Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (34)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Rodemer, C.
Right arrow Articles by Just, W. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rodemer, C.
Right arrow Articles by Just, W. W.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2003, Vol. 12, No. 15 1881-1895
DOI: 10.1093/hmg/ddg191
© 2003 Oxford University Press

Inactivation of ether lipid biosynthesis causes male infertility, defects in eye development and optic nerve hypoplasia in mice

Claus Rodemer1, Thanh-Phuong Thai2, Britta Brugger1, Thomas Kaercher3, Hauke Werner4, Klaus-Armin Nave5, Felix Wieland1, Karin Gorgas6 and Wilhelm W. Just1,*

1Universität Heidelberg, Biochemie-Zentrum Heidelberg (BZH), 69120 Heidelberg, Germany, 2Universitätsklinik, Abteilung für Innere Medizin, 69120 Heidelberg, Germany, 3Klinikum Ludwigshafen, 67063 Ludwigshafen, Germany, 4Yale University, School of Medicine, Department of Cell Biology, New Haven, CT, USA, 5Max-Planck-Institut für Experimentelle Medizin, Abteilung Neurogenetik, 37075 Göttingen, Germany and 6Institut für Anatomie und Zellbiologie der Universität, 69120 Heidelberg, Germany

Received March 20, 2003; Accepted May 28, 2003


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Although known for almost 80 years, the physiological role of plasmalogens (PLs), the major mammalian ether lipids (ELs), is still enigmatic. Humans that lack ELs suffer from rhizomelic chondrodysplasia punctata (RCDP), a peroxisomal disorder usually resulting in death in early childhood. In order to learn more about the functions of ELs, we generated a mouse model for RCDP by a targeted disruption of the dihydroxyacetonephosphate acyltransferase gene. The mutant mice revealed multiple abnormalities, such as male infertility, defects in eye development, cataract and optic nerve hypoplasia, some of which were also observed in RCDP. Mass spectroscopic analysis demonstrated the presence of highly unsaturated fatty acids including docosahexaenoic acid (DHA) in brain PLs and the occurrence of PLs in lipid raft microdomains (LRMs) isolated from brain myelin. In mutants, PLs were completely absent and the concentration of brain DHA was reduced. The marker proteins flotillin-1 and F3/contactin were found in brain LRMs in reduced concentrations. In addition, the gap junctional protein connexin 43, known to be recruited to LRMs and essential for lens development and spermatogenesis, was down-regulated in embryonic fibroblasts of the EL-deficient mice. Free cholesterol, an important constituent of LRMs, was found in these fibroblasts to be accumulated in a perinuclear compartment. These data suggest that the EL-deficient mice allow the identification of new phenotypes not related so far to EL-deficiency (male sterility, defects in myelination and optic nerve hypoplasia) and indicate that PLs are required for the correct assembly and function of LRMs.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Plasmalogens (PLs) are by far the most abundant ether lipids (ELs). Their concentration may vary between 5%, for example, in liver and 70% of total phosphatidylethanolamine (PE) in human brain white matter (1). Although it has been speculated that PLs participate in diverse physiological processes, such as modulation of membrane fluidity, facilitation of membrane fusion, synthesis of eicosanoids, mediation of signal transduction processes and protection against oxidative stress, the in vivo function of PLs remains to be elucidated (reviewed in 1). However, other EL species than PLs exist that possess important physiological functions, among these are alkenylacyl-glycerophosphocholines (PC-PLs) (2), platelet activating factor (PAF), an alkylacetyl-glycerophosphocholine (3), the glycosyl-phosphatidylinositol (GPI)-anchor of distinct membrane proteins (4,5) as well as seminolipid, a sulfogalactosyl-alkylacylglycerol (SGalAAG) and its precursor galactosyl-alkylacylglycerol (GalAAG) (6,7).

Two enzymes, dihydroxyacetonephosphate acyltransferase (DAPAT) and alkyl dihydroxyacetonephosphate synthase (ADAPS), are involved in the synthesis of ELs forming the ether bond (8). The cellular level of ELs is affected by both peroxisome assembly disorders and single peroxisomal enzyme deficiencies, e.g. Zellweger syndrome and rhizomelic chondrodysplasia punctata (RCDP) type 1–3 (9). In Zellweger syndrome (ZS) the genetic defect is attributed to mutations of various PEX genes, such as for example PEX5 coding for the peroxisomal targeting signal 1 (PTS 1) receptor, PEX5p (10). As a consequence peroxisomal proteins imported via the PTS 1 pathway are mislocalized to the cytoplasm where they are proteolytically degraded (11). Most peroxisomal matrix proteins including DAPAT carry a PTS 1. Accordingly, ZS is distinguished by multiple peroxisomal deficiencies and model systems, such as human skin fibroblasts (SFs) from Zellweger patients or the targeted disruption of PEX5 or PEX2 in mice (1214) do not allow unequivocal assignment of the observed phenotypes to their basic molecular defects.

In RCDP type 1 the PTS 2 receptor, PEX7p, is mutationally inactivated (15). Only a small subset of peroxisomal proteins, including ADAPS, peroxisomal 3-ketoacyl-CoA thiolase, phytanic acid oxidase and mevalonate kinase, are imported via the PTS 2 pathway. Loss of the PTS 2 receptor generates a phenotype that appears to be primarily determined by the deficiency of ELs. RCDP type 2 and type 3 are characterized by the isolated deficiencies of DAPAT and ADAPS, respectively, and result in a phenotype indistinguishable from that of RCDP type 1. The major clinical manifestations of the different types of RCDP are microcephaly, psychomotor retardation, short humerus and femur, calcific stippling and cataract (9). Most RCDP patients die in early childhood (1620). Both human and animal PL-deficient cell lines reveal that ELs are not essential for the viability of single cells; for example mutant human SF cell lines grow well in culture for many generations. Most likely, this class of lipids is essential for cellular functions that govern development and organization of complex multicellular systems.

In order to gain insight into the in vivo functions of ELs, particularly PLs, we disrupted the DAPAT gene in mice. DAPAT is the key enzyme in EL biosynthesis that localizes to the luminal aspect of the peroxisomal membrane where it interacts with ADAPS (12,21). The DAPAT gene in human and mouse are similar in structure, including 16 exons, and the encoded proteins are about 80% identical (12). Here we show that the targeted disruption of the DAPAT gene causes a complex developmental phenotype in mice. Homozygous mutants are viable but infertile (males) and subfertile (females) and display phenotypic abnormalities similar to those of RCDP including developmental defects of the central nervous system (CNS), eyes, testis and others organs. In addition, evidence is provided that PLs are important constituents of lipid raft microdomains (LRMs) and that PL deficiency might result in their impaired functioning.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Generation of DAPAT-/- mice
Exons 5–7 of the mouse DAPAT gene were disrupted in R1-ES cells by homologous recombination using a DAPAT/pgk-Neo® cassette (Fig. 1A). DNA transfer into ES cells was performed by electroporation and recombinant cell clones were identified by G418 and gancyclovir® selection (Fig. 1B). Chimeric animals were generated by the implantation of C57Bl/6 blastocysts that had been injected with about six cells. Chimeras were mated with C57Bl/6 wild-type (wt) mice and DAPAT+/- heterozygous animals were obtained from 20 chimeras. These mice were backcrossed to C57Bl/6 mice to generate DAPAT+/+, DAPAT+/- and DAPAT-/- offsprings. Whereas the frequency of DAPAT+/- newborns was in the range of expected Mendelian inheritance, that of DAPAT-/- mice was consistently lower (about 15%) suggesting prenatal death of some embryos.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 1. Construction, screening and expression of DAPAT-/- transgene as well as immunologic detection of DAPAT-protein. Schematic representation of DAPAT-/- transgene construct (A), screening of ES clones (B) and PCR mouse tail DNA analysis (C) using primers for exon 5 and the neo-gene. (D) DAPAT-protein as detected by western blotting in Harderian glands of wt animals was completely absent in ko mice. Peroxisomes isolated from the Harderian gland of rabbits (hPox) were used as positive controls.

 
DAPAT+/+ and DAPAT-/- mice were identified by tail DNA analysis 2–3 days after birth and used to generate primary SF cultures (Fig. 1C). As expected, DAPAT protein was absent in these mutant cells (Fig. 1D). Whereas ADAPS activity was normal in cells of DAPAT-/- mice, there was no measurable DAPAT activity in brain, heart and SFs (Table 1).


View this table:
[in this window]
[in a new window]
 
Table 1. DAPAT activities in brain, heart and skin fibroblasts of wt and DAPAT-deficient (ko) mice
 
Homozygous mutants were viable, but displayed a marked variability in lifespan. About 40% died within the first 4–6 weeks of age, whereas others have now reached the age of 18 months. In nearly all cases, long-lived animals were females. RCDP in humans is frequently accompanied by dwarfism that also occurred in DAPAT-/- mice. Mutants were about 30–40% underweight during the first 2 weeks after birth (Fig. 2A) and this underweight was even more pronounced after 4 weeks (Fig. 2B), although controls and DAPAT-/- mutants had the same food intake. Although not as conspicuous as in RCDP, shortening of proximal limbs was also observed in the mutants (results not shown).



