Human Molecular Genetics Advance Access originally published online on July 15, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Human Molecular Genetics, 2003, Vol. 12, No. 17 2153-2165
DOI: 10.1093/hmg/ddg231
© 2003 Oxford University Press
Monosomy 1p36 breakpoint junctions suggest pre-meiotic breakagefusionbridge cycles are involved in generating terminal deletions
1Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX 77030, USA and 2Health Research and Education Center, Washington State University, Spokane, WA 99210, USA
Received April 24, 2003; Accepted July 5, 2003
| ABSTRACT |
|---|
|
|
|---|
Terminal deletions of 1p36 result in a mental retardation syndrome that is presumably caused by haploinsufficiency of a number of genes. Although monosomy 1p36 is the most commonly observed terminal deletion syndrome in humans, the molecular mechanism(s) that generates and stabilizes terminal deletions of 1p36 is not completely understood. Our previous molecular analysis of a large cohort of monosomy 1p36 subjects demonstrated that deletion sizes vary widely from
1 Mb to >10.5 Mb in the most distal portion of 1p36 with no single common breakpoint. In this report, we have identified the precise breakpoint junctions in three subjects with apparently pure terminal deletions of 1p36 ranging from 2.5 to 4.25 Mb. These junctions revealed one deletion to be stabilized by telomeric repeat sequences and two to have terminal deletions associated with cryptic interrupted inverted duplications at the ends of the chromosomes. These interrupted inverted duplication/deletion breakpoints are reminiscent of those seen in tumor cell lines that have undergone breakagefusionbridge (BFB) cycles leading to gene amplification. We propose a pre-meiotic model for the formation of these deletions in which a terminally deleted chromosome is generated in the germ line and passes through at least one BFB cycle to produce gametes with terminal deletions associated with interrupted inverted duplications. These data suggest that, on a molecular level, seemingly pure terminal deletions visualized cytogenetically may be more complex, and BFB cycles may play an important role in generating terminal deletions associated with genetic disease in humans. | INTRODUCTION |
|---|
|
|
|---|
Terminal deletions are one of the most commonly observed structural chromosome abnormalities detected by routine chromosome analysis. Telomeric deficiencies result in several well-known mental retardation and multiple congenital anomaly syndromes including monosomy 1p36 (1p-), WolfHirschhorn (4p-), Cri-du-chat (5p-), MillerDieker (17p-), 18q- and 22q-. In addition, cryptic telomeric abnormalities undetectable at the level of the light microscope have recently emerged as a major, yet previously under-recognized, cause of mental retardation (reviewed in 1). Although terminal deletions have been described for every human chromosome, the molecular mechanism(s) that generates and stabilizes terminal deletions is not understood.
Telomeres are specialized proteinDNA complexes that play critical roles in the replication of linear chromosome ends and the prevention of chromosome fusions (reviewed in 2,3). Chromosomes that lose a telomere due to improper telomere maintenance or by a double-strand break near the telomere must acquire a new telomeric cap to be structurally stable. Over 50 years ago, McClintock first demonstrated in maize that chromosomes that have lost their telomeres form end-to-end fusions that are subsequently broken by passage of the newly formed dicentric chromosome through mitosis (4,5). This chromosome instability is perpetuated as a result of repeated breakagefusionbridge (BFB) cycles during each cell division until a stable telomeric cap is obtained. Recently, telomere loss followed by BFB cycles has been shown to play an important role in chromosome instability and gene amplification during cancer progression (610). However, to our knowledge, BFB cycles have not yet been demonstrated to play a role in generating constitutional chromosome rearrangements resulting in human genetic disease.
Terminal deletions of 1p36 occur in
1 in 5000 live births, making it the most frequently observed terminal deletion and one of the most commonly occurring mental retardation syndromes in humans (11). Monosomy 1p36 results in a clinically recognizable syndrome characterized by distinct facial features, mental retardation, seizures, hearing impairment, growth failure and cardiac defects (12,13). Monosomy 1p36 is considered a contiguous gene deletion syndrome presumably caused by haploinsufficiency of a number of different genes.
We recently generated a minimal tiling path contig of the most distal 10.5 Mb of 1p36 and reported the molecular characterization of 60 subjects with monosomy 1p36 (13). Microsatellite and fluorescence in situ hybridization (FISH) analyses revealed that deletion sizes vary widely over the 10.5 Mb of 1p36 with no single common breakpoint. In addition, FISH using telomere region-specific probes identified terminal deletions, interstitial deletions, complex rearrangements, and derivative chromosomes. Furthermore, we recently developed a human 1p36 comparative genomic hybridization (CGH) microarray and demonstrated its utility in rapidly and precisely characterizing deletion sizes and subtelomeric aneusomy in subjects with monosomy 1p36 (14). The heterogeneity in the location of the breakpoints and the types of rearrangements identified illustrates the challenges associated with identifying mechanisms for these diverse rearrangements. However, we anticipate that sequence information from the breakpoint junctions of various terminal deletions will help to elucidate the underlying mechanism(s) involved in generating this relatively common class of deletions. Given that 1p36 deletions are relatively common and, like other terminal deletions, have breakpoints occurring in multiple locations over several megabases, monosomy 1p36 is likely to be a valuable model for investigating the molecular basis of terminal deletions.
Here we report the identification of the precise breakpoint junctions for three subjects with varying-sized terminal deletions of 1p36. Sequence analysis at the junctions indicates that one terminal deletion was a pure terminal truncation stabilized by telomeric repeat sequences. Junction sequences from two additional subjects identified terminal deletions associated with cryptic interrupted inverted duplications at the ends of the chromosomes. These breakpoint sequences are identical in structure to those found in embryonic stem (ES) cell lines (15) and tumor cell lines (16) that have gone through BFB cycles in which uncapped sister chromatids are fused by non-homologous end joining (NHEJ). Array-based comparative genomic hybridization (array CGH) using a human 1p36-targeted BAC microarray suggests that one of the inverted duplications extends more than 750 kb from the breakpoint junction, whereas the other extends less than 100 kb from the breakpoint junction. We propose a pre-meiotic origin for the formation of these two terminal deletions, with interrupted inverted duplications generated by passage of a broken chromosome through at least one BFB cycle. This suggests that BFB cycles can play an important role in the generation of terminal deletions of 1p36 and possibly in other telomeric deletions and constitutional chromosome rearrangements.
