Skip Navigation


Human Molecular Genetics Advance Access originally published online on July 22, 2003
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
12/18/2277    most recent
ddg239v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (115)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Itier, J.-M.
Right arrow Articles by García de Yébenes, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Itier, J.-M.
Right arrow Articles by García de Yébenes, J.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2003, Vol. 12, No. 18 2277-2291
DOI: 10.1093/hmg/ddg239
© 2003 Oxford University Press

Parkin gene inactivation alters behaviour and dopamine neurotransmission in the mouse

Jean-Michel Itier1,{dagger}, Pablo Ibáñez2,{dagger}, María Angeles Mena3, Nacer Abbas2,{ddagger}, Charles Cohen-Salmon4, Georg Andrees Bohme5, Michel Laville5, Jeremy Pratt5, Olga Corti2, Laurent Pradier5, Gwénäelle Ret1, Chantal Joubert4, Magali Periquet2, Francisco Araujo5, Julia Negroni4, María José Casarejos3, Santiago Canals3, Rosa Solano3, Alba Serrano6, Eva Gallego6, Marina Sánchez6, Patrice Denèfle1, Jesús Benavides5, Günter Tremp1, Thomas A. Rooney5,*, Alexis Brice2,7 and Justo García de Yébenes6

1Functional Genomics Department, Aventis Pharma SA, 13 Quai Jules Guesde, F-94400 Vitry-sur-Seine, France, 2INSERM U289, Groupe Hopitalier Pitié-Salpêtrière, 47, Bd de l'Hôpital, 75651 Paris Cedex 13, France, 3Department of Research, Hospital Ramon y Cajal, Carretera de Colmenar km. 9,100, 28034 Madrid, Spain, 4CNRS UMR 7593, Hopitalier Pitié-Salpêtrière, 47, Bd de l'Hôpital, 75651 Paris Cedex 13, France, 5CNS Department, Aventis Pharma SA, 13 Quai Jules Guesde, F-94400 Vitry-sur-Seine, France, 6Department of Neurology, Fundación Jiménez Díaz, Universidad Autónoma de Madrid, Avda. de Reyes Católicos, 2. 28040 Madrid, Spain and 7Département de Génétique, Cytogénétique et Embryologie, Groupe Hopitalier Pitié-Salpêtrière, AP-HP, 47, Bd de l'Hôpital, 75651 Paris Cedex 13, France

Received April 10, 2003; Revised June 13, 2003; Accepted July 10, 2003


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Mutations of the parkin gene are the most frequent cause of early onset autosomal recessive parkinsonism (EO-AR). Here we show that inactivation of the parkin gene in mice results in motor and cognitive deficits, inhibition of amphetamine-induced dopamine release and inhibition of glutamate neurotransmission. The levels of dopamine are increased in the limbic brain areas of parkin mutant mice and there is a shift towards increased metabolism of dopamine by MAO. Although there was no evidence for a reduction of nigrostriatal dopamine neurons in the parkin mutant mice, the level of dopamine transporter protein was reduced in these animals, suggesting a decreased density of dopamine terminals, or adaptative changes in the nigrostriatal dopamine system. GSH levels were increased in the striatum and fetal mesencephalic neurons from parkin mutant mice, suggesting that a compensatory mechanism may protect dopamine neurons from neuronal death. These parkin mutant mice provide a valuable tool to better understand the preclinical deficits observed in patients with PD and to characterize the mechanisms leading to the degeneration of dopamine neurons that could provide new strategies for neuroprotection.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Parkinson's Disease (PD) is the second most frequent neurodegenerative disorder with a prevalence of 0.2–0.3% in the population of Europe and North America (1,2). Clinically, PD is best characterized by akinesia or bradykinesia, rigidity, resting tremor and postural abnormalities (3,4). In addition, other neurological deficits, such as peculiar personality traits, cognitive and autonomic dysfunction, depression and sleep disorders often take place (3). The major pathological hallmark of PD is the degeneration of dopaminergic neurons of the substantia nigra, predominantly the ventrolateral portion of the pars compacta that innervates the dorsal striatum. Other monoamine brain nuclei are also damaged, but to a lesser extent than in the substantia nigra. Most PD patients present intracellular eosinophillic inclusions, known as Lewy bodies (5). These inclusions are immunoreactive for several proteins, such as {alpha}-synuclein and ubiquitin, but are not exclusive to PD since they have been observed in other neurological disorders (6,7).