View larger version (27K):
[in this window]
[in a new window]
 
Figure 2. Growth retardation of DAPAT-/- mice. (A) Size comparison of wt (right) and ko mouse (left) 5 weeks after birth. (B) Weight gain of wt and ko mice during the first 4 weeks after birth. For each time point the weight of three animals was determined.

 
Brain phospholipids and LRMs
Brain tissue from wt and mutant animals was used for lipid extraction and analysis by nano-ESI-MS/MS. The major ethanolamine PL (PE-PL) species found in controls contained the alkenyl/acyl residues 34 : 2, 36 : 5, 38 : 5, 38 : 6 and 40 : 7 (Fig. 3A). All these PL species were undetectable in DAPAT-/- mice. The most abundant PE species in brain of wt animals was PE 40 : 6, whereas in the DAPAT-/- mutants it was PE 38 : 4. Thus, the loss of PL 40 : 7, which is the most abundant PL species in controls, resulted in a decrease of PE 40 : 6 and an increase in PE 38 : 4 (Fig. 3B). There were no such compensatory changes observed in the spectra recording PC and sphingomyelin (SM; Fig. 3C and E).



View larger version (35K):
[in this window]
[in a new window]
 
Figure 3. Nano-ESI-MS/MS analysis of mouse brain lipid extracts. Total brain from wt and DAPAT-/- animals was extracted and the dried extracts were dissolved in 5 mM ammonium acetate in methanol (see Materials and Methods). (A) Detection of PE and PE-PL, (B) of PE and (C) of PC. (D) Specific scanning for DHA in phosphoglycerolipids and (E) detection of SM molecular species and (F) PE-PL in lipid raft microdomains isolated from brain myelin. Lack of PLs does not change the peak intensity of other DHA containing PE species (D). Note the relative increase in PE 38 : 4 over PE 40 : 6 in the tissue of DAPAT-/- mice (A, B and F). Total number of carbon atoms and double bonds in alkenyl/acyl chains are displayed.

 
Since PLs have been reported to contain with high frequency docosahexaenoic acid (DHA) at the sn-2 position, we analyzed the brain phospholipid extracts for DHA. The most abundant DHA-containing species in wt tissue was PE 40 : 6 and about half the amount of DHA of PE 40 : 6 was found in PL 40 : 7 (Fig. 3D). In spite of the absence of PL 40 : 7 from mutant brain, there were no indications for a compensatory integration of DHA into other phospholipid species.

A recent ESI-MS analysis demonstrated that LRMs isolated from KB cells, human epidermal carcinoma cells that do not express caveolin-1, were significantly enriched in PLs, particularly in that species containing arachidonic acid (AA) (22). Since PLs are highly abundant in brain myelin, we isolated LRMs from brain myelin of controls and DAPAT-/- mutants in order to investigate their PE and PL content (Fig. 3F). In control LRM preparations, PE-PLs were the dominating species, mainly composed of PE-PL 36 : 2 and PE-PL 38 : 2. This pattern was strikingly changed in LRMs of the mutants in which, due to the complete absence of PLs, PE 38 : 4, PE 40 : 6, PE 36 : 1 and PE 34 : 1 were the major species.

These changes in the phospholipid pattern of LRMs prompted us to investigate the segregation into total brain LRMs of two proteins, flotillin-1 and F3/contactin, known markers of cerebral LRMs (23). Whereas flotillin-1 is a transmembrane protein that was originally described as a caveolae-associated protein (24), F3/contactin is a neural GPI-anchored protein of the Ig superfamily implicated in the development of the neural circuitry (25,26). Although starting from the same amount of control and mutant brain tissue and loading the same amount of LRM protein to the gradients, the concentrations of flotillin-1 and F3/contactin, determined by western blotting, were reduced by 30% in LRMs of the mutant brain (Fig. 4A and B). Furthermore, we investigated the expression of connexin (Cx) 43 and the distribution of free cholesterol in embryonic fibroblasts of controls and DAPAT-deficient mutant mice. Cx43 is a transmembrane protein known to be targeted to LRMs and to be involved in the formation of intercellular gap junctions, the regulation of cell growth and the maintenance of tissue homeostasis (27). Cx43-containing gap junctions have been shown to play important roles in spermatogenesis (28) and maintenance of lens transparency (29). Analyses by both western blotting (Fig. 4C) and immunofluorescence labeling (Fig. 4D and E) demonstrated the reduced expression of Cx43 in the DAPAT-deficient fibroblasts. Free cholesterol, one of the major lipids accumulating in LRMs and visualized by filipin staining, was found to be concentrated in a perinuclear compartment indicating severe impairment of intracellular cholesterol distribution (Fig. 4F and G).



View larger version (77K):
[in this window]
[in a new window]
 
Figure 4. Analysis of brain LRMs and embryonic fibroblasts of control (wt) and DAPAT-/- (ko) mice. (A, B) LRMs were isolated from total brain by density gradient flotation. For the preparations 100 mg wet weight of brain were homogenized and identical amounts of protein (1.54 mg) loaded onto the gradients. Fractions were analyzed for flotillin-1 and F3/contactin by western blotting and ECL detection. Protein concentrations were determined by densitometry and expressed as percentages. Cx43 expression was analyzed in embryonic fibroblasts by western blotting (C) and immunofluorescence (D, E). Fibroblast homogenates (50 µg of protein/lane) were separated by SDS–PAGE and Cx43 and ß-actin were visualized by immunoblotting. ß-actin was used as a marker for the protein load. (D, E) Immunofluorescence detection of Cx43 was carried out using mouse anti-Cx43 peptide and FITC-labeled goat anti-mouse antibodies. (F, G) Filipin staining of embryonic fibroblasts for the visualization of free cholesterol. Note the abnormal perinuclear accumulation of free cholesterol in EL-deficient fibroblasts. Bar: 20 µm.

 
Male DAPAT-/- mice are infertile
Mating male and female homozygous mutants with appropriate wt partners suggested that male DAPAT-/- mice were infertile. Wt and mutant newborns did not show major differences in the histological characteristics of their testes, although apoptotic cells did occur more frequently in the seminiferous epithelium of DAPAT-/- mice. In adult mutants, testes were atrophic and the epididymis devoid of spermatozoa. Semithin cross-sections of testis revealed a 40% decrease in the average diameter of seminiferous tubules (STs) exhibiting reduction and disorganization of the multilayered seminiferous epithelium as well as partial arrest and apoptosis of pachytene spermatocytes (Fig. 5A–C). Multinucleated giant cells were present at different apoptotic stages and contained up to 30 nuclei depending on the meiotic progress and localization within the disorganized epithelium (Fig. 5D and E). Together with the complete absence of mature spermatozoa and elongated spermatids these observations suggest that the spermatogenic arrest occurred between pachytene primary spermatocytes and the stage of round spermatids.



View larger version (182K):
[in this window]
[in a new window]
 
Figure 5. Semithin sections of wt (A, C, F) and DAPAT-/- (B, D, E, G, H) testes. Whereas in wt mice (A, C) the multilayered epithelium of STs contains the entire complement of spermatogenic cells, in mutant STs (B, D, E) epithelial disorganization is accompanied by variable apoptotic stages visible in the population of primary spermatocytes. Most notably, elongated spermatids and mature spermatozoa are completely absent and multinucleated giant cells become dominating. Spermatogonia (SG) and vacuolated Sertoli cells (S) are the predominant cells types constituting the disorganized seminiferous epithelium (B, E). In controls (F), the lamina propria is composed of a continuous layer of flat elongated myoid cells separated by a rather thin basal lamina from both STs and the endothelium of lymphatic capillary. In DAPAT-/- mice (G, H), the lamina propria progressively increases age-dependently in thickness. Proliferation of myoid cells correlates with thickening of basement membranes (arrows). (A–G) Three-month-old mice and (H) 10-month-old mouse. Methylene blue–Azur II stain. Bars: 100 µm (A, B) and 20 µm (C–H).

 
Corresponding to the impaired spermatogenesis, an age-dependent thickening of the lamina propria was observed in the mutants. Proliferation of myoid cells correlated with an increase in thickness of the basement membranes of STs, myoid cells and lymphatic capillaries (Fig. 5F–H). In contrast to controls, the intertubular space of the mutant testis was occupied by proliferating Leydig cell clusters of all developmental stages (Fig. 5A and B).

When bred to wt males, only one of seven homozygous females became pregnant. However, the two siblings died at birth. Mutant ovaries were smaller in size but displayed intact folliculogenesis showing primary, secondary and tertiary follicles. Development of the oocyte, zona pellucida, granulosa and theca interna (Fig. 6A), as well as formation of corpus rubrum (Fig. 6B) and corpora lutea, appeared normal confirming that ovulation occurs in the absence of ELs. Secondary and tertiary follicles as well as corpora lutea and glassy membranes were reduced in number, indicating female subfertility.



View larger version (136K):
[in this window]
[in a new window]
 
Figure 6. Semithin sections of DAPAT-/- ovary. (A) DAPAT-/- mutants (6 months old) show normal folliculogenesis but an increased number of atretic follicles (arrow marks the apoptotic oocyte). Secondary follicles exhibit intact theca, granulosa and zona pellucida. Formation of corpus rubrum in the mutant ovary (B, 10 months old) corresponds to that in controls. Bars: 50 µm (A) and 100 µm (B).