| RESULTS |
|---|
|
|
|---|
Breakpoint mapping
Previous molecular studies using FISH with genomic clones and microsatellite markers located within the most distal 10.5 Mb of 1p36 indicated that all three of the cases in this study were maternally derived, apparently pure terminal deletions with deletion sizes ranging from 2.5 to 4.25 Mb (13). Based on our previous FISH and microsatellite analyses, we localized the breakpoint in each of these three subjects to within a large-insert clone or between two overlapping clones (13). To simplify experiments to refine the breakpoints further, we generated a somatic cell hybrid cell line that carried the chromosome 1 with the deletion, segregated from the normal chromosome 1, for each of these three subjects. This enabled us to use a systematic approach to progressively narrow each deletion breakpoint by PCR and STS marker walking. Because the genomic clones within which the breakpoints are located have been completely sequenced, STS markers that spanned the length of the clones were easily selected for use in PCR. Because the normal chromosomes 1 were not present in the hybrid cell lines, PCR amplification of an STS marker from the DNA of each hybrid indicated retention of that locus, whereas no amplification indicated deletion. Multiple rounds of marker walking identified 1 kb regions for each of the three subjects within which each breakpoint junction was located (Figs 1A and B, 2A and B, and 3A and B).
|
|
|
Breakpoint junction analysis identifies a terminal truncation stabilized by telomeric repeats
Based on the hypothesis that these three apparently pure terminal deletions were true terminal truncations stabilized by telomeric repeat sequences, we used a telomere-anchored PCR strategy to attempt to amplify across the junctions (17). To accomplish this, we used a unique sequence forward primer located only a few hundred base pairs from the putative breakpoint and a reverse primer complementary to the telomeric (TTAGGG)n repeat sequence. For subject 23, specific PCR products were generated only from the subject's genomic DNA and DNA extracted from the hybrid cell line carrying the chromosome 1 with the deletion (Fig. 1C). No amplification was obtained from parental DNA controls. Sequence analysis of these PCR products identified unique 1p36 sequence onto which pure (TTAGGG)n telomeric repeats had been added (Fig. 1D). Although the full length of this novel telomere is not known, at least 11 pure (TTAGGG)n telomeric repeats were sequenced at this junction. This suggests that subject 23 has a pure terminal truncation stabilized by the acquisition of telomeric repeat sequences. Repeated attempts to amplify across the junctions in hybrids derived from subjects 30 and 40 using telomere-anchored PCR failed, perhaps indicating that telomeric repeats were not adjacent to the breakpoints in these subjects.
Breakpoint junction analysis identifies two terminal deletions associated with interrupted inverted duplications
Failure to amplify junction fragments by telomere-anchored PCR in hybrids derived from cell lines of subjects 30 and 40 suggested that sequences other than pure (TTAGGG)n telomeric repeats may be located distal to the 1p36 breakpoints. Therefore, we used a restriction digest and Southern blot approach to identify novel junction fragments unique to the subject's genomic DNA. In case 40, an NcoI digest and Southern blot with a unique sequence probe designed from known sequence just proximal to the breakpoint identified an
1.4 kb fragment in the subject along with the expected
1.9 kb fragment (Fig. 2B and C). In case 30, a DrdI digest and Southern blot identified an
3.2 kb novel junction fragment in the subject along with the expected
3.6 kb fragment (Fig 3B and C). Parental controls identified only the
1.9 kb fragment in case 40 (Fig. 2C) and the
3.6 kb fragment in case 30 (Fig. 3C), suggesting that the observed
3.2 kb fragment in case 30 and the
1.4 kb fragment in case 40 are specific to the chromosome 1 containing the deletion in each of the subjects and that they contain the breakpoint junction.
Sequence analysis of the junction fragment from subject 40 (see Materials and Methods) revealed that the distal 1p36 breakpoint was followed by an inverted duplication of 1p36 sequences originating 1.8 kb proximal to the deletion breakpoint (Fig. 2D and F). PCR using primers flanking the breakpoint junction (Fig. 2D and E) confirmed this interrupted inverted duplication junction to be specific to subject 40 with a de novo deletion. For subject 30, sequence from the
3.2 kb junction fragment (see Materials and Methods) indicated that an interrupted inverted duplication was also present at the breakpoint of this deletion (Fig. 3D and F). The inverted duplication originated 1.7 kb proximal to the deletion breakpoint in subject 30 and was also confirmed to be specific to the de novo deletion in subject 30 by PCR (Fig. 3D and E).
Array CGH clarifies the extent of the interrupted inverted duplications
Sequence analysis and PCR experiments at the junctions in subjects 30 and 40 demonstrated the presence of interrupted inverted duplications. However, the size of the duplicated segments was still not clearly defined. To determine more precisely the size of the duplications, we performed array CGH with cell lines derived from subjects 30 and 40 using a previously assembled microarray of 1p36 (14). The array includes 97 large-insert clones that represent a minimal tiling path contig of the most distal 10.5 Mb of 1p36. Array CGH was performed as previously described to identify gains or losses within a particular region of 1p36 (14). For subject 30, array CGH not only correctly identified the size of the 1p36 deletion but also clearly detected a single-copy gain of an
750 kb region proximal to the terminal deletion breakpoint (Fig. 4A and B). This relatively large cryptic inverted duplication was confirmed by interphase FISH analysis using a clone within the duplicated region of 1p36 (Fig. 4C). However, for subject 40, array CGH correctly identified the size of the deletion but did not detect a gain proximal to the deletion breakpoint (data not shown). We repeated the array CGH for this subject under high-stringency hybridization conditions and obtained identical results in both experiments. This suggests that the interrupted inverted duplication in subject 40 is likely to be smaller than the length of the large-insert clone containing the breakpoint (<100 kb) because array CGH did not detect either a gain or a loss of the breakpoint-containing clone.
|
| DISCUSSION |
|---|
|
|
|---|
Terminal deletions of 1p36 are representative of a class of constitutional chromosome abnormalities that, based on routine chromosome analysis, appear to be simple terminal truncations of the chromosome. However, this study and other recent reports show that cytogenetically defined terminal deletions may actually include a variety of simple and complex rearrangements that are not distinguishable at the resolution provided by the light microscope (1820). Our molecular studies of cytogenetically defined terminal deletions of 1p36 have confirmed terminal deletions, including at least one case of a pure terminal truncation, but have also identified interstitial deletions, derivative chromosomes, complex rearrangements, and now inverted duplications (13,20).
Two major questions are associated with understanding the molecular basis of cytogenetically defined terminal deletions. First, how are terminal deletions generated? Second, how are terminal deletions stabilized? However, the generation and stabilization of terminal deletions are not necessarily mutually exclusive. For example, a terminal deletion may be generated and stabilized by illegitimate recombination between two non-homologous telomeric regions resulting in the formation of a derivative chromosome in a single step. Yet when considering the possible mechanism(s) of terminal deletion formation, it can be useful to regard generation and stabilization as two independent events.