Most cases of PD are sporadic and have been associated with a number of risk factors, including exposure to pesticides, drinking well water, and recent industrialization. This suggests that the pathogenesis of the disease may be related to excessive oxidative stress, lack of free radical scavenging products or abnormalities of mitochondrial energy production (8,9). Indeed, blockade of the mitochondrial respiratory chain or generation of oxidative stress by different pharmacological tools has been used to generate most of the experimental models of PD in laboratory animals (10–13). In addition to the sporadic forms of PD, familial aggregation is present in up to 25% of PD cases. A subset of these families correspond to monogenic forms of PD; a few families with mutations in genes encoding for {alpha}-synuclein (14) and Nurr1 (15) are associated with autosomal dominant forms of the disease. However, the majority of familial cases are associated with mutations of the parkin gene (16), which causes the most common form of autosomal recessive parkinsonism (17) and accounts for approximately 15% of the isolated cases with onset before the age of 45 (18).

In most families with PD related to parkin gene mutations, the disease onset is before age 40 and the clinical response to L-DOPA is good (16,19,20). The majority of patients with homozygous or combined heterozygous mutations of the parkin gene have severe loss of nigral dopaminergic neurons, but without Lewy bodies (21–24). However, PD patients with parkin mutations can also display atypical phenotypes of late onset, autosomal dominant transmission and Lewy bodies in their brain (17,25–27). Age at onset of parkinsonism related to parkin mutations is extremely variable, even within the same family or among carriers of the same mutation (20,28). In addition, a single parkin mutation is detected in some patients (29), suggesting that this situation could represent a risk factor for PD. Therefore, the reduction of parkin protein function, and not only total absence of parkin function or a dominant negative effect of specific mutations, is enough to produce parkinsonism in some individuals. The pathogenic impact of parkin mutations may also be modulated by other factors.

Parkin is encoded by a gene containing 12 exons. Many different mutations, including deletions and multiplications of one or several exons, point mutations that alter the open reading frame producing premature stop codons and truncated proteins or changes of a single amino acid in critical regions of the protein have been identified in all exons, including exon 3 (17,19). Parkin is a protein of 465 amino acids with a ubiquitin homology domain at the N terminal, and two ring fingers plus one ‘in between ring’ sequence towards the C terminal. As with many RING-finger-containing proteins, parkin acts as an E3 ubiquitin protein ligase and has been shown to bind to and ubiquitinate a number of specific protein substrates, including Cdcrel-1 (30), Pael-R (31), synphilin-1 (32) and glycosylated {alpha}-synuclein (33).

To date, the mechanism(s) by which parkin mutations and deregulation of parkin substrates lead to dopamine neuronal loss and the onset of parkinsonian symptoms is unknown. To further understand the mechanisms by which mutations in parkin lead to the onset of parkinsonism, we have generated a transgenic animal model in which the parkin gene has been inactivated. Here we report the construction of a parkin mutant mouse and a characterization of the phenotype resulting from preventing the functional expression of the parkin protein.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Absence of parkin protein in parkin exon 3 deleted mice
A 12 kb fragment containing mouse parkin exon 3 was isolated from the 129SV genomic phage library. A targeting vector was assembled to replace the 3' end of exon 3 and a substantial part of intron 4 by a neomycin-resistance cassette (Fig. 1A). The successful deletion was confirmed at the genome level by Southern blot (Fig. 1B). Northern blot analysis revealed that the tree parkin mRNA disappeared in the mutant mice and is replaced by a single new band. Using parkin exon 2, 3 or 4 as a probe, we demonstrated a splice between exon 2 and 4 and skipping of exon 3 in the parkin mRNA present in the mutant mice (Fig. 1C). This result was confirmed by RT–PCR experiments and sequencing of the amplification products (data not shown). The consequence of such aberrant splicing in this putative coding mRNA is the change of the ORF from position codon 57 and the appearance of a stop codon at position 105. Germ line transmission was obtained with chimeric mice. Mice carrying the homozygous mutation were viable and fertile. Studies of mortality in the colony showed no excess mortality when compared with wild-type animals reared in parallel and mutant mice had the same average litter size as wild type mice (7.6±0.6 versus 8.3±0.6 young/litter; n=32 and 24, respectively).