 
Ocular anomalies
Ophthalmologic examination of nine DAPAT-/- mice elicited distinct developmental eye defects resulting in microphthalmia with an about 20% reduction in eye diameter, dysgenesis of the anterior eye chamber and bilateral central dense cataract (Fig. 7A). At both the anterior and equatorial poles, the lens epithelium appeared strikingly disorganized. Anterior lenticonus adhering to the corneal endothelium was the most conspicuous anomaly observed (Fig. 7B). Towards the lens equator impaired epithelial cell differentiation and fiber formation resulted in a multilayered cell sheath mainly composed of undifferentiated precursor cells lacking parallel orientation (Fig. 7C and E). The epithelial layers migrated up to the posterior pole covering the posterior suture. They were frequently disrupted by large vacuoles (Fig. 7C and D). Compared with controls, the thickness of the lens capsule at the anterior and posterior poles was increased in mutants 2- and 3-fold, respectively. In addition, disarrangement of lens core fibers containing crystalline aggregates favored cataractogenesis. Most animals showed anterior and posterior synechias, i.e. iris attachments to both the corneal endothelium and the anterior lens surface (Fig. 7A) caused by persistent vascular remnants of the pupillary membrane. Pigment cells and pigment-loaded macrophages were also frequently found at the surface of the anterior lenticonus (Fig. 7B) and in the trabecular meshwork of the irido-corneal angle, similarly as described for the iris pigment dispersion syndrome (30).



View larger version (141K):
[in this window]
[in a new window]
 
Figure 7. Thick microslicer section and semithin sections of the eye. Thick microslicer section of mutant eye bulb showing the entire lens (A) reveals microphthalmia, anterior lenticonus, lens attachment to the corneal endothelium, irregular pupil, posterior synechia, iris pigment dispersion on the lens surface (see arrows in B), lens deformation and cataract. At the lenticonus (B), lens capsule is remarkably increased in thickness and lens epithelial cells form a highly disorganized stellate cellular meshwork (see also arrow in C). In contrast to controls (E), at lens equator mutant lens (C) shows severe defects in epithelial cell organization, fiber differentiation and maturation. Focal disruptions are paralleled by formation of large vacuoles. Lens epithelial cells continue to migrate along the thickened capsule to the posterior pole (D), resulting in lens fiber swelling and vacuole formation at the posterior suture. Bars: 200 µm (A), 50 µm (B, C, E) and 30 µm (D).

 
Retinal architecture of mutant mice revealed minor alterations that were predominantly confined to the pigment epithelium demonstrating vacuolation, hypo- and hyperplasia, hypo- and hyperpigmentation as well as accumulation of photoreceptor degradation products. The basement membrane (Bruch's membrane) was increased in thickness by about 40% (data not shown). Moreover, several observations indicated optic nerve hypoplasia in mutants: (i) a nearly 20% reduction in diameter of the optic nerve head proportional to microphthalmia (Fig. 8A and B); (ii) a nearly 40% increase in the length of the non-myelinated portion of the optic nerve (Fig. 8A and B); (iii) the frequent appearance of abnormally dilated retinal ganglion cell axons (exceeding 20 µm in diameter) predominantly situated at the nerve periphery (Fig. 8D, arrow); and (iv) a nearly 50% decrease in diameter of the myelinated portion of the optic nerve. This reduction was mainly due to a 55% reduction in the numerical density of large axonal profiles (exceeding a diameter of 1.5 µm), as verified by morphometric analysis (Fig. 8E and F).



View larger version (170K):
[in this window]
[in a new window]
 
Figure 8. Semithin sections of the posterior eye bulb. Compared with controls (A), regression of the hyaloid artery is incomplete in the mutant eye (C). The optic nerve head is covered by an elongated fibro-vascular, funnel-shaped structure (Bergmeister's papilla) extending with numerous fine strands to the posterior pole of the lens (C). Posterior to the scleral canal, the unmyelinated segment of the optic nerve is reduced in diameter and enhanced in length in mutants (B) compared with controls (A). In addition, the diameter of the myelinated portion of the optic nerve is more than proportionally decreased (arrows in A and B mark the first myelinated axons). Remarkable axon swelling is observed in the transition zone (D, arrow) suggesting axon degeneration and optic nerve atrophy. Cross-sections through the myelinated segment show a distinct decrease in the number of large axon profiles in mutants (F) compared with controls (E). Bars: 100 µm (A–C), 30 µm (D) and 20 µm (E, F).

 
A striking feature of the adult mutant eye was a persistent hyaloid artery (Bergmeister's papilla) that exceeded a length of 400 µm, corresponding to a 4-fold increase in length compared with controls (Fig. 8C; evaluated by serial sectioning). Although the persisting hyaloid artery remained connected by fibrils and hyalocytes to the posterior lens capsule, no remnants of the tunica vasculosa lentis were visible, suggesting a defective remodeling of the primary to the secondary vitreous body.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Mammalian ELs
PLs are by far the most abundant ELs in mammalian tissues. However, as mentioned at the beginning, other EL species, such as PC-PLs, PAF, the GPI-anchor of numerous membrane proteins and SGalAAG (seminolipid) do occur, raising the question as to the individual contribution of each of these molecules to the overall DAPAT-/- phenotype. Although most tissues contain PE-PLs as the major PL species, some tissues, such as cardiac tissue, are particularly rich in PC-PLs. In the human heart, for example, about 40% of total PC is PC-PL (2). The reason for that is not clear, however it has been demonstrated that PE-PLs but not PC-PLs have a high tendency at or below 30°C to adopt a non-bilayer structure known to facilitate membrane fusion events (22). Thus, subtle differences in the structure of PLs might have important influences on the physical properties of membranes.

PAF, a potent bioactive EL, is considered to constitutively regulate physiological processes, such as neural development, hippocampal long-term potentiation, blood pressure, reproduction as well as anaphylaxis and endotoxic shock (for review see 3). Studies in mice lacking a functional PAF receptor have unexpectedly shown that PAF plays a dominant role only in eliciting anaphylaxis. Moreover, PAF receptor-deficient mice were fertile, develop normally and were as sensitive to endotoxins as wt animals (31). Thus, PAF deficiency might not significantly contribute to the DAPAT-/- phenotype.

An additional major characteristic of PLs is their high content of polyunsaturated fatty acids, such as DHA and AA that both occur in high concentrations in brain and retina. As seen by mass spectroscopical analysis, relatively large amounts of brain DHA were incorporated into PLs and were missing in the DAPAT-/- tissue (Fig. 3D). Correspondingly, the level of both PLs and DHA was drastically reduced in brain tissue of patients with peroxisomal disorders (32), confirming that DHA deficiency is a predominant defect in the CNS of these patients. Release of AA might be mediated by a PL-selective phospholipase A2 and released AA and AA-derived eicosanoids might participate in intra- and extracellular signaling processes (33). In contrast to AA, the role of DHA is less well understood. However, the benefits of long-chain polyunsaturated fatty acids, currently under discussion, at least in part, may be attributed to their incorporation into PLs (34).

Numerous mammalian proteins, e.g. human placental alkaline phosphatase, human erythrocyte acetylcholinesterase, aminopeptidase, folate receptor and neural F3/contactin, are anchored to membranes via a GPI structure. GPI-anchoring has been attributed to processes, such as endocytic sorting, transmembrane signaling and clathrin-independent endocytosis (reviewed in 4,5). Since the lipid anchor in many mammalian GPI-anchored proteins is 1-alkyl-2-acylglycerol, its synthesis should be dependent on the peroxisomal pathway of EL biosynthesis. Studies on human placental alkaline phosphatase suggested an alternative pathway of ether bond formation (35), although substantial evidence for its existence is lacking.

A major proposed function of PLs is their protective activity against reactive oxygen species. This view was mainly derived from experiments demonstrating UV-induced photosensitized killing of PL-deficient CHO and murine macrophage-like cells following incorporation of pyrenedodecanoic acid into membrane lipids (36). Exposure of these cells to long wavelength UV light was supposed to generate reactive oxygen species (singlet oxygen) and/or radicals. Although there is evidence that PL deficiency in cultured cells increases their sensitivity against lipid peroxyl radicals, the underlying chemical mechanism for the stabilization of PL radicals is unclear. Stabilization of these radicals, however, is essential that PLs act as radical scavengers. Studies in human SFs of control and PL-deficient patients as well as in vivo studies in these patients failed to show any evidence for PLs to play a major role in protection against oxidative stress (37,38). The DAPAT-deficient mouse might be a valuable model system to clarify the existing discrepancies.

PLs are constituents of LRMs
GPI anchoring not only serves the firm membrane attachment of proteins, but is also a means to sort and concentrate the anchored proteins into specialized membrane areas called LRMs. For most of these proteins sorting into LRMs has been demonstrated to be essential for functioning. LRMs are membrane microdomains particularly enriched in cholesterol and glycosphingolipids and, as in the case of caveolae, contain caveolin-1 as an essential structural component (reviewed in 39). Membranes may also contain LRMs not associated with caveolin-1. They are isolated by low-temperature detergent extraction and gradient flotation and the proteins that segregate into these LRMs are of considerable functional heterogeneity including signaling molecules and receptors (4045), junction and adhesion molecules (28,46,47) and enzymes (4).