All ends of human chromosomes must have a telomeric cap to be structurally stable (reviewed in 2,3). Therefore, two general processes exist by which broken chromosomes such as terminal deletions can acquire this cap. First is the stabilization of a terminal deletion by the de novo addition of telomeric repeats onto the end of a broken chromosome by the enzyme telomerase. This process is known as telomere healing and has been reported in at least 11 terminal deletion cases (17,2125) and in human tumor cell lines (15), mouse ES cells (26), and other model organisms (2730). The second general process by which a broken chromosome can be stabilized is through the acquisition of telomeric sequences from another chromosome. This process is known as telomere capture and could potentially occur between sister chromatids, homologs, or non-homologous chromosome ends. The result of a telomere capture event is a derivative chromosome. A number of terminal deletions, including 1p-, appear to have been stabilized (and/or generated) by capturing a telomere from another chromosome (13,20,3135). Some interstitial deletions may also have arisen from a broken chromosome capturing a telomere from a sister chromatid or homologous chromosome.
Other examples of telomere capture could also include terminal truncations stabilized by telomeric repeats obtained by telomerase-independent mechanisms (17,36,37). Broken chromosomes stabilized by acquisition of telomeric sequences from another chromosome end could appear virtually identical to ones stabilized by telomere healing by telomerase. However, in support of telomere healing by telomerase, pure (TTAGGG)n telomeric repeat sequences have been found at the sites of healing, as opposed to variant telomeric repeats that are commonly found in the proximal telomeric region of existing telomeres (this study, 17,2125,38,39). The lack of variant repeats is consistent with de novo addition but is not definitive because more than half of an existing telomere's 220 kb sequence consists of pure telomeric repeats (38,39). However, using an in vitro assay system, human telomerase was shown to preferentially recognize the sequence at the breakpoint of one 16p terminal truncation and to add (TTAGGG)n telomeric repeat sequences (40).
Breakpoint analysis has been useful in elucidating the molecular mechanism(s) by which terminal deletions and other constitutional chromosome abnormalities were formed (4143). However, when dealing with terminal deletions, the observed site of healing (junction) may be at a different location than the actual breakpoint because an unprotected terminal deletion may have been subjected to exonucleolytic degradation before obtaining a telomeric cap. However, studies of induced double-strand breaks near telomeres in yeast and mammalian cells suggest that degradation is minimal and generally less than 100 bp, although sites of healing up to 10 kb away from the original breakpoint have been observed (15,16,4447). Therefore, degradation at the site of the breakpoint is not likely to be responsible for the extreme variability in deletion sizes observed in monosomy 1p36, which range from
1 to >10.5 Mb. But because of this possibility, we have used junction to describe the site of healing or rearrangement rather than breakpoint in many places in this report.
To date, there have been only four other cases reported of de novo terminal deletions stabilized by telomeric repeat sequences (2224). However, seven other cases of telomere healing have been reported that were not de novo events but were healed terminal truncations stably transmitted through the germ line (17,21,25). In this study, we report an additional case of a de novo terminal truncation stabilized by the addition of pure (TTAGGG)n telomeric repeat sequences. Sequence analysis of all five de novo breakpoints (this study, 2224) indicates that they are generally located within repeat-rich regions of the genome, yet there is no sequence homology or common sequence motif located within 1 kb of these breakpoints. In fact, the precise breakpoints appear to have occurred within non-repetitive, unique sequences within these repetitive regions. However, the precise sites of healing cannot be determined in four of five cases because they have one to four nucleotides in frame with the (TTAGGG)n telomeric repeat tract (Fig. 1D) (2224). Although this makes it impossible to identify the precise site of healing in these four cases, it may indicate a minimum sequence requirement for human telomerase to generate a new telomere or for the acquisition of a new telomere from another chromosome end. One de novo case reported by Varley et al. (24) identified 10 nucleotides of unknown origin inserted at the breakpoint followed by telomeric repeat sequences. This finding is not uncommon at sites where double-strand breaks have been repaired by NHEJ and may suggest a multi-step process of breakage and stabilization for this particular chromosome end (4452).
Several different mechanisms have now been reported for the generation and stabilization of terminal deletions in humans based on the sequence analysis of a few terminal deletion breakpoints. The majority of these have focused on terminal deletions presumably stabilized by de novo addition of telomeric repeats (17,2125). Alternately, two terminal deletions of 16p appear to have been stabilized by homologous recombination between closely related Alu elements producing interstitial deletions (25,41). Another report, of a single 18q- breakpoint, suggests that illegitimate recombination with satellite III DNA sequences from an unknown location was involved in capturing a new telomere (42). Recently, another mechanism has been proposed that implicates misalignment and nonallelic homologous recombination between low-copy repeats in generating inverted duplications associated with terminal deletions (53,54). Although low-copy repeats have been identified and implicated in the generation of inverted duplication/deletions of 8p (53), these cases have common, recurring terminal deletion and inverted duplication breakpoints that are not observed in terminal deletions of 1p36.
In contrast to other proposed models, the identification of interrupted inverted duplications in two subjects with monosomy 1p36 suggests that BFB cycles may play an important role in terminal deletion formation. The interrupted inverted duplication/deletions identified in subjects 30 and 40 in this study are identical in structure to those seen in mouse embryonic stem (ES) cell lines (16) and in human tumor cell lines (15) that have undergone BFB cycles. In one of these studies, Lo et al. (16) used a mouse ES cell system with a marker chromosome that contained a specifically engineered I-SceI site adjacent to a telomere to introduce double-strand breaks and investigate the consequences of telomere loss in mammalian cells. Following the induction of a double-strand break by the I-SceI endonuclease, 90% of the ES cells had marker chromosomes that were eventually healed by the addition of telomeric repeat sequences directly onto the broken chromosome. The remaining 10% showed interrupted inverted duplications at the breakpoints. These ES cell lines were also shown to pass through periods of instability characterized by the formation of dicentric chromosomes and inverted duplications resulting in gene amplification. Their results suggest that BFB cycles were involved in the chromosome instability observed following telomere loss in these ES cell lines. In a similar study, Fouladi et al. (15) also showed that spontaneous telomere loss in a human tumor cell line resulted in chromosome instability characteristic of BFB cycles. Although some of these tumor cell lines showed telomere healing by the addition of telomeric repeats directly onto the ends of the broken chromosomes, the majority of these cells appeared to pass through BFB cycles that resulted in interrupted inverted duplications at the breakpoints. A comparison of these previous studies with our current study suggests that the interrupted inverted duplications observed at the junctions in subjects 30 and 40 are also likely to be a result of passing terminally deleted chromosomes through at least one BFB cycle.
In both the ES and tumor cell line studies, sequence analysis at the breakpoint junctions identified interrupted inverted duplications originating
110 kb proximal to the distal deletion breakpoint (15,16). In addition, there were 04 bp of complementarity at the breakpoint junctions between the distal deletion breakpoint and the proximal interrupted inverted duplication breakpoint that made it impossible to identify the precise breakpoint. In one tumor cell line, there was a short 187 bp DNA fragment of unknown origin inserted at the breakpoint junction (15). These breakpoint junctions were strikingly similar in structure to the two 1p36 terminal deletion breakpoints reported in this study (Figs 2F and 3F). Junctions similar to these with little or no complementarity and occasional insertions of filler DNA have also been observed in mammalian cells that have repaired double-strand breaks by NHEJ (4452).