View larger version (30K):
[in this window]
[in a new window]
  		Figure 1. Inactivation of the parkin gene. (A) The strategy for inactivating the parkin gene in the mouse. The 1097 bp encompassing the 3' end of exon 3 and 5' end of intron 3 were deleted. (B) Southern blot of genomic DNA from wild type and parkin mutant mice. The 6 kb and the 5 kb bands indicate the presence of the wild-type and the mutated parkin allele, respectively. (C) Northern blot: total RNA from wild-type or parkin mutant mice brain were hybridized with a probe corresponding to parkin gene exon 2, 3 or 4. (D) Demonstration of the absence of parkin protein by western blot analysis. Brain extract from wild-type or parkin mutant mice was used with an anti-parkin antibody.

 
Western blots using an antibody raised against amino acids 71–92 of the parkin protein indicated that the 48–50 kDa band, corresponding to the parkin protein, had disappeared in the parkin mutant mice (Fig. 1D). These mutants can therefore be considered to have lost their ability to produce the parkin protein.

Clinical phenotype and brain morphology
Transgenic parkin mice appeared to be normal with no modification of behaviour or handicap. The oldest homozygous transgenic mice, of both mixed (C57BL6/129SV) and pure (129SV) background, did not show any overt behavioural changes up to 24 months of age. No differences in brain morphology, brain weight and brain size were observed and there was no evidence of muscle degeneration (data not shown). These findings are in contrast to those found in Drosophila parkin mutants that display a reduced lifespan, male sterility and muscle degeneration (34). Histological sections of the brain at the levels of the striatum, hippocampus, brain stem and cerebellum stained with haematoxylin and eosin also did not reveal any changes (data not shown). However, body weight was reduced from weaning to 500 days of age in both male and female parkin mutant mice (Fig. 2) and body temperature, measured rectally, was reduced in parkin mutant mice at 4 months (37.2±0.2°C in parkin mutant mice versus 38.5±0.16°C in wild-type mice, P<0.001, n=14).



View larger version (35K):
[in this window]
[in a new window]
  		Figure 2. Parkin mutant mice have decreased body weight. Evolution of body weight for wild type (open bars, n=11) and parkin mutant (hatched bars, n=14) mice. *P<0.05; **P<0.01; ***P<0.001 versus wild-type mice, Student's t-test.

 
Protein markers of dopaminergic neurons
Tyrosine hydroxylase (TH) immunoreactivity in the substantia nigra and striatum of female mice was similar in wild type and parkin mutant mice at 15 months of age. Quantitative analysis showed no statistically significant difference in the number of TH-positive perikaria in the substantia nigra or in TH optical density in the striatum between the two groups (Fig. 3A–F). No differences in TH staining were observed up to 24 months of age (data not shown). This lack of effect on TH staining was confirmed by western blot where no differences in the levels of TH protein were observed between male parkin mutant mice and controls at 15 months of age in the striatum (Fig. 3G and H) or in the limbic region, diencephalon and brain stem (data not shown). In addition, there was no difference in {alpha}-synuclein, ubiquitin, synapsin, synaptophysin, Map2 and Neu N staining in mutant mice at 24 months of age (data not shown). By contrast, although immunohistochemical examination of dopamine transporter (DAT) staining in wild-type and mutant mice at 15 months of age showed no significant differences (data not shown), the levels of DAT and VMAT2, measured by western blot, were significantly reduced in the striatum of parkin mutant mice (Fig. 3G and H).



View larger version (56K):
[in this window]
[in a new window]
  		Figure 3. Protein markers of dopamine neurons. (A) Representative photomicographs of TH immunoreactivity in the striatum of a 15-month-old female wild-type mouse. (B) Representative photomicographs of TH immunoreactivity in the striatum of a 15-month-old female parkin mutant mouse. (C) TH immunoreactivity in the substantia nigra of wild-type mouse. (D) TH immunoreactivity in the substantia nigra of parkin mutant mice. (E) Magnification of TH immunostaining in the substantia nigra in wild-type mice. (F) Magnification of TH immunostaining in the substantia nigra in parkin mutant mice (original magnification x50). Bar indicates 500 µm for the striatum and 200 µm for the substantia nigra. TH cell counts and OD-values in wild type and mutant mice were compared using an unpaired t-test. A value of P<0.05 was considered statistically significant. (G) Representative western blots of tyrosine hydroxylase, dopamine transporter and vesicular monoamine transporter proteins in mice striatum (1–3 from wild type and 4–6 from parkin mutant mice). ß-Actin was used as charge control. (H) Data represent the ratio TH, DAT and VMAT2/ß-actin in mice striatum. Values are expressed as the mean±SEM (n=6 animals in each group). Statistical analysis was performed by ANOVA, followed by Student's t-test. *P<0.05, **P<0.01 parkin mutant versus wild-type mice.

