Genet., 65, 111124.[CrossRef][Web of Science][Medline]
- Bowles, J., Schepers, G. and Koopman, P. (2000) Phylogeny of the SOX family of developmental transcription factors based on sequence and structural indicators. Dev. Biol., 227, 239255.[CrossRef][Web of Science][Medline]
-
Lillie, J.W. and Green, M.R. (1989) Transcription activation by the adenovirus E1a protein. Nature, 338, 3944.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
C T Gordon, T Y Tan, S Benko, D FitzPatrick, S Lyonnet, and P G Farlie Long-range regulation at the SOX9 locus in development and disease J. Med. Genet., October 1, 2009; 46(10): 649 - 656. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hattori, F. Coustry, S. Stephens, H. Eberspaecher, M. Takigawa, H. Yasuda, and B. de Crombrugghe Transcriptional regulation of chondrogenesis by coactivator Tip60 via chromatin association with Sox9 and Sox5 Nucleic Acids Res., May 1, 2008; 36(9): 3011 - 3024. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Guimont, F. Grondin, and C. M. Dubois Sox9-dependent transcriptional regulation of the proprotein convertase furin Am J Physiol Cell Physiol, July 1, 2007; 293(1): C172 - C183. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. C. Lynn, S. B. Smith, M. E. Wilson, K. Y. Yang, N. Nekrep, and M. S. German Sox9 coordinates a transcriptional network in pancreatic progenitor cells PNAS, June 19, 2007; 104(25): 10500 - 10505. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Sumi, N. Iehara, H. Akiyama, T. Matsubara, A. Mima, H. Kanamori, A. Fukatsu, D. J. Salant, T. Kita, H. Arai, et al. SRY-Related HMG Box 9 Regulates the Expression of Col4a2 through Transactivating Its Enhancer Element in Mesangial Cells Am. J. Pathol., June 1, 2007; 170(6): 1854 - 1864. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Wilhelm, R. Hiramatsu, H. Mizusaki, L. Widjaja, A. N. Combes, Y. Kanai, and P. Koopman SOX9 Regulates Prostaglandin D Synthase Gene Transcription in Vivo to Ensure Testis Development J. Biol. Chem., April 6, 2007; 282(14): 10553 - 10560. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Genzer and L. C. Bridgewater A Col9a1 enhancer element activated by two interdependent SOX9 dimers Nucleic Acids Res., February 28, 2007; 35(4): 1178 - 1186. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Kou and S. Ikegawa SOX9-dependent and -independent Transcriptional Regulation of Human Cartilage Link Protein J. Biol. Chem., December 3, 2004; 279(49): 50942 - 50948. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Moniot, S. Biau, S. Faure, C. M. Nielsen, P. Berta, D. J. Roberts, and P. de Santa Barbara SOX9 specifies the pyloric sphincter epithelium through mesenchymal-epithelial signals Development, August 1, 2004; 131(15): 3795 - 3804. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. R. Harley, M. J. Clarkson, and A. Argentaro The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9] Endocr. Rev., August 1, 2003; 24(4): 466 - 487. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||