The data from this study suggest that a chromosome with a terminal deletion of 1p36 could, following DNA replication, form a sister chromatid fusion by NHEJ and that a subsequent BFB cycle could give rise to a proximal interrupted inverted duplication and a distal deletion. After obtaining a telomeric cap, the chromosome would be stabilized (15,16,55). The mechanism by which the final telomeric cap is obtained is not known in these cases, but could be a result of either telomere healing or telomere capture. FISH analysis using a (TTAGGG)n telomeric repeat probe confirmed the presence of a telomeric cap on the ends of both of these interrupted inverted duplication/deletions (13,20). BFB cycles suggest that the initial break leading to a terminally deleted chromosome occurred in mitotic cells, which suggests either a pre-meiotic or post-zygotic origin for these interrupted inverted duplication/deletion chromosomes.
In a post-zygotic model, a double-strand break near the telomere of one homolog results in a terminally deleted chromosome in one cell of the developing embryo. If the broken chromosome is not immediately stabilized by acquisition of a telomere, DNA replication followed by sister chromatid fusion can occur (4,5). During anaphase, the dicentric chromosome is broken in a random location as the centromeres move to opposite poles. Completion of mitosis results in one cell with a terminal deletion chromosome and another cell with an inverted duplication chromosome. If these broken chromosomes do not obtain telomeric caps, additional rounds of BFB cycles could occur, resulting in further chromosomal aberrations. However, multiple rounds of BFB cycles would probably be catastrophic to the developing embryo. Once telomeric caps are obtained, the chromosomes would be stabilized and unique cell lines would be established. Although two cases of mosaic 1p36 deletions have been reported in the literature (56,57), mosaicism has not been observed in the subjects reported here (13). However, it is possible that all but one of the cell lines could have been lost early in development, leaving only the observed interrupted inverted duplication/deletion cell line.
We favor a pre-meiotic model in the developing germ cells for the formation of terminal deletions with interrupted inverted duplications (Fig. 5). This model is similar to the post-zygotic model, except that pre-meiotic BFB cycles would result in mitotic germ cell lines carrying either inverted duplication/deletions or terminal deletions that would eventually give rise to individual abnormal gametes during meiosis. If one of these abnormal gametes carrying an interrupted inverted duplication/deletion successfully fertilized, the resulting embryo would not be mosaic. This is consistent with what we have observed in the two subjects presented here. However, a pre-meiotic model raises the possibility of gonadal mosaicism in the parent of origin, suggesting an increased recurrence risk for parents with monosomy 1p36 children (58,59). Although we have not observed multiple affected children resulting from apparently de novo events in a single family, we cannot formally rule out this possibility. Because most terminal deletions of 1p36 (65%), including the three subjects characterized here, are de novo events that occurred in the maternal germ line (13), a pre-meiotic model would suggest that the original insult to the chromosome must have occurred in the maternal germ cell precursors when the mother was a developing fetus in the maternal grandmother (60,61).
|
A number of recent studies aimed at characterizing the underlying mechanism(s) of inverted duplication formation in human chromosomes have uncovered subtle telomeric deletions (54,6266). Most of these studies have proposed various meiotic models in which a dicentric chromosome is formed and subsequently broken in meiotic anaphase. However, none of these studies have examined the inverted duplication/deletion breakpoint junctions at the DNA sequence level. Although it is possible that double-strand breaks at the same locations in both sister chromatids during meiosis could fuse to form a dicentric chromosome similar to the one proposed in our pre-meiotic model, DNA repair by NHEJ (as observed in our study) is repressed during meiosis to favor repair by homologous recombination (67,68). This suggests that meiotic repair by NHEJ would be less likely to occur. Other inverted duplication/deletion and terminally deleted chromosomes in humans may also arise from pre-meiotic BFB cycles.
It is still unknown what causes the initial double-strand break to occur and why terminal deletions of 1p36 are ascertained so frequently. This could reflect higher instability in this particular telomeric region or increased survival of terminal deletions of 1p36 over other telomeric abnormalities. Large-scale sequence analysis of 1p36 may identify genomic architectural features in the region that promote terminal deletion formation. We anticipate that sequence analysis of other breakpoints will be essential to the elucidation of the mechanism(s) that generate and stabilize cytogenetically defined terminal deletions.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Generation of somatic cell hybrids
Transformed lymphoblast cells from each subject were fused to HPRT-deficient RJK88 hamster cells to generate somatic cell hybrids as previously described (69). Chromosome 1 markers D1S243 and D1S2663 (Research Genetics) were used to screen hybrid colonies for those containing the chromosome 1 with the 1p36 deletion (D1S243-, D1S2663+), but without the normal chromosome 1 homolog (D1S243+, D1S2663+). Positive colonies were selected and confirmed by FISH on metaphase chromosomes from the hybrids using chromosome 1p (GS-62L8) and 1q (GS-160H23) telomere region-specific probes as described previously (13).
STS marker selection, primer design and PCR analysis
DNA sequence was obtained from GenBank (www.ncbi.nlm.nih.gov) for each of the large-insert genomic clones that corresponded to the genomic region containing the breakpoint of each subject. Repetitive elements were masked from the sequence using RepeatMasker (http://repeatmasker.genome.washington.edu), and 100300 bp STS markers were selected from the unmasked unique sequence. PCR primers were designed from the unmasked unique sequence using Primer 3 (www-genome.wi.mit.edu/cgi-bin/primer/primer3.cgi). All primers were ordered from Integrated DNA Technologies Inc. Marker walking by PCR was performed by initially amplifying markers spaced
30 kb apart along the length of the clone from each subject. As breakpoints were narrowed, markers were then selected
10 kb apart, and finally
1 kb apart. DNA from somatic cell hybrids was extracted using standard procedures. PCR was performed using 100 ng of the subject's hybrid DNA, 0.3 µM each primer (final concentration), 10x buffer (TaKaRa), 2.5 mM each dNTP (TaKaRa), and 1 U TaKaRa Ex Taq (TaKaRa) in a final volume of 20 µl. PCR reactions were initially denatured at 95°C for 5 min followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 5865°C for 30 s, extension at 72°C for 1 min, and a final extension at 72°C for 7 min. PCR products were visualized by electrophoresis on 1% TBE agarose gels.
Telomere-anchored PCR
Telomere-anchored PCR was carried out as previously described with slight modification (17). We used the same telomere primer sequence (5' TATGGATCCCTAACCCTGACCCTAACCC 3') and PCR cycling conditions as those previously used by Flint et al. (17). Telomere-anchored PCR was performed using a unique sequence forward primer <1 kb from the putative site of healing that varied according to the subject's breakpoint location. For subject 23, the unique sequence forward primer used was 5' CTCTGTGCTAGGCTCATCCC 3'. PCR reagent concentrations were the same as those described for STS marker analysis above. PCR products were visualized by electrophoresis on 1% TBE agarose gels. PCR products specific to the subject and the hybrid containing the subject's chromosome 1 with the deletion were excised from the gels, purified and sequenced.