As shown in the present paper, detergent-resistant membranes isolated from brain myelin contain PE-PLs. It is interesting to note that in lipid extracts of both total brain and LRMs prepared from brain myelin of DAPAT-/- mice, PE 38 : 4 is the dominating species (Fig. 3A, B and F). Thus, lack of PLs might be compensated for by an increase in PE 38 : 4. Moreover, studies using human epidermal carcinoma cells that either express or do not express caveolin-1 have shown that LRMs isolated by a non-detergent method compared with the plasma membrane fractions were enriched in cholesterol, sphingomyelin and AA-containing PE-PLs (22). Further evidence for the important role of PLs in assembly and function of LRMs was provided by a comparative analysis of the recruitment of flotillin-1 and F3/contactin to brain LRMs of control and EL-deficient mice. Flotillin-1 is an integral membrane protein abundantly expressed in brain and frequently used as a biochemical marker of neural LRMs (23). F3/contactin is a neural GPI-anchored cell adhesion molecule known to interact with paranodin, a neural transmembrane protein, and to guide it to LRMs at the cell surface, a process important for the correct formation of the nodes of Ranvier (25,48). The concentration of both flotillin-1 and F3/contactin was significantly reduced in LRMs of the EL-deficient mice suggesting that the lack of ELs affects the composition and possibly also the function of LRMs (Fig. 4A and B). Along this line are the results demonstrating the reduced expression of Cx43 in DAPAT-deficient fibroblasts (Fig. 4C and E) and the impaired cellular distribution of cholesterol (Fig. 4F and G), a major lipid constituent of LRMs. Several connexin family members including Cx43 have been shown to be targeted to LRMs and to interact with caveolin-1. Caveolin-1 acts as a scaffolding protein to cluster lipids, particularly cholesterol, and signaling molecules within LRMs (49). Although the mechanism by which EL+ deficiency affects the expression level of Cx43 is unknown, various factors have been described that influence Cx43 expression. Among these are some protooncogenes, such as Src, Ras and Neu that alter regulation of gap junctions and Cx43 (5052). Activated c-Src, for example, stimulates Cx43 phosphorylation reducing gap junctional communication and the level of Cx43 (50). Similarly PDGF, a strong inhibitor of intercellular communication via gap junctions, causes rapid junctional interruption and the concomitant phosphorylation of Cx43 involving protein kinase C and the mitogen-activated protein kinase (53). Phosphorylation of Cx43 is believed to be causally linked with the disruption of gap junctional communication (54). Interestingly with respect to the observed phenotypes in the DAPAT-deficient mouse, Cx43 plays a dominant role in both lens development (29) and spermatogenesis (28) (see below).

Our observation that EL-deficient fibroblasts showed impaired intracellular cholesterol distribution was consistent with previous results in human SFs of patients with RCDP type 2 and type 3 also demonstrating cholesterol accumulations in an endosomal/lysosomal compartment and the impaired formation of caveolae and clathrin-coated pits (12). Impaired cholesterol transport was recently also observed in PL-depleted CHO cells (55). In these cells transport of cholesterol from an endosomal compartment or the plasma membrane to the endoplasmic reticulum was defective. These results strongly suggest that PLs are important constituents of LRMs and that the lack of PLs affects both the sequestration of proteins into LRMs and the maintainance of intracellular cholesterol homeostasis. The latter aspect was further supported by observations demonstrating that both chondrodysplasia punctata and cataract, major clinical phenotypes of RCDP, were also manifested in human disorders with defects in late cholesterol biosynthesis, such as Conradi–Hünermann–Happel syndrome and Smith–Lemmli–Opitz syndrome (56).

EL deficiency causes spermatogenic arrest
The detailed histological analysis of DAPAT-/- testis revealed the presence of normal spermatogonia and early primary spermatocytes. Late primary spermatocytes exhibited severe degeneration including the frequent appearance of multinucleated giant cells suggesting arrest of spermatogenesis between the stages of pachytene primary spermatocytes and round spermatids (Fig. 5). DAPAT deficiency is not the only lipid deficiency eliciting this phenotype. In addition, three other targeted deletions of lipid synthesizing enzymes were described, all resulting in an early arrest of spermatogenesis and the complete absence of spermatozoa. In mammalian testes and spermatozoa, SGalAAG (seminolipid) is the principle glycolipid comprising ~3% of total lipids and more than 90% of total boar spermatozoa (reviewed in 6,7). In the early phase of spermatocyte development synthesis of SGalAAG rapidly increases and the level is maintained in subsequent germ cell stages. SGalAAG in humans, although not detected in testes of infants of prepubertal age, is highest at 40 years and decreases drastically above 70 years. Synthesis of the SGalAAG precursor GalAAG is catalyzed by UDP-galactose : ceramide galactosyltransferase (CGT) and SGalAAG is synthesized by cerebroside sulfotransferase (CST). Both the CGT-/- (5759) and the CST-/- (60) mouse revealed a phenotype in testis rather similar to that seen in the DAPAT-/- mutant. The CGT-/- mouse, besides GalAAG, was also unable to synthesize galactosylceramide (GalCer), the major myelin galactolipid, galactosylsphingosine (psychosine) and galactosyldiacylglycerol (GalDAG), whereas the CST-/- mouse failed to synthesize both galactosylceramide-3-sulfate (SGalCer) and SGalAAG. The fact that SGalAAG is the predominant sulfolipid in testis (6,7) suggested that the defects in spermatogenesis of the CST-/- mouse were related to the lack of the EL SGalAAG rather than the sphingolipid SGalCer. This in turn indicates that the spermatogenic arrest in the DAPAT-/- mutant is at least in part due to the lack of GalAAG and particularly SGalAAG.

The GM2/GD2 synthase deficient (GM2/GD2-/-) mouse is lacking the enzyme ß 1,4-N-acetylgalactosaminyltransferase, a key enzyme in the biosynthesis of complex gangliosides (belonging to the sialo-ganglio series). These mice were unable to synthesize GM2, GD2 and their more complex derivatives (61). Considering that the targeted deletion of GM2/GD2 synthase and Cx43 led to a phenotype in testis close to that seen in the DAPAT-deficient mouse, lack of seminolipid and/or its precursor GalAAG might not be the only cause of defective spermatogenesis in the DAPAT-/- mutants. Although affecting a different branch of glycolipids, the complex sialogangliosides, the phenotype of GM2/GD2-/- and DAPAT-/- mice is strikingly similar. Provided that a functional relationship exists between complex gangliosides and ELs, they might converge on a common cellular platform which we hypothesize might be the glycosphingolipid- and cholesterol-enriched LRMs. Furthermore, gap junctional communication also plays a dominant role in spermatogenesis. Cx43 is expressed in several cell types in testis including Sertoli cells, Leydig cells and spermatogonia/spermatocytes and its targeted deletion caused a ‘Sertoli cell-only’ phenotype similarly to that seen in the DAPAT-/- mutants (28).

PLs and ocular anomalies
Ocular manifestations in DAPAT-/- mice included microphthalmia, cataract, anterior lenticonus, persistent hyaloid artery and alterations in retinal pigment epithelium (Figs 7 and 8). Various gap junctional proteins including Cx43, Cx46 and Cx50 are expressed in the eye. Individual mutations in these proteins were found in lenses of cataract patients and the targeted deletion of Cx46 and Cx50 has been shown to result in impaired lens homeostasis favoring cataract (62). Moreover, it was proposed that in the lens Cx43 phosphorylation led to its destabilization and proteasome-dependent degradation (29). Direct interaction has also been demonstrated between Cx43 and the tight-junction-associated protein zonula occludens-1 (ZO-1), v- and c-Src and ß-catenin (6365), suggesting that Cx43 is part of a complex that includes both signaling and scaffolding molecules.

Anterior lenticonus, as we observed it in the DAPAT-/- mutants, is rarely described in the literature but is a hallmark in the Alport syndrome, a familial nephritis. In the X-linked form, mutations were found in COL(IV){alpha}5. Within the lens capsule and Bruch's membrane, COL(IV){alpha}5, forms a collagen network and, by the expression of abnormal COL(IV){alpha}5, it becomes destabilized, leading to structural alterations and thickening of the basement membrane (66,67). Analogous to the lens, thickening of the basement membrane was also observed in STs of DAPAT-/- testis (Fig. 5F–H). In this tissue, tumor necrosis factor (TNF) {alpha} activation of Sertoli cells induced expression and secretion of COL(IV), metalloprotease-9 and tissue inhibitor of metalloprotease-1 regulating tight junction dynamics behind the blood–testis barrier (68). Interestingly, TNF{alpha} receptor was localized to both LRMs and the trans Golgi complex and loss of the ability to become targeted to LRMs following mutagenesis was paralleled by functional deactivation (41). Since most of the proteins discussed are topologically related to LRMs, the functions of these proteins may be dependent on the presence of PLs and be impaired by their lack in the DAPAT-/- tissue. Thus, it is tempting to speculate that a major function of PLs might be to act as an essential constituent of LRMs.