 
Deficits in learning and exploration in parkin mutant mice
Parkin mutant mice display reduced exploratory behaviour in unfamiliar environments (Fig. 4A) and decreased spontaneous alternation in the exploration of the unknown arm of a T-maze (Fig. 4B), a test used to reveal deficits in working memory. This indicates that mutant mice are less willing to explore and/or less able to remember what they had recently explored. In the hanging thread test no differences were observed between wild-type and mutant mice with respect to maximal hanging time (Fig. 4C), or the number of animals refusing the test during the first trial (data not shown), which could indicate no differences in muscular tonus between both groups. However, during re-exposure to the test 3 months later, the number of animals rejecting the challenge was greater in the wild-type than in the mutant group (Fig. 4C). This could be interpreted as abnormal learning by the mutant mice, although other explanations, such as a more submissive character are also possible.



View larger version (27K):
[in this window]
[in a new window]
  		Figure 4. Parkin mutant mice have motor and cognitive deficits. (A) Open field activity in 170-day-old wild-type (open bars, n=14) and parkin mutant (striped bars, n=14) male mice over two consecutive periods of 3 min immediately following the introduction of the mouse into the motility cage reveals a reduced exploratory behaviour during the first period of testing without changes in the motor activity during the second period. **P<0.01 versus wild-type mice (Student's t-test). (B) Alternance in a T maze: male 140-day-old wild-type (open bars, n=10) and parkin mutant (hatched bars, n=14) mice were allowed 3 min to explore the maze when one of its arms were blocked. The next day animals were returned to the maze with both arms open. The first arm to be visited was noted. Wild-type mice showed a higher probability of visiting the previously unknown arm than the parkin mutant mice. *P<0.05 (Fisher's exact test). (C) Hanging thread test: the data show the longest time that animals of 12 months of age managed to hang on to the taught string (best of three trials). There was no difference between hanging times achieved by naive wild-type (open bars) and mutant mice (hatched bars) and no difference between the number of animals refusing to try the test (n=3/28 wild-type versus 3/25 mutant). However, when animals were re-exposed to the test 3 months later, a significantly higher proportion of wild-type animals refused to grip the string. *P<0.05 (Fischer's exact test). (D) Basal motor activity in control wild-type (open bar) and parkin mutant mice (shaded bar) at 6 months of age. Motor activity was decreased in the parkin mutant mice. ***P<0.001 (Student's t-test). (E) Amphetamine-induced motor activity in control wild type (shaded diamond) and parkin mutant mice (open triangle) at 6 months of age. The data show the cumulative amount of motor activity at 6 months of age in mice treated with amphetamine (0.5–5 mg/kg, i.p.) over a period of 1 h before and after treatment with amphetamine and the mean±SEM of the counts observed during the periods of 5 min expressed as a percentage of baseline for each group. Amphetamine (0.5 mg/kg) reduced motor activity to a similar extent in both mutant and wild-type groups. Amphetamine (1 and 5 mg/kg) increased motor activity in wild-type, but not in mutant mice. Motor activity was evaluated in groups of five animals. ***P<0.001 (Student's t-test).

 
Spontaneous and amphetamine-induced motor activity
Amphetamine (0.5 mg/kg) reduced locomotor activity in both mutant and wild type mice, and the percentage reduction with respect to the baseline was similar for both groups (Fig. 4E). Spontaneous motor activity in familiar environments was reduced in parkin mutant mice at 6 months of age (Fig. 4D). Amphetamine (1–5 mg/kg) significantly increased motor activation in wild-type, but not in parkin mutant mice (Fig. 4E). Since amphetamine is thought to release newly formed, mostly cytoplasmic, catecholamines, rather than vesicular catecholamines, these findings suggest that deregulation of parkin function alters the handling of intracytoplasmic neurotransmitters.