DNA sequencing
Gel-purified PCR products were sequenced directly at SeqWright (Houston, TX, USA).
Southern blotting and characterization of junction fragments
Restriction digests and Southern blots for cell lines and hybrids from subjects 30 and 40 were performed using standard procedures. Briefly, 510 µg of genomic DNA was digested using 10 U of DrdI (NEB) (subject 30) or NcoI (Invitrogen) (subject 40) restriction enzyme. Digested DNAs were separated by electrophoresis on 1% TBE agarose gels, and DNAs were transferred to Hybond-N+ membranes (Amersham Pharmacia Biotech). Southern blots were prehybridized for 2 h at 65°C in Rapid-hyb Buffer (Amersham Pharmacia Biotech) and subsequently hybridized overnight at 65°C with probes generated by PCR of unique sequence fragments just proximal to the breakpoints. 32P-labeled probes were generated by random primed labeling with Rediprime II (Amersham Pharmacia Biotech). Blots were washed in 2x SSC and 0.1% SDS; 0.5x SSC and 0.1% SDS; and 0.1x SSC and 0.1% SDS at 65°C for 30 min each. Junction fragments were visualized by autoradiography.
In order to eliminate the labor-intensive step of cloning the
1.4 kb junction fragment by mini-library screening of subject 40's NcoI digested genomic DNA, a PCR-based approach to isolating the
1.4 kb junction fragment was employed. Briefly, NcoI digested genomic DNA from subject 40 was size-fractionated on a 1% TBE agarose gel. DNA fragments of
1.4 kb were excised from the gel and purified. Linker DNA molecules containing PCR primer sites were ligated to the ends of these
1.4 kb DNA fragments using Invitrogen's TOPO Walker Kit. A 600 bp portion of the
1.4 kb junction fragment specific to subject 40 was subsequently amplified by PCR using a primer located within the linker molecule and a unique sequence primer located proximal to the putative breakpoint. This
600 bp PCR product was gel purified and sequenced. For subject 30's breakpoint junction, suspicion of an interrupted inverted duplication, based on a BclI Southern blot that also produced a junction fragment (data not shown), led us to estimate the position and nature of the breakpoint and to perform breakpoint PCR directly (Fig. 3E). These PCR products were gel purified and sequenced. The primers used to confirm subject 40's breakpoint junction were 5' CACTCGACCCACGGTGGCAA 3' (distal non-duplicated primer) and 5' CCTGGAACCCTGAAACCTG 3' (duplicated primer). The primers used to confirm subject 30's breakpoint junction were 5' CCCAGCCATTAACTGACCAC 3' (distal non-duplicated primer) and 5' TGTGGATCTTCCACTTTCCC 3' (duplicated primer).
Array CGH
Array CGH was performed using genomic DNA isolated from lymphoblastoid cell lines established from subjects 30 and 40 and from peripheral blood of phenotypically normal sex-matched controls as described recently in Yu et al. (14). Briefly, we used a dye-reversal strategy on two separate microarrays in which subject and reference DNAs were labeled with Cyanine 3 and Cyanine 5, respectively. Labeled DNAs were co-hybridized to one microarray and then oppositely labeled and co-hybridized to a second microarray. Image acquisition and data analysis were performed as described previously (14) to identify gains or losses within a particular region of 1p36 and to generate the plot shown in Figure 4A.
Interphase FISH
Interphase FISH analysis was performed on a previously established lymphoblastoid cell line of subject 30 (13) using clone RPCI1-286D6 located
3.25 Mb from the 1p telomere and within the putative duplicated region. Clone RPCI5-1185F7, located
5.25 Mb from the 1p telomere, was used as a chromosome 1 control. Clone RPCI1-286D6 was directly labeled with SpectrumGreenTM (Vysis) and clone RPCI5-1185F7 was directly labeled with SpectrumRedTM (Vysis) by nick translation according to the manufacturer's specifications. Cells were counterstained with DAPI and visualized using a Zeiss Axiophot fluorescent microscope equipped with single-band-pass filters as well as a triple-band-pass filter. Digital images were captured using a Power Macintosh G3 system and MacProbe version 4.3 (Applied Imaging). Twenty-five cells were scored for the detection of a duplicated red signal corresponding to clone RPCI1-286D6.
| ACKNOWLEDGEMENTS |
|---|
We thank Cami Knox-Du Bois for the generation of the somatic cell hybrid cell lines, Jonathan Flint (Oxford, UK) for providing the telomere region-specific FISH probes used in this study and Aaron Theisen (Washington State University) for his careful editing of the manuscript. We are also grateful to the families who participated in this study and to Heidi Heilstedt as well as many other clinicians who referred these study subjects. This work was supported by a grant from the NIH National Institute for Child Health and Development P01 HD39420 (L.G.S.).
| FOOTNOTES |
|---|
* To whom correspondence should be addressed at: Washington State University Spokane, Health Research and Education Center, Box 1495, Spokane, WA 99210-1495, USA. Tel: +1 5093686710; Fax: +1 5093587627; Email: lshaffer{at}wsu.edu
| REFERENCES |
|---|
|
|
|---|
-
Knight, S.J. and Flint, J. (2000) Perfect endings: a review of subtelomeric probes and their use in clinical diagnosis. J. Med. Genet., 37, 401409.
[Abstract/Free Full Text] - McEachern, M.J., Krauskopf, A. and Blackburn, E.H. (2000) Telomeres and their control. A. Rev. Genet., 34, 331358.[CrossRef][Web of Science][Medline]
- Cervantes, R.B. and Lundblad, V. (2002) Mechanisms of chromosome-end protection. Curr. Opin. Cell. Biol., 14, 351356.[CrossRef][Web of Science][Medline]
-
McClintock, B. (1939) The behavior in successive nuclear divisions of a chromosome broken at meiosis. Proc. Natl Acad. Sci. USA, 25, 405416.
[Free Full Text] -
McClintock, B. (1941) The stability of broken ends of chromosomes in Zea mays. Genetics, 26, 234282.
[Free Full Text] - Artandi, S.E., Chang, S., Lee, S.L., Alson, S., Gottlieb, G.J., Chin, L. and DePinho, R.A. (2000) Telomere dysfunction promotes non-reciprocal translocations and epithelial cancers in mice. Nature, 406, 641645.[CrossRef][Medline]
-
Difilippantonio, M.J., Petersen, S., Chen, H.T., Johnson, R., Jasin, M., Kanaar, R., Ried, T. and Nussenzweig, A. (2002) Evidence for replicative repair of DNA double-strand breaks leading to oncogenic translocation and gene amplification. J. Exp. Med., 196, 469480.