ELs and optic nerve hypoplasia
The major alterations seen in the optic nerve of the DAPAT-/- mutants were the reduced diameter of the nerve head, the appearance of dilated retinal ganglion cell axons as well as the increased length of the non-myelinated and the decreased diameter of the myelinated portion of the nerve (Fig. 8A and B). These structural alterations are indicative of optic nerve hypoplasia and distinct deficits in myelination. In particular, the increase in length of the non-myelinated portion of the nerve suggests that the complex processes involved in axon–oligodendrocyte interaction at the paranode rather than within the compact myelin are affected by EL deficiency. This view is favored by the reduced amount of F3/contactin recovered from cerebral LRMs of the mutants, most likely reflecting the reduced amount of LRMs isolated. A recent model for the function of F3/contactin at the paranode proposed the intracellular interaction of neuronal F3/contactin with paranodin (contactin-associated protein) to be necessary for translocating the complex to the paranodal axolemma. Deficiency of ELs, therefore, might affect translocation to the axolemma and/or sorting of the complex to axolemmal LRMs.

Proliferation and survival of oligodendrocytes is regulated by PDGF-A (69). The corresponding receptor switches from mitogen to survival function by sequestering into GM1 containing LRMs that provide a favorable signaling environment (70). Intriguingly, the PDGF-A-/- mouse exhibits severe defects in oligodendrogenesis and also spermatogenesis (71). The greatest loss of both myelin and PDGF-A receptor progenitors was observed in the optic nerve, cerebellar white matter and thoracic spinal cord (72). Alterations in cerebral structures were also seen in the peroxisome-deficient PEX2-/- Zellweger mouse (14). The phenotypes described were altered cerebellar foliate patterning, loss of Purkinje cells and neuronal migration defects. Possibly due to the multiple defects generated by the PEX2 deletion, phenotypes different to that of DAPAT-/- mice were observed.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cloning and disruption of the murine DAPAT gene
The full-length mouse DAPAT cDNA was used to screen PAC clones with the total genomic mmDNA. Positive clones were sequenced to get the full genomic DAPAT sequence (12). The targeting vector designed to eliminate the DNA sequence between the introns 4 and 7 of the DAPAT gene was generated by cloning PCR products into the CWKO vector as 5'- and 3'-flanking regions of the pgk-Neo® cassette (73). For the 5'-region the primers VA6s (5'-ctcggatccACGGTGACAGAAAACATCTGGGCAGTACCC-3') and VA6as (5'- gagggtaccGGCAAGGCAACATGACAACACTGTCAGAGG-3'), covering parts of intron 4, were used. The resulting 1.2 kb product was cloned into the BamHI and KpnI sites of the vector. For the 3'-region the primers HA2s (5'-ctcgtcgacGATTTCCTTTGAGTATAGAGAATACCCTGG-3') and HA2as (5'-cacgtcgac CTTCCAACTCTAGACCTCTACGTGGTCAGG-3'), covering intron 7 and exons 8–10, were used. The 5 kb product was cloned into the SalI site of the targeting construct. A 100 µg sample of the vector was linearized with AscI and introduced into 6.5x106 R1-ES cells by electroporation. Transfected cells were double selected by neomycin (250 µg/ml) and ganciclovir (0.2 µm) and resistant clones obtained 7–9 days after transfection as described (74). Targeted clones were identified by nested PCR using the primers VA11s (CTGGCTTTCCTCCCCATGGCTTGTTCAGCC) and neo1as (GCCTCTCCACCCAAGCGGCCGGAGAACCTGCGTGC). Homologous recombination was identified in four out of 300 clones, and one of the four clones was used for injection into blastocysts of C57BL/6 mice. Chimeric mice were mated with C57BL/6 mice and offsprings tested for germline transmission by PCR. Homozygous DAPAT-/- mice were obtained by mating F1 heterozygous animals and F2 offsprings genotyped by PCR.

PCR analysis
Nested PCR of ES cells and genomic tail DNA of heterozygous, wt and ko animals was carried out using the primers VA16 (CAATCAGTGAGGGCGGGACCTGGAGCAGGA), Neo10as (GCTGACAGCCG GAACACGGCGGCATCAGAG), ex7-1s (CGATACCTACTTTGTCCCAATTAGC) and HA5as (GCTGGTCTCAAACAGCTACGTAGCTGA). About 0.1 µg DNA, 20 pmol of each primer in reaction buffer and Taq/Pwo polymerase (Thermohybaid, Heidelberg, Germany) were used in a total volume of 50 µl. After 3 min denaturation at 95°C, PCR was performed using 35 cycles at 94°C for 30 s and 68°C for 4 min followed by a final extension at 68°C for 2 min, resulting in a 2 kb product for the recombinant and a 3 kb product for the wt gene. For the primers Ex7 and HA5 elongation time was shortened to 1 min at 72°C resulting in a 650 bp product for the wt gene and a 860 bp product for the recombinant DAPAT gene. PCR products were analyzed by agarose gel electrophoresis.

Biochemical assays
DAPAT activity was assayed as described (12,75). Brain and heart of wt and knockout (ko) mice were directly solubilized in solu-chaps (Sigma, Munich). For measuring DAPAT activity in fibroblasts, a 15 cm confluent dish was washed with PBS and the cells scraped off using 0.25 M sucrose, containing 10 mM glycylglycine pH 7.4. After pelleting, the cells were solubilized in solu-chaps and subjected to sonication (12,75). Protein content of solubilized material was determined by the Bradford assay (Biorad, Munich).

Myelin and detergent-resistant lipid microdomains from total brain and myelin and were prepared as described (25,76). Lipid extraction from brain tissue was performed according to the method of Bligh and Dyer (77). After solvent evaporation, samples were resuspended in methanol and further processed for mass spectrometry as described (78). ESI-MS/MS analysis was performed on a Micromass QII triple-stage quadrupol tandem mass spectrometer equipped with a nano-ESI source (Z spray; Micromass). Argon was used as collision gas at a nominal pressure of 2–3x10-3 mbar. Usually the cone voltage was set to 30 eV. Resolution of Q1 and Q3 was set to achieve isotope resolution. For detecting distinct phospholipid species the following MS parameters were used: PC and SM—positive precursor ion scanning mode, selection of phosphocholine ion (m/z 184), 32 eV collision energy; SM—negative precursor ion mode, selection for dimethyl phosphoethanolamine anion (m/z 168), 35 eV collision energy and 100 eV cone voltage; PE—neutral loss scanning in positive mode, selection for neutral phosphoethanolamine (m/z 141), 30 eV collision energy; PE and PE-PL—negative precursor ion scanning mode, selection for the dilyso-PE–H2O fragment (m/z 196), 50 eV collision energy; docosahexaenoyl-containing phosphoglycerolipids—negative precursor ion mode, selection for docosahexaenoate anion (m/z 327), 50 eV collision energy.

Histological analysis
Mice were anesthetized by phenobarbital and subsequently perfused via either the left ventricle or the abdominal aorta. The fixative used for perfusion contained 1.5% paraformaldehyde, 1.5% glutaraldehyde, 2.5% polyvinylpyrrolidone dissolved in either PBS or 0.1 M cacodylate pH 7.4. Organs were removed and 80–1200 µm thick sections prepared by using a Dosaka-microslicer. Cytochemical staining, postfixation with 1–2% osmium tetroxide, and embedding in Epon or Araldite of the tissue samples was carried out as described (79). Serial semithin sections (0.5–1 µm) were stained with a modified Richardson solution (methylene blue–Azur II).

Morphometric analysis
The numerical density of axon profiles in the myelinated portion of the optic nerve was determined using semithin sections. All axon profiles exceeding a diameter of 1.5 µm were counted on three cross-sections of each of two animals.

Cell culture and immunofluorescence
DAPAT+/+ and DAPAT-/- embryonic fibroblasts were isolated from E13.5 embryos by removing head and limbs and incubation of the remaining carcasses for 10 min in 0.5% trypsin at 37°C. Cells were grown in DMEM with 10% FCS in a humified CO2 incubator at 37°C and used at passage numbers P4–5.

For immunofluorescence, cells were plated on coverslips. Briefly subconfluent cells were washed twice with PBS, fixed with 3% paraformaldehyde and permeabilized with 1% Triton X-100. Cells were incubated for 30 min at 37°C with antibodies against Cx43 (Dianova, Hamburg) in PBS–1% BSA. After washing the FITC-coupled secondary antibodies (Sigma, Munich) were applied. Cells were washed again and mounted using moviol/paraphenylendiamine. Staining was visualized in a Zeiss-LSM laser scanning microscope (Zeiss, Goettingen).

For cholesterol staining embryonal fibroblasts were grown on coverslips and incubated 30 min with 25 µg/ml filipin (Sigma, Munich) in PBS at room temperature. After washing, the cells were fixed with 3% paraformaldehyde and mounted using moviol. Micrographs were taken with a Zeiss Axiovert Microscope using a DAPI filter.

Immunoblotting was carried out as previously described (75). Briefly, an aliquot of the LRM fraction following acetone precipitation was solubilized in sample buffer and subjected to SDS–PAGE. Proteins were transblotted onto PVDF membranes. After blocking with 5% non-fat dry milk in PBS/0.05% Tween20 the blots were processed with anti-flotillin-1 (76) and anti-F3/contactin (25) antiserum. Horseradish peroxidase-conjugated secondary antibodies (Dianova, Hamburg) were used to visualize the proteins by chemiluminescence.