Monoamine metabolism in parkin mutant mice
The levels of 5-HT and 5-HIAA in the striatum, limbic system, diencephalon and brainstem were similar in both wild type and mutant animals at 11 months of age (Table 1 and Fig. 5A–D), suggesting that the metabolism of 5-HT is not altered by parkin dysfunction. The endogenous levels of dopamine were increased in the limbic regions of parkin mutant mice and the ratios of DOPAC/DA and DOPAC/3-MT were also increased in mutant mice (Table 1 and Fig. 5A–D). Increased dopamine levels and increased dopamine metabolism to DOPAC via monoamino oxidase (MAO), an enzyme considered to be mostly intraneuronal, and to 3-MT via catechol-ortho-methyl-tranferase (COMT), an enzyme considered mostly extraneuronal, suggests that parkin dysfunction impairs the release of dopamine and increases intraneuronal dopamine metabolism via MAO.


View this table:
[in this window]
[in a new window]
  		Table 1. Monoamine metabolism in limbic system, striatum, diencephalon and brain stem of wild-type and knockout mice for parkin
 


View larger version (34K):
[in this window]
[in a new window]
  		Figure 5. Monoamine metabolism in parkin mutant mice is shifted towards the H2O2 producing MAO pathway, and a compensatory increase in GSH levels. (A) Monoamine and metabolites in limbic system. (B) Monoamine and metabolites in the striatum. (C) Monoamine and metabolites in the diencephalon. (D) Monoamine and metabolites in the brain stem. (E) GSH levels in striatum. (F) GSH levels in fetal ventral mid brain neuronal cultures. Wild-type and parkin mutant mice at 11 months of age. (A–D) Results were calculated as ng/g of fresh tissue and then expressed as a ratio. (E) Results are expressed as mg GSH/g of fresh tissue. (F) Results are expresed as ng GSH/mg protein. Values are the mean±SEM (n=6–9). Statistical analysis was performed by one-way analysis of variance, followed by the Newman–Kleus multiple comparision test. *P<0.05; **P<0.01, ***P<0.001.

 
To determine which cellular compartment of dopamine is shifted to intraneuronal oxidation, we investigated the turnover of catecholamines after inhibition of their synthesis by {alpha}-methyl-tyrosine ({alpha}-MT). The rate of depletion of catecholamines in {alpha}-MT-treated animals was similar in both mutant and wild-type animals (data not shown), suggesting that the turnover is similar in both groups. Since the short term effects of {alpha}-MT on catecholamines are mostly related to the turnover of the newly synthesized intracytoplasmic pool of catecholamines, rather than the vesicular pool of catecholamines, our data suggest that the increased production of DOPAC in the absence of parkin is not mediated by changes in dopamine turnover, but due to intracytoplasmatic dopamine being unprotected against metabolism by MAO.

The increased dopamine metabolism by MAO was associated with an increase in the levels of reduced GSH in the striatum (Fig. 5E), the brain area with the highest levels of dopamine, but not in other brain areas (data not shown). There were no significant differences in the GSSG levels (data not shown). To further evaluate the changes of GSH in dopamine rich areas, we measured GSH levels in neuronal enriched cultured cells from ventral fetal mid brain. We found that there was an increase of GSH levels in dopamine rich areas of parkin mutant mice from the fetal period (Fig. 5F).

[3H]-DA release and [3H]-DA uptake in fetal midbrain neuronal-enriched cultures
Both basal release of [3H]-DA and K+-evoked [3H]-DA release, which is mainly an index of vesicular dopamine release, were similar in neuronal cultures from wild type and parkin mutant mice (Fig. 6A). However, amphetamine-induced [3H]-DA release, which is mainly an index of newly synthesized neurotransmitter release, was significantly decreased in neuronal cultures from parkin mutant mice compared to wild-type (Fig. 6A). [3H]-DA uptake was also significantly decreased in fetal midbrain cultures from parkin mutant mice compared with wild type (Fig. 6B). This data is in agreement with the reduction of DAT protein levels, suggesting that there is a decrease in both dopamine transporter protein expression and function in parkin mutant mice.



View larger version (35K):
[in this window]
[in a new window]
  		Figure 6. Parkin mutant mice have normal basal spontaneous release of [3H]-dopamine and KCl-induced release of [3H]-dopamine, but reduced amphetamine-induced release of [3H]-dopamine as well as reduced [3H]-dopamine uptake. (A) [3H]-DA release in 7 DIV-old cultures from fetal (E13) midbrain mice are the mean±SEM (n=4–6). Statistical analysis was performed by one-way analysis of variance followed by the Newman–Keuls multiple comparison test. ***P<0.001 for amphetamine-induced [3H]-DA release in parkin mutant versus wild-type mice. (B) [3H]-DA uptake in 7 DIV-old cultures from fetal (E13) midbrain mice are the mean±SEM (n=12). Statistical analysis was performed by one-way analysis of variance followed by the Newman–Keuls multiple comparison test. ***P<0.001 parkin mutant versus wild-type mice.