[Abstract/Free Full Text] - O'Sullivan, J.N., Bronner, M.P., Brentnall, T.A., Finley, J.C., Shen, W.T., Emerson, S., Emond, M.J., Gollahon, K.A., Moskovitz, A.H., Crispin, D.A., Potter, J.D. and Rabinovitch, P.S. (2002) Chromosomal instability in ulcerative colitis is related to telomere shortening. Nat. Genet., 32, 280284.[CrossRef][Web of Science][Medline]
-
Ciullo, M., Debily, M.A., Rozier, L., Autiero, M., Billault, A., Mayau, V., El Marhomy, S., Guardiola, J., Bernheim, A., Coullin, P., Piatier-Tonneau, D. and Debatisse, M. (2002) Initiation of the breakage-fusion-bridge mechanism through common fragile site activation in human breast cancer cells: the model of PIP gene duplication from a break at FRA7I. Hum. Mol. Genet., 11, 28872894.
[Abstract/Free Full Text] - Lo, A.W.I., Sabatier, L., Fouladi, B., Pottier, G., Ricoul, M. and Murnane, J.P. (2002) DNA amplification by breakge/fusion/bridge cycles initiated by spontaneous telomere loss in a human cancer cell line. Neoplasia, 4, 531538.[CrossRef][Web of Science][Medline]
- Shaffer, L.G. and Lupski, J.R. (2000) Molecular mechanisms for constitutional chromosomal rearrangements in humans. A. Rev. Genet., 34, 297329.[CrossRef][Web of Science][Medline]
- Shapira, S.K., McCaskill, C., Northrup, H., Spikes, A.S., Elder, F.F., Sutton, V.R., Korenberg, J.R., Greenberg, F. and Shaffer, L.G. (1997) Chromosome 1p36 deletions: the clinical phenotype and molecular characterization of a common newly delineated syndrome. Am. J. Hum. Genet., 61, 642650.[Web of Science][Medline]
- Heilstedt, H.A., Ballif, B.C., Howard, L.A., Lewis, R.A., Stal, S., Kashork, C.D., Bacino, C.A., Shapira, S.K. and Shaffer, L.G. (2003) Physical map of 1p36, placment of breakpoints in monosomy 1p36, and clinical characterization of the syndrome. Am. J. Hum. Genet., 72, 12001212.[CrossRef][Web of Science][Medline]
-
Yu, W., Ballif, B.C., Kashork, C.D., Heilstedt, H.A., Howard, L.A., Cai, W.-W., White, L.D., Liu, W., Beaudet, A.L., Bejjani, B.A., Shaw, C.D. and Shaffer, L.G. (2003) Development of a comparative genomic hybridization microarray and demonstration of its utility with 25 well-characterized human 1p36 deletions. Hum. Mol. Genet., 12, 21452152.
[Abstract/Free Full Text] - Fouladi, B., Sabatier, L., Miller, D., Pottier, G. and Murnane, J.P. (2000) The relationship between spontaneous telomere loss and chromosome instability in a human tumor cell line. Neoplasia, 2, 540554.[CrossRef][Web of Science][Medline]
-
Lo, A.W.I., Sprung, C.N., Fouladi, B., Pedram, M., Sabatier, L., Ricoul, M., Reynolds, G.E. and Murnane, J.P. (2002) Chromosome instability as a result of double-strand breaks near telomeres in mouse embryonic stem cells. Mol. Cell. Biol., 22, 48364850.
[Abstract/Free Full Text] - Flint, J., Craddock, C.F., Villegas, A., Bentley, D.P., Williams, H.J., Galanello, R., Cao, A., Wood, W.G., Ayyub, H. and Higgs, D.R. (1994) Healing of broken human chromosomes by the addition of telomeric repeats. Am. J. Hum. Genet., 55, 505512.[Web of Science][Medline]
- Brkanac, Z., Cody, J.D., Leach, R.J. and DuPont, B.R. (1998) Identification of cryptic rearrangements in patients with 18q- deletion syndrome. Am. J. Hum. Genet., 62, 15001506.[CrossRef][Web of Science][Medline]
- Catrinel Marinescu, R., Johnson, E.I., Grady, D., Chen, X-N. and Overhauser, J. (1999) FISH analysis of terminal deletions in patients diagnosed with cri-du-chat syndrome. Clin. Genet., 56, 282288.[CrossRef][Web of Science][Medline]
- Ballif, B.C., Kashork, C.D. and Shaffer, L.G. (2000) FISHing for mechanisms of cytogenetically defined terminal deletions using chromosome-specific subtelomeric probes. Eur. J. Hum. Genet., 8, 764770.[CrossRef][Web of Science][Medline]
-
Wilkie, A.O.M., Lamb, J., Harris, P.C., Finney, R.D. and Higgs, D.R. (1990) A truncated human chromosome 16 associated with
thalassaemia is stabilized by addition of telomeric repeat (TTAGGG)n. Nature, 346, 868871.[CrossRef][Medline] -
Lamb, J., Harris, P.C., Wilkie, A.O.M., Wood, W.G., Dauwerse, J.H.G. and Higgs, D.R. (1993) De novo truncation of chromosome 16p and healing with (TTAGGG)n in the
-thalassemia/mental retardation syndrome (ATR-16). Am. J. Hum. Genet., 52, 668676.[Web of Science][Medline] - Wong, A.C.C., Ning, Y., Flint, J., Clark, K., Dumanski, J.P., Ledbetter, D.H. and McDermid, H.E. (1997) Molecular characterization of a 130-kb terminal microdeletion at 22q in a child with mild mental retardation. Am. J. Hum. Genet., 60, 113120.[Web of Science][Medline]
- Varley, H., Di, S., Scherer, S.W. and Royle, N.J. (2000) Characterization of terminal deletions at 7q32 and 22q13.3 healed by de novo telomere addition. Am. J. Hum. Genet., 67, 610622.[CrossRef][Web of Science][Medline]
- Horsley, S.W., Daniels, R.J., Anguita, E., Raynham, H.A., Peden, J.F., Vellegas, A., Vickers, M.A., Green, S., Waye, J.S., Chui, D.H.K. et al. (2001) Monosomy for the most telomeric, gene-rich region of the short arm of human chromosome 16 causes minimal phenotypic effects. Eur. J. Hum. Genet., 9, 217225.[CrossRef][Web of Science][Medline]
-
Sprung, C.N., Reynolds, G.E., Jasin, M. and Murnane, J.P. (1999) Chromosome healing in mouse embryonic stem cells. Proc. Natl Acad. Sci. USA, 96, 67816786.
[Abstract/Free Full Text] - Friebe, B., Kynast, R.G., Zhang, P., Qi, L., Dhar, M. and Gill, B.S. (2001) Chromosome healing by addition of telomeric repeats in wheat occurs during the first mitotic divisions of the sporophyte and is a gradual process. Chromosome Res., 9, 137146.[CrossRef][Web of Science][Medline]
-
Bottius, E., Bakhsis, N. and Scherf, A. (1998) Plasmodium falciparum telomerase: de novo telomere addition to telomeric and nontelomeric sequences and role in chromosome healing. Mol. Cell. Biol., 18, 919925.