    ACKNOWLEDGEMENTS
 
We would like to thank Dr C. H. Westphal (MIT, Boston, MA) and Dr A. Nagy (Mount Sinai Hospital, Toronto) for the generous gift of the CWKO-vector and the mouse ES cell clone, respectively, and Dr J. Ortiz-Lechner for reading the manuscript. The technical assistance of Ingrid Kuhn-Krause, Ursula Wald and Jutta Worsch is acknowledged.


    FOOTNOTES
 
* To whom correspondence should be addressed at: Biochemie-Zentrum der Universität, Im Neuenheimer Feld 328, D-69120 Heidelberg, Germany. Tel: +49 6221544151; Fax: +49 6221544366; Email: wilhelm.just{at}urz.uni-heidelberg.de Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Nagan, N. and Zoeller, R.A. (2001) Plasmalogens: biosynthesis and functions. Prog. Lipid Res., 40, 199–229.[CrossRef][Web of Science][Medline]

  2. Diagne, A., Fauvel, J., Record, M., Chap, H. and Douste-Blazy, L. (1984) Studies on ether phospholipids. II. Comparative composition of various tissues from human, rat and guinea pig. Biochim. Biophys. Acta, 793, 221–231.[Medline]

  3. Montrucchio, G., Alloatti, G. and Camussi, G. (2000) Role of platelet-activating factor in cardiovascular pathophysiology. Physiol. Rev., 80, 1669–1699.[Abstract/Free Full Text]

  4. Hooper, N.M. (1997) Glycosyl–phosphatidylinositol anchored membrane enzymes. Clin. Chim. Acta, 266, 3–12.[CrossRef][Web of Science][Medline]

  5. Chatterjee, S. and Mayor, S. (2001) The GPI-anchor and protein sorting. Cell Mol. Life Sci., 58, 1969–1987.[CrossRef][Web of Science][Medline]

  6. Vos, J.P., Lopes-Cardozo, M. and Gadella, B.M. (1994) Metabolic and functional aspects of sulfogalactolipids. Biochim. Biophys. Acta, 1211, 125–149.[Medline]

  7. Ishizuka, I. (1997) Chemistry and functional distribution of sulfoglycolipids. Prog. Lipid Res., 36, 245–319.[CrossRef][Web of Science][Medline]

  8. Hajra, A.K. (1995) Glycerolipid biosynthesis in peroxisomes (microbodies). Prog. Lipid Res., 34, 343–364.[CrossRef][Web of Science][Medline]

  9. Moser, H.W. (2000) Molecular genetics of peroxisomal disorders. Front. Biosci., 5, D298–306.[Web of Science][Medline]

  10. Subramani, S., Koller, A. and Snyder, W.B. (2000) Import of peroxisomal matrix and membrane proteins. A. Rev. Biochem., 69, 399–418.[CrossRef][Web of Science][Medline]

  11. Heikoop, J.C., van Roermund, C.W., Just, W.W., Ofman, R., Schutgens, R.B., Heymans, H.S., Wanders, R.J. and Tager, J.M. (1990) Rhizomelic chondrodysplasia punctata. Deficiency of 3-oxoacyl-coenzyme A thiolase in peroxisomes and impaired processing of the enzyme. J. Clin. Invest., 86, 126–130.[Web of Science][Medline]

  12. Thai, T.P., Rodemer, C., Jauch, A., Hunziker, A., Moser, A., Gorgas, K. and Just, W.W. (2001) Impaired membrane traffic in defective ether lipid biosynthesis. Hum. Mol. Genet., 10, 127–136.[Abstract/Free Full Text]

  13. Baes, M., Gressens, P., Baumgart, E., Carmeliet, P., Casteels, M., Fransen, M., Evrard, P., Fahimi, D., Declercq, P.E., Collen, D. et al. (1997) A mouse model for Zellweger syndrome. Nat. Genet., 17, 49–57.[CrossRef][Web of Science][Medline]

  14. Faust, P.L., Su, H.M., Moser, A. and Moser, H.W. (2001) The peroxisome deficient PEX2 Zellweger mouse: pathologic and biochemical correlates of lipid dysfunction. J. Mol. Neurosci., 16, 289–297; discussion 317–321.[CrossRef][Web of Science][Medline]

  15. Kunau, W.H. (2001) Peroxisomes: the extended shuttle to the peroxisome matrix. Curr. Biol., 11, R659–662.[CrossRef][Web of Science][Medline]

  16. Clayton, P.T., Eckhardt, S., Wilson, J., Hall, C.M., Yousuf, Y., Wanders, R.J. and Schutgens, R.B. (1994) Isolated dihydroxyacetonephosphate acyltransferase deficiency presenting with developmental delay. J. Inherit. Metab. Disord., 17, 533–540.[CrossRef][Web of Science][Medline]

  17. Hebestreit, H., Wanders, R.J., Schutgens, R.B., Espeel, M., Kerckaert, I., Roels, F., Schmausser, B., Schrod, L. and Marx, A. (1996) Isolated dihydroxyacetonephosphate-acyl-transferase deficiency in rhizomelic chondrodysplasia punctata: clinical presentation, metabolic and histological findings. Eur. J. Pediatr., 155, 1035–1039.[CrossRef][Web of Science][Medline]

  18. Elias, E.R., Mobassaleh, M., Hajra, A.K. and Moser, A.B. (1998) Developmental delay and growth failure caused by a peroxisomal disorder, dihydroxyacetonephosphate acyltransferase (DHAP-AT) deficiency. Am. J. Med. Genet., 80, 223–226.[CrossRef][Web of Science][Medline]

  19. Powers, J.M., Kenjarski, T.P., Moser, A.B. and Moser, H.W. (1999) Cerebellar atrophy in chronic rhizomelic chondrodysplasia punctata: a potential role for phytanic acid and calcium in the death of its Purkinje cells. Acta Neuropathol. (Berl.), 98, 129–134.[CrossRef][Medline]

  20. Wanders, R.J. (1999) Peroxisomal disorders: clinical, biochemical, and molecular aspects. Neurochem. Res., 24, 565–580.[CrossRef][Web of Science][Medline]

  21. de Vet, E.C, Ijlst, L., Oostheim, W., Dekker, C., Moser, H.W., van Den Bosch, H. and Wanders, R.J. (1999) Ether lipid biosynthesis: alkyl-dihydroxyacetonephosphate synthase protein deficiency leads to reduced dihydroxyacetonephosphate acyltransferase activities. J. Lipid Res., 40, 1998–2003.[Abstract/Free Full Text]

  22. Pike, L.J., Han, X., Chung, K.N. and Gross, R.W. (2002) Lipid rafts are enriched in arachidonic acid and plasmenylethanolamine and their composition is independent of caveolin-1 expression: a quantitative electrospray ionization/mass spectrometric analysis. Biochemistry, 41, 2075–2088.[CrossRef][Medline]

  23. Kokubo, H., Lemere, C.A. and Yamaguchi, H. (2000) Localization of flotillins in human brain and their accumulation with the progression of Alzheimer's disease pathology. Neurosci. Lett., 290, 93–96.[CrossRef][Web of Science][Medline]

  24. Bickel, P.E., Scherer, P.E., Schnitzer, J.E., Oh, P., Lisanti, M.P. and Lodish, H.F. (1997) Flotillin and epidermal surface antigen define a new family of caveolae-associated integral membrane proteins. J. Biol. Chem., 272, 13793–13802.[Abstract/Free Full Text]

  25. Kramer, E.M., Klein, C., Koch, T., Boytinck, M. and Trotter, J. (1999) Compartmentation of Fyn kinase with glycosylphosphatidylinositol-anchored molecules in oligodendrocytes facilitates kinase activation during myelination. J. Biol. Chem., 274, 29042–29049.[Abstract/Free Full Text]

  26. Boyle, M.E., Berglund, E.O., Murai, K.K., Weber, L., Peles, E. and Ranscht, B. (2001) Contactin orchestrates assembly of the septate-like junctions at the paranode in myelinated peripheral nerve. Neuron, 30, 385–397.[CrossRef][Web of Science][Medline]

  27. Goodenough, D.A., Goliger, J.A. and Paul, D.L. (1996) Connexins, connexons, and intercellular communication. A. Rev. Biochem., 65, 475–502.[CrossRef][Web of Science][Medline]

  28. Roscoe, W.A., Barr, K.J., Mhawi, A.A., Pomerantz, D.K. and Kidder, G.M. (2001) Failure of spermatogenesis in mice lacking connexin43. Biol. Reprod., 65, 829–838.[Abstract/Free Full Text]

  29. Girao, H. and Pereira, P. (2003) Phosphorylation of connexin 43 acts as a stimuli for proteasome-dependent degradation of the protein in lens epithelial cells. Mol. Vis., 9, 24–30.[Web of Science][Medline]

  30. Chang, B., Smith, R.S., Hawes, N.L., Anderson, M.G., Zabaleta, A., Savinova, O., Roderick, T.H., Heckenlively, J.R., Davisson, M.T. and John, S.W. (1999) Interacting loci cause severe iris atrophy and glaucoma in DBA/2J mice. Nat. Genet., 21, 405–409.[CrossRef][Web of Science][Medline]

  31. Ishii, S. and Shimizu, T. (2000) Platelet-activating factor (PAF) receptor and genetically engineered PAF receptor mutant mice. Prog. Lipid Res., 39, 41–82.[CrossRef][Web of Science][Medline]

  32. Martinez, M. and Mougan, I. (1999) Fatty acid composition of brain glycerophospholipids in peroxisomal disorders. Lipids, 34, 733–740.[CrossRef][Web of Science][Medline]

  33. Ford, D.A. and Gross, R.W. (1989) Plasmenylethanolamine is the major storage depot for arachidonic acid in rabbit vascular smooth muscle and is rapidly hydrolyzed after angiotensin II stimulation. Proc. Natl Acad. Sci. USA, 86, 3479–3483.[Abstract/Free Full Text]

  34. Nordoy, A., Marchioli, R., Arnesen, H. and Videbaek, J. (2001) n-3 polyunsaturated fatty acids and cardiovascular diseases. Lipids, 36 (suppl.), S127–129.