 
Deficits in glutamate synaptic transmission in parkin mutant mice
The deficits in dopamine neurotransmission prompted us to examine the effects of parkin deletion on the pre- and postsynaptic properties of other synaptic systems. To this end, we examined glutamatergic synaptic transmission in hippocampal slices from wild type and parkin mutant mice. First, we analyzed basal synaptic transmission by applying isolated stimuli of increasing intensity to the Schaffer collaterals. The shape of the resulting glutamatergic extracellular field excitatory post-synaptic potentials (EPSPs) appeared identical in slices from parkin mutant mice and wild-type controls. There was also no evidence for abnormal excitability, such as traces of repeated action-potential firing. However, the amplitude of the EPSPs was smaller in the parkin mutant mice (Fig. 7A and B).



View larger version (23K):
[in this window]
[in a new window]
  		Figure 7. Parkin mutant mice have deficits in glutamate transmission at hippocampal Schaeffer collateral-CA1 synapses. (A) Superimposed representative tracings of EPSPs elicited by stimulation of increasing strength in a slice prepared from a wild-type mice (+/+, upper panel) and a parkin mutant mice (-/-, lower panel). (B) Mean (±SEM) amplitude of the EPSPs plotted as a function of stimulus intensity showing the significantly smaller EPSPs size in parkin mutant animals (closed triangles, n=7 slices from four male mutant mice) with respect to wild-type controls (open circles, n=8, four male mice). The decreased EPSP amplitudes in parkin mutant mice were highly significant versus stimulation intensity data over the nine levels of intensities tested (F1,116=23.42; P<0.001). Bonferoni post-tests indicated that the average size of the EPSPs were significantly different at 200 µA (237±70 and 556±128 µV, mean±SEM for mutant and wild-type, respectively, P<0.05) and 225 µA (323±90 and 694±150 µV, P<0.05). (C) Magnitude of paired-pulse facilitation. Plot of the mean (±SEM) percentage increase of the second EPSP with respect to the first EPSP as a function of interstimulation interval (same symbols and number of replicates as in B). In parkin mutant mice there was a significant increase on the facilitation ratios (F1,78=7.795; P<0.01), but there was no significant difference in the average PPF ratios at any of the five paired-pulse intervals tested. (D) Enhanced facilitation upon repeated low frequency stimulation. Amplitudes (mean±SEM) of successive EPSPs in a burst of 30 applied 70 ms apart (i.e. at 14 Hz) normalized with respect to the amplitude of the first EPSP of the burst (same symbols and replicates as in B). There was a significant increase in normalized EPSP amplitude in parkin mutant mice in the ANOVA (F1,390=36.81, P<0.001 compared with wild-type. (E) Normal LTP in both wild-type and parkin mutant mice. Plot of the mean (±SEM) amplitude of the EPSPs versus time. Data were normalized for each slice with respect to the average amplitude recorded during baseline. Shown in insert are representative superimposed tracings taken before and after LTP induction (theta-burst stimulation, arrow) in wild-type mice (+/+) and a parkin mutant mice (-/-).

 
We then examined paired pulse facilitation (PPF), a phenomenon whereby the second pulse of a pair applied in rapid succession elicits increased EPSP when the interval is sufficiently short (<500 ms). This phenomenon reflects neurotransmitter release (35). We observed a slight increase in PPF in parkin mutant animals (Fig. 7C). We therefore activated the pathway in a more sustained manner by applying trains of 30 pulses at a fixed frequency of 14 Hz. Under these conditions of low-frequency stimulation, the size of the EPSPs in the parkin mutant animals were further increased (Fig. 7D). Previous studies have established that manipulations that decrease neurotransmitter release result in increased synaptic facilitation in the hippocampal slice (35–37). Therefore, the observation of a decreased EPSP size in response to single stimulation, together with an enhanced facilitation upon repeated stimulation, suggests that deletion of parkin results in decreased presynaptic glutamate release. By contrast, there was no difference in the ability to induce long-term potentiation (LTP) in slices from wild-type and parkin mutant groups (Fig. 7E), suggesting that postsynaptic glutamate-mediated events are not altered in this brain region.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 REFERENCES
 