[Abstract/Free Full Text] - Muller, F., Wicky, C., Spicher, A. and Tobler, H. (1991) New telomere formation after developmentally regulated chromosomal breakage during the process of chromatin dimunition in Ascaris lumbricoides. Cell, 67, 815822.[CrossRef][Web of Science][Medline]
-
Kramer, K.M. and Haber, J.E. (1993) New telomeres in yeast are initiated with a highly selected subset of TG1-3 repeats. Genes Dev., 7, 23452356.
[Abstract/Free Full Text] - Meltzer, P.S., Guan, X.-Y. and Trent, J.M. (1993) Telomere capture stabilizes chromosome breakage. Nat. Genet., 4, 252255.[CrossRef][Web of Science][Medline]
- Ning, Y., Liang, J.C., Nagarajan, L., Schrock, E. and Ried, T. (1998) Characterization of 5q deletions by subtelomeric probes and spectral karyotyping. Cancer Genet. Cytogenet., 103, 170172.[CrossRef][Web of Science][Medline]
-
Bosco, G. and Haber, J.E. (1998) Chromosome break-induced DNA replication leads to nonreciprocal translocations and telomere capture. Genetics, 150, 10371047.
[Abstract/Free Full Text] - Kuwano, A., Ledbetter, S.A., Dobyns, W.B., Emanuel, B.S. and Ledbetter, D.H. (1991) Detection of deletions and cryptic translocations in MillerDieker syndrome by in situ hybridization. Am. J. Hum. Genet., 49, 707714.[Web of Science][Medline]
- Altherr, M.R., Bengtsson, U., Elder, F.F., Ledbetter, D.H., Wasmuth, J.J., McDonald, M.E., Gusella, J.F. and Greenberg, F. (1991) Molecular confirmation of Wolf-Hirschhorn syndrome with a subtle translocation of chromosome 4. Am. J. Hum. Genet., 49, 12351242.[Web of Science][Medline]
- Varley, H., Pickett, H.A., Foxon, J.L., Reddel, R.R. and Royle, N.J. (2002) Molecular characterization of inter-telomere and intra-telomere mutations in human ALT cells. Nat. Genet., 30, 301305.[CrossRef][Web of Science][Medline]
- Neumann, A.A. and Reddel, R.R. (2002) Telomere maintenance and cancerlook, no telomerase. Nat. Rev. Cancer, 2, 879884.[CrossRef][Web of Science][Medline]
-
Allshire, R.C., Dempster, M. and Hastie, N.D. (1989) Human telomeres contain at least three types of G-rich repeats distributed non-randomly. Nucl. Acids Res., 17, 46114627.
[Abstract/Free Full Text] - Baird, D.M., Jeffreys, A.J. and Royle, N.J. (1995) Mechanisms underlying telomere repeat turnover, revealed by hypervariable variant repeat distribution patterns in the human X/Yp telomere. EMBO J., 14, 54335443.[Web of Science][Medline]
-
Morin, G.B. (1991) Recognition of a chromosome truncation site associated with
-thalassemia by human telomerase. Nature, 353, 454456.[CrossRef][Medline] -
Flint, J., Rochette, J., Craddock, C.F., Dodé, C., Vignes, B., Horsley, S.W., Kearney, L., Buckle, V.J., Ayyub, H. and Higgs, D.R. (1996) Chromosomal stabilization by a subtelomeric rearrangement involving two closely related Alu elements. Hum. Mol. Genet., 5, 11631169.
[Abstract/Free Full Text] -
Katz, S.G., Schneider, S.S., Bartuski, A., Trask, B.J., Massa, H., Overhauser, J., Lalande, M., Lansdorp, P.M. and Silverman, G.A. (1999) An 18q- syndrome breakpoint resides between the duplicated serpins SCCA1 and SCCA2 and arises via a cryptic rearrangement with satellite III DNA. Hum. Mol. Genet., 8, 8792.
[Abstract/Free Full Text] - Inoue, K., Osaka, H., Thurston, V.C., Clarke, J.T., Yoneyama, A., Rosenbarker, L., Bird, T.D., Hodes, M.E., Shaffer, L.G. and Lupski, J.R. (2002) Genomic rearrangements resulting in PLP1 deletion occur by nonhomologous end joining and cause different dysmyelinating phenotypes in males and 0females. Am. J. Hum. Genet., 71, 838853.[CrossRef][Web of Science][Medline]
- Hackett, J.A., Feldser, D.M. and Greider, C.W. (2001) Telomere dysfunction increases mutation rates and genomic instability. Cell, 106, 275286.[CrossRef][Web of Science][Medline]
- Hemann, M.T., Strong, M.A., Hao, L.-Y. and Greider, C.W. (2001) The shortest telomere, not average telomere length, is critical for cell viability and chromosome stability. Cell, 107, 6777.[CrossRef][Web of Science][Medline]
- Sargent, R.G., Brenneman, M.A. and Wilson, J.H. (1997) Repair of site-specific double-strand breaks in a mammalian chromosome by homologous and illegitimate recombination. Mol. Cell. Biol., 17, 267277.[Abstract]
-
Lin, Y. and Waldman, A.S. (2001) Capture of DNA sequences at double-strand breaks in mammalian chromosomes. Genetics, 158, 16651674.
[Abstract/Free Full Text] -
Lin, Y., Lukacsovich, T. and Waldman, A.S. (1999) Multiple pathways for repair of DNA double-strand breaks in mammalian chromosomes. Mol. Cell. Biol., 19, 83538360.
[Abstract/Free Full Text] - Piparas, E., Coquelle, A., Bieth, A. and Debatisse, M. (1998) Interstitial deletions and intrachromosomal amplification initiated from a double-strand break targeted to a mammalian chromosome. EMBO J., 17, 325333.[CrossRef][Web of Science][Medline]
-
Roth, D.B. and Wilson, J.H. (1986) Nonhomologous recombination in mammalian cells: role for short sequence homology in the joining reaction. Mol. Cell. Biol., 6, 42954304.
[Abstract/Free Full Text] -
Roth, D.B., Chang, X.B. and Wilson, J.H. (1989) Comparison of filler DNA at immune, nonimmune, and oncogenic rearrangements suggests multiple mechanisms of formation. Mol. Cell. Biol., 9, 30493057.
[Abstract/Free Full Text] -
Rouet, P., Smih, F. and Jasin, M. (1994) Introduction of double-strand breaks into the genome of mouse cells by expression of a rare-cutting endonuclease. Mol. Cell. Biol., 14, 80968106.