  35. Singh, N., Zoeller, R.A., Tykocinski, M.L., Lazarow, P.B. and Tartakoff, A.M. (1994) Addition of lipid substituents of mammalian protein glycosylphosphoinositol anchors. Mol. Cell. Biol., 14, 21–31.[Abstract/Free Full Text]

  36. Zoeller, R.A., Morand, O.H. and Raetz, C.R. (1988) A possible role for plasmalogens in protecting animal cells against photosensitized killing. J. Biol. Chem., 263, 11590–11596.[Abstract/Free Full Text]

  37. Jansen, G.A. and Wanders, R.J. (1997) Plasmalogens and oxidative stress: evidence against a major role of plasmalogens in protection against the superoxide anion radical. J. Inherit. Metab. Disord., 20, 85–94.[CrossRef][Web of Science][Medline]

  38. Wanders, R.J., Jansen, G.A., van Roermund, C.W., Denis, S., Schutgens, R.B. and Jakobs, B.S. (1996) Metabolic Aspects of Peroxisomal Disorders. New York Academy of Science, New York.

  39. Brown, D.A. and London, E. (1998) Structure and origin of ordered lipid domains in biological membranes. J. Membr. Biol., 164, 103–114.[CrossRef][Web of Science][Medline]

  40. Ko, Y.G., Lee, J.S., Kang, Y.S., Ahn, J.H. and Seo, J.S. (1999) TNF-alpha-mediated apoptosis is initiated in caveolae-like domains. J. Immunol., 162, 7217–7223.[Abstract/Free Full Text]

  41. Cottin, V., Doan, J.E. and Riches, D.W. (2002) Restricted localization of the TNF receptor CD120a to lipid rafts: a novel role for the death domain. J. Immunol., 168, 4095–4102.[Abstract/Free Full Text]

  42. Razani, B., Zhang, X.L., Bitzer, M., von Gersdorff, G., Bottinger, E.P. and Lisanti, M.P. (2001) Caveolin-1 regulates transforming growth factor (TGF)-beta/SMAD signaling through an interaction with the TGF-beta type I receptor. J. Biol. Chem., 276, 6727–6738.[Abstract/Free Full Text]

  43. Mineo, C., Gill, G.N. and Anderson, R.G. (1999) Regulated migration of epidermal growth factor receptor from caveolae. J. Biol. Chem., 274, 30636–30643.[Abstract/Free Full Text]

  44. Davy, A., Feuerstein, C. and Robbins, S.M. (2000) Signaling within a caveolae-like membrane microdomain in human neuroblastoma cells in response to fibroblast growth factor. J. Neurochem., 74, 676–683.[CrossRef][Web of Science][Medline]

  45. Citores, L., Wesche, J., Kolpakova, E. and Olsnes, S. (1999) Uptake and intracellular transport of acidic fibroblast growth factor: evidence for free and cytoskeleton-anchored fibroblast growth factor receptors. Mol. Biol. Cell, 10, 3835–3848.[Abstract/Free Full Text]

  46. Nusrat, A., Parkos, C.A., Verkade, P., Foley, C.S., Liang, T.W., Innis-Whitehouse, W., Eastburn, K.K. and Madara, J.L. (2000) Tight junctions are membrane microdomains. J. Cell Sci., 113 (Pt 10), 1771–1781.[Abstract]

  47. Lee, N.P., Mruk, D., Lee, W.M. and Cheng, C.Y. (2003) Is the cadherin/catenin complex a functional unit of cell-cell actin-based adherens junctions in the rat testis? Biol. Reprod., 68, 489–508.[Abstract/Free Full Text]

  48. Faivre-Sarrailh, C., Gauthier, F., Denisenko-Nehrbass, N., Le Bivic, A., Rougon, G. and Girault, J.A. (2000) The glycosylphosphatidyl inositol-anchored adhesion molecule F3/contactin is required for surface transport of paranodin/contactin-associated protein (caspr). J. Cell Biol., 149, 491–502.[Abstract/Free Full Text]

  49. Schubert, A.L., Schubert, W., Spray, D.C. and Lisanti, M.P. (2002) Connexin family members target to lipid raft domains and interact with caveolin-1. Biochemistry, 41, 5754–5764.[CrossRef][Medline]

  50. Zhou, L., Kasperek, E.M. and Nicholson, B.J. (1999) Dissection of the molecular basis of pp60(v-src) induced gating of connexin 43 gap junction channels. J. Cell Biol., 144, 1033–1045.[Abstract/Free Full Text]

  51. Carystinos, G.D., Kandouz, M., Alaoui-Jamali, M.A. and Batist, G. (2003) Unexpected induction of the human connexin 43 promoter by the ras signaling pathway is mediated by a novel putative promoter sequence. Mol. Pharmac., 63, 821–831.[Abstract/Free Full Text]

  52. Jou, Y.S., Layhe, B., Matesic, D.F., Chang, C.C., de Feijter, A.W., Lockwood, L., Welsch, C.W., Klaunig, J.E. and Trosko, J.E. (1995) Inhibition of gap junctional intercellular communication and malignant transformation of rat liver epithelial cells by neu oncogene. Carcinogenesis, 16, 311–317.[Abstract/Free Full Text]

  53. Hossain, M.Z., Jagdale, A.B., Ao, P., Kazlauskas, A. and Boynton, A.L. (1999) Disruption of gap junctional communication by the platelet-derived growth factor is mediated via multiple signaling pathways. J. Biol. Chem., 274, 10489–10496.[Abstract/Free Full Text]

  54. Lau, A.F., Kurata, W.E., Kanemitsu, M.Y., Loo, L.W., Warn-Cramer, B.J., Eckhart, W. and Lampe, P.D. (1996) Regulation of connexin43 function by activated tyrosine protein kinases. J. Bioenerg. Biomembr., 28, 359–368.[CrossRef][Web of Science][Medline]

  55. Munn, N.J., Arnio, E., Liu, D., Zoeller, R.A. and Liscum, L. (2003) Deficiency in ethanolamine plasmalogen leads to altered cholesterol transport. J. Lipid Res., 44, 182–192.[Abstract/Free Full Text]

  56. Nwokoro, N.A., Wassif, C.A. and Porter, F.D. (2001) Genetic disorders of cholesterol biosynthesis in mice and humans. Mol. Genet. Metab., 74, 105–119.[CrossRef][Web of Science][Medline]

  57. Bosio, A., Binczek, E. and Stoffel, W. (1996) Functional breakdown of the lipid bilayer of the myelin membrane in central and peripheral nervous system by disrupted galactocerebroside synthesis. Proc. Natl Acad. Sci. USA, 93, 13280–13285.[Abstract/Free Full Text]

  58. Coetzee, T., Fujita, N., Dupree, J., Shi, R., Blight, A., Suzuki, K. and Popko, B. (1996) Myelination in the absence of galactocerebroside and sulfatide: normal structure with abnormal function and regional instability. Cell, 86, 209–219.[CrossRef][Web of Science][Medline]

  59. Fujimoto, H., Tadano-Aritomi, K., Tokumasu, A., Ito, K., Hikita, T., Suzuki, K. and Ishizuka, I. (2000) Requirement of seminolipid in spermatogenesis revealed by UDP-galactose: ceramide galactosyltransferase-deficient mice. J. Biol. Chem., 275, 22623–22626.[Abstract/Free Full Text]

  60. Honke, K., Hirahara, Y., Dupree, J., Suzuki, K., Popko, B., Fukushima, K., Fukushima, J., Nagasawa, T., Yoshida, N., Wada, Y. et al. (2002) Paranodal junction formation and spermatogenesis require sulfoglycolipids. Proc. Natl Acad. Sci. USA, 99, 4227–4232.[Abstract/Free Full Text]

  61. Takamiya, K., Yamamoto, A., Furukawa, K., Zhao, J., Fukumoto, S., Yamashiro, S., Okada, M., Haraguchi, M., Shin, M., Kishikawa, M. et al. (1998) Complex gangliosides are essential in spermatogenesis of mice: possible roles in the transport of testosterone. Proc. Natl Acad. Sci. USA, 95, 12147–12152.[Abstract/Free Full Text]

  62. White, T.W. (2002) Unique and redundant connexin contributions to lens development. Science, 295, 319–320.[Abstract/Free Full Text]

  63. Giepmans, B.N. and Moolenaar, W.H. (1998) The gap junction protein connexin43 interacts with the second PDZ domain of the zona occludens-1 protein. Curr. Biol., 8, 931–934.[CrossRef][Web of Science][Medline]

  64. Giepmans, B.N., Hengeveld, T., Postma, F.R. and Moolenaar, W.H. (2001) Interaction of c-Src with gap junction protein connexin-43. Role in the regulation of cell–cell communication. J. Biol. Chem., 276, 8544–8549.[Abstract/Free Full Text]

  65. Ai, Z., Fischer, A., Spray, D.C., Brown, A.M. and Fishman, G.I. (2000) Wnt-1 regulation of connexin43 in cardiac myocytes. J. Clin. Invest., 105, 161–171.[Web of Science][Medline]

  66. Colville, D.J. and Savige, J. (1997) Alport syndrome. A review of the ocular manifestations. Ophthal. Genet., 18, 161–173.[Web of Science][Medline]

  67. Chen, L., Miyamura, N., Ninomiya, Y. and Handa, J.T. (2003) Distribution of the collagen IV isoforms in human Bruch's membrane. Br. J. Ophthal., 87, 212–215.[Abstract/Free Full Text]

  68. Siu, M.K., Lee, W.M. and Cheng, C.Y. (2003) The interplay of collagen IV, tumor necrosis factor-alpha, gelatinase B (matrix metalloprotease-9), and tissue inhibitor of metalloproteases-1 in the basal lamina regulates Sertoli cell-tight junction dynamics in the rat testis. Endocrinology, 144, 371–387.[Abstract/Free Full Text]

  69. Noble, M., Murray, K., Stroobant, P., Waterfield, M.D. and Riddle, P. (1988) Platelet-derived growth factor promotes division and motility and inhibits premature differentiation of the oligodendrocyte/type-2 astrocyte progenitor cell. Nature, 333, 560–562.[CrossRef][Medline]

  70. Baron, W., Decker, L., Colognato, H. and Ffrench-Constant, C. (2003) Regulation of integrin growth factor interactions in oligodendrocytes by lipid raft microdomains. Curr. Biol., 13, 151–155.[CrossRef][Web of Science][Medline]

  71. Mariani, S., Basciani, S., Arizzi, M., Spera, G. and Gnessi, L. (2002) PDGF and the testis. Trends Endocrinol. Metab., 13, 11–17.[CrossRef][Web of Science][Medline]

  72. Fruttiger, M., Karlsson, L., Hall, A.C., Abramsson, A., Calver, A.R., Bostrom, H., Willetts, K., Bertold, C.H., Heath, J.K., Betsholtz, C. et al. (1999) Defective oligodendrocyte development and severe hypomyelination in PDGF-A knockout mice. Development, 126, 457–467.[Abstract]

  73. Westphal, C.H. and Leder, P. (1997) Transposon-generated ‘knock-out’ and ‘knock-in’ gene-targeting constructs for use in mice. Curr. Biol., 7, 530–533.[CrossRef][Web of Science][Medline]

  74. Forss-Petter, S., Werner, H., Berger, J., Lassmann, H., Molzer, B., Schwab, M.H., Bernheimer, H., Zimmermann, F. and Nave, K.A. (1997) Targeted inactivation of the X-linked adrenoleukodystrophy gene in mice. J. Neurosci. Res., 50, 829–843.[CrossRef][Web of Science][Medline]

  75. Thai, T.P., Heid, H., Rackwitz, H.R., Hunziker, A., Gorgas, K. and Just, W.W. (1997) Ether lipid biosynthesis: isolation and molecular characterization of human dihydroxyacetonephosphate acyltransferase. FEBS Lett., 420, 205–211.[CrossRef][Web of Science][Medline]

  76. Gkantiragas, I., Brugger, B., Stuven, E., Kaloyanova, D., Li, X.Y., Lohr, K., Lottspeich, F., Wieland, F.T. and Helms, J.B. (2001) Sphingomyelin-enriched microdomains at the Golgi complex. Mol. Biol. Cell, 12, 1819–1833.[Abstract/Free Full Text]

  77. Bligh, E.G. and Dyer, W.J. (1959) A rapid method of total lipid extraction and purification. Can. J. Biochem. Physiol., 37, 911–917.

  78. Brugger, B., Erben, G., Sandhoff, R., Wieland, F.T. and Lehmann, W.D. (1997) Quantitative analysis of biological membrane lipids at the low picomole level by nano-electrospray ionization tandem mass spectrometry. Proc. Natl Acad. Sci. USA, 94, 2339–2244.[Abstract/Free Full Text]

  79. Gorgas, K. (1984) Peroxisomes in sebaceous glands. V. Complex peroxisomes in the mouse preputial gland: serial sectioning and three-dimensional reconstruction studies. Anat. Embryol. (Berl.), 169, 261–270.[CrossRef][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
GlycobiologyHome page
N. Goto-Inoue, T. Hayasaka, N. Zaima, and M. Setou
The specific localization of seminolipid molecular species on mouse testis during testicular maturation revealed by imaging mass spectrometry
Glycobiology, September 1, 2009; 19(9): 950 - 957.
[Abstract] [Full Text] [PDF]


Home page
NeuroscientistHome page
M. Baes and P. Aubourg
Peroxisomes, Myelination, and Axonal Integrity in the CNS
Neuroscientist, August 1, 2009; 15(4): 367 - 379.
[Abstract] [PDF]


Home page
Hum Mol GenetHome page
A. Teigler, D. Komljenovic, A. Draguhn, K. Gorgas, and W. W. Just
Defects in myelination, paranode organization and Purkinje cell innervation in the ether lipid-deficient mouse cerebellum
Hum. Mol. Genet., June 1, 2009; 18(11): 1897 - 1908.
[Abstract] [Full Text] [PDF]


Home page
BrainHome page
P. Brites, P. A. W. Mooyer, L. el Mrabet, H. R. Waterham, and R. J. A. Wanders
Plasmalogens participate in very-long-chain fatty acid-induced pathology
Brain, February 1, 2009; 132(2): 482 - 492.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
R. E. Gimeno and J. Cao
Thematic Review Series: Glycerolipids. Mammalian glycerol-3-phosphate acyltransferases: new genes for an old activity
J. Lipid Res., October 1, 2008; 49(10): 2079 - 2088.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
J. C. DeMar Jr., C. DiMartino, A. W. Baca, W. Lefkowitz, and N. Salem Jr.
Effect of dietary docosahexaenoic acid on biosynthesis of docosahexaenoic acid from alpha-linolenic acid in young rats
J. Lipid Res., September 1, 2008; 49(9): 1963 - 1980.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
L. Hulshagen, O. Krysko, A. Bottelbergs, S. Huyghe, R. Klein, P. P. Van Veldhoven, P. P. De Deyn, R. D'Hooge, D. Hartmann, and M. Baes
Absence of Functional Peroxisomes from Mouse CNS Causes Dysmyelination and Axon Degeneration
J. Neurosci., April 9, 2008; 28(15): 4015 - 4027.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
A. Nenicu, G. H Luers, W. Kovacs, M. Bergmann, and E. Baumgart-Vogt
Peroxisomes in Human and Mouse Testis: Differential Expression of Peroxisomal Proteins in Germ Cells and Distinct Somatic Cell Types of the Testis
Biol Reprod, December 1, 2007; 77(6): 1060 - 1072.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
C. D. Akpovi, S. R. Yoon, M. L. Vitale, and R-M. Pelletier
The predominance of one of the SR-BI isoforms is associated with increased esterified cholesterol levels not apoptosis in mink testis
J. Lipid Res., October 1, 2006; 47(10): 2233 - 2247.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. Huyghe, H. Schmalbruch, K. De Gendt, G. Verhoeven, F. Guillou, P. P. Van Veldhoven, and M. Baes
Peroxisomal Multifunctional Protein 2 Is Essential for Lipid Homeostasis in Sertoli Cells and Male Fertility in Mice
Endocrinology, May 1, 2006; 147(5): 2228 - 2236.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Sandhoff, R. Geyer, R. Jennemann, C. Paret, E. Kiss, T. Yamashita, K. Gorgas, T. P. Sijmonsma, M. Iwamori, C. Finaz, et al.
Novel Class of Glycosphingolipids Involved in Male Fertility
J. Biol. Chem., July 22, 2005; 280(29): 27310 - 27318.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
Y. Zhang, Y. Hayashi, X. Cheng, T. Watanabe, X. Wang, N. Taniguchi, and K. Honke
Testis-specific sulfoglycolipid, seminolipid, is essential for germ cell function in spermatogenesis
Glycobiology, June 1, 2005; 15(6): 649 - 654.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
D. Liu, N. Nagan, W. W. Just, C. Rodemer, T.-P. Thai, and R. A. Zoeller
Role of dihydroxyacetonephosphate acyltransferase in the biosynthesis of plasmalogens and nonether glycerolipids
J. Lipid Res., April 1, 2005; 46(4): 727 - 735.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
X. Cheng, Y. Zhang, N. Kotani, T. Watanabe, S. Lee, X. Wang, I. Kawashima, T. Tai, N. Taniguchi, and K. Honke
Production of a Recombinant Single-Chain Variable-Fragment (scFv) Antibody against Sulfoglycolipid
J. Biochem., March 1, 2005; 137(3): 415 - 421.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (34)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Rodemer, C.
Right arrow Articles by Just, W. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rodemer, C.
Right arrow Articles by Just, W. W.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?