[Abstract/Free Full Text] - Giglio, S., Broman, K.W., Matsumoto, N., Calvari, V., Gimelli, G., Neumann, T., Ohashi, H., Voullaire, L., Larizza, D., Giorda, R. et al. (2001) Olfactory receptor-gene clusters, genomic-inversion polymorphisms, and common chromosome rearrangements. Am. J. Hum. Genet., 68, 874883.[CrossRef][Web of Science][Medline]
- Bonaglia, M.C., Giorda, R., Poggi, G., Raggi, M.E., Rossi, E., Baroncini, A., Giglio, S., Borgatti, R. and Zuffardi, O. (2000) Inverted duplications are recurrent rearrangements always associated with a distal deletion: description of a new case involving 2q. Eur. J. Hum. Genet., 8, 597603.[CrossRef][Web of Science][Medline]
- Kostiner, D.R., Nguyen, H., Cox, V.A. and Cotter, P.D. (2002) Stabilization of a terminal inversion duplication of 8p by telomere capture from 18q. Cytogenet. Genome Res., 98, 912.[CrossRef][Web of Science][Medline]
- Eugster, E.A., Berry, S.A. and Hirsch, B. (1997) Mosaicism for deletion 1p36.33 in a patient with obesity and hyperphagia. Am. J. Med. Genet., 70, 409412.[CrossRef][Web of Science][Medline]
- Reddy, K.S. and Yang, X. (2003) Submicroscopic terminal deletion of 1p36.3 and Xp23 hidden in complex chromosome rearrangements: independent mechanism of telomere restitution on the two chromatids. Am. J. Med. Genet., 117A, 261267.[CrossRef]
- Hall, J.G. (1988) Review and hypotheses: somatic mosaicism: observations related to clinical genetics. Am. J. Hum. Genet., 43, 355363.[Web of Science][Medline]
- Youssoufian, H. and Pyeritz, R.E. (2002) Mechanisms and consequences of somatic mosaicism in humans. Nat. Rev. Genet., 3, 748758.[CrossRef][Web of Science][Medline]
- Cohen, P.E. and Pollard, J.W. (2001) Regulation of meiotic recombination and prophase I progression in mammals. BioEssays, 23, 9961009.[CrossRef][Web of Science][Medline]
- Petronczki, M., Siomos, M.F. and Nasmyth, K. (2003) Un menage a quatre. The molecular biology of chromosome segregation in meiosis. Cell, 112, 423440.[CrossRef][Web of Science][Medline]
- Stetten, G., Charity, L.L., Kasch, L.M., Scott, A.F., Berman, C.L., Pressman, E. and Blakemore, K.J. (1997) A paternally derived inverted duplication of 7q with evidence of a telomeric deletion. Am. J. Med. Genet., 68, 7681.[CrossRef][Web of Science][Medline]
- Jenderny, J., Poetsch, M., Hoeltzenbein, M., Friedrich, U. and Jauch, A. (1998) Detection of a concomitant distal deletion in an inverted duplication of chromosome 3. Is there an overall mechanism for the origin of such duplication/deficiencies? Eur. J. Hum. Genet., 6, 439444.[CrossRef][Web of Science][Medline]
- Tsezou, A., Kitsiou, S., Galla, A., Petersen, M.B., Karadima, G., Syrrou, M., Sahlèn, S. and Blennow, E. (2000) Molecular cytogenetic characterization and origin of two de novo duplication 9p cases. Am. J. Med. Genet., 91, 102106.[CrossRef][Web of Science][Medline]
- Cotter, P.D., Kaffe, S., Li, L., Gershin, I.F. and Hirschhorn, K. (2001) Loss of subtelomeric sequence associated with a terminal inversion duplication of the short arm of chromosome 4. Am. J. Med. Genet., 102, 7680.[CrossRef][Web of Science][Medline]
- Krepischi-Santos, A.C.V. and Vianna-Morgante, A.M. (2003) Disclosing the mechanisms of origin of de novo short-arm duplications of chromosome 9. Am. J. Med. Genet., 117A, 4146.[CrossRef]
- Goedecke, W., Eijpe, M., Offenberg, H.H., van Aalderen, M. and Heyting, C. (1999) Mre11 and Ku70 interact in somatic cells, but are differentially expressed in early meiosis. Nat. Genet., 23, 194198.[CrossRef][Web of Science][Medline]
- Fiorenza, M.T., Bevilacqua, A., Bevilacqua, S. and Mangia, F. (2001) Growing dictyate oocytes, but not early preimplantation embryos, of the mouse display high levels of DNA homologous recombination by single-strand annealing and lack DNA nonhomologous end joining. Dev. Biol., 233, 214224.[CrossRef][Web of Science][Medline]
-
Page, S.L. and Shaffer, L.G. (1997) Nonhomologous Robertsonian translocations form predominantly during female meiosis. Nat. Genet., 15, 231232.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:
![]() |
L R Rowe, J-Y Lee, L Rector, E B Kaminsky, A R Brothman, C L Martin, and S T South U-type exchange is the most frequent mechanism for inverted duplication with terminal deletion rearrangements J. Med. Genet., October 1, 2009; 46(10): 694 - 702. [Abstract] [Full Text] [PDF] |
||||
![]() |
E Rossi, M Riegel, J Messa, S Gimelli, P Maraschio, R Ciccone, M Stroppi, P Riva, C S Perrotta, T Mattina, et al. Duplications in addition to terminal deletions are present in a proportion of ring chromosomes: clues to the mechanisms of formation J. Med. Genet., March 1, 2008; 45(3): 147 - 154. [Abstract] [Full Text] [PDF] |
||||
![]() |
M C Bonaglia, R Giorda, E Mani, G Aceti, B-M Anderlid, A Baroncini, T Pramparo, and O Zuffardi Identification of a recurrent breakpoint within the SHANK3 gene in the 22q13.3 deletion syndrome J. Med. Genet., October 1, 2006; 43(10): 822 - 828. [Abstract] [Full Text] [PDF] |
||||
![]() |
R Ciccone, T Mattina, R Giorda, M C Bonaglia, M Rocchi, T Pramparo, and O Zuffardi Inversion polymorphisms and non-contiguous terminal deletions: the cause and the (unpredicted) effect of our genome architecture. J. Med. Genet., May 1, 2006; 43(5): e19 - e19. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. G. Shaffer and B. A. Bejjani A cytogeneticist's perspective on genomic microarrays Hum. Reprod. Update, May 1, 2004; 10(3): 221 - 226. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Shaw and J. R. Lupski Implications of human genome architecture for rearrangement-based disorders: the genomic basis of disease Hum. Mol. Genet., April 1, 2004; 13(90001): R57 - 64. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Yu, B. C. Ballif, C. D. Kashork, H. A. Heilstedt, L. A. Howard, W.-W. Cai, L. D. White, W. Liu, A. L. Beaudet, B. A. Bejjani, et al. Development of a comparative genomic hybridization microarray and demonstration of its utility with 25 well-characterized 1p36 deletions Hum. Mol. Genet., September 1, 2003; 12(17): 2145 - 2152. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||