We have generated and characterized a knock out mouse model in which exon 3 of the parkin gene has been deleted by homologous recombination. Deletion of exon 3 has been shown to be one of the most common parkin mutations found in patients with autosomal recessive early-onset parkinsonism (17,19). As in parkinsonian patients with parkin mutations, deletion of parkin exon 3 in mice abolishes their capacity to produce the parkin protein. These mice therefore reproduce the key protein deficit that is responsible for the pathogenesis of the most frequent cause of autosomal recessive parkinsonism. The parkin mutant mice are viable and reproduce successfully, but display behavioural, biochemical and electrophysiological changes that could help explain some aspects of the pathogenesis of PD. In addition, parkin mutant mice display decreased body weight and temperature. The significance of the body weight and temperature changes is unclear, since similar changes have been observed in other transgenic models. However, it is noteworthy that both parkin and dopaminergic signalling have been implicated in the control of body weight and thermoregulation (38–41).

Loss of parkin function is associated with deregulation of dopamine handling. Thus, the endogenous levels of dopamine, but not the turnover of dopamine, are increased in brain areas rich in dopamine terminals and the ratio of the MAO-derived dopamine metabolite, DOPAC, over the COMT-derived dopamine metabolite, 3-MT, was significantly greater in parkin mutant mice. These changes suggest that abolition of parkin function interferes with dopamine release. Since MAO-mediated metabolism of dopamine is considered to be mainly intracellular and COMT activity is mostly extracellular, these findings suggest that there is a shift towards increased intraneuronal dopamine metabolism by MAO in parkin mutant mice. The increase in the oxidative reduction of dopamine by MAO should result in enhanced production of H2O2, since MAO generates one molecule of DOPAC and H2O2 per molecule of dopamine metabolized. Increasing the production of H2O2 could cause neuronal damage, due to excessive production of free radicals, if the normal scavenging systems are not able to cope with the excess of oxidative stress (42). Moreover, a number of studies have implicated oxidative stress in the neuronal death associated with PD (43) and severe reductions in the levels of GSH have been observed in the substantia nigra of PD patients (44,45). Decreased GSH levels have also been reported in human neuroblastoma and human teratoma cells transfected with mutant parkin proteins through a mechanism that appears to be independent of parkin ubiquitin ligase activity (46).

In parkin mutant mice we have detected reduced levels of DAT in the striatum, which suggests an initial damage to the presynaptic terminals of nigrostriatal dopamine neurons. However, since there is no obvious loss of nigrostriatal dopamine neurons in parkin mutant mice, it is possible that these animals develop more powerful free radical protecting systems than the wild-type. Evidence supporting this possibility is provided by the observation that the levels of GSH are selectively increased in the striatum, the brain area with the highest dopamine levels, as well as in neuronal cultures from the dopamine rich ventral midbrain of parkin mutant mice. GSH is a critical factor that regulates the neurotoxic or neurotrophic effects of catecholamines and other free radical donors on DA neurons (47–49). For example, increasing catecholamine levels, similar to those observed in parkin mutant mice, also increases GSH levels and produces neuroprotective effects in both cultured fetal rat neurons and neuroblastoma cells and inhibition of this increased GSH formation switches the neuroprotective effects of catecholamines to a neurotoxic action (47–49). Since we found increased GSH levels in both fetal neurons and brain regions of postnatal animals, this mechanism of neuroprotection appears to be active from the very early stages of dopamine cell development.

The parkin mutant mice also show a number of deficits in dopamine function, such as abnormal baseline motor activity, lack of amphetamine-induced increased locomotor activity, reduced amphetamine-induced dopamine release in fetal neuronal cultures, as well as decreased levels of VMAT2 and DAT protein and reduced [3H]-DA uptake. Amphetamine mainly increases the release of dopamine from the intracytoplasmic rather than the vesicular pool (50–54). Since the release of dopamine evoked by KCl, which is considered as an index of vesicular release, was unaffected in fetal neuronal cultures from mutant mice, this indicates that the reduction of amphetamine-induced dopamine release is mediated by alterations in the intracytoplasmic pool of dopamine.

The changes observed in VMAT2 and DAT protein levels and the reduction of [3H]-DA uptake may be related to the pathogenetic mechanisms of parkin dysfunction, or they could signal the first indication of initial damage to the dopamine nigrostriatal terminals. However, we cannot exclude a contribution of adaptative modifications in response to other changes in DA metabolism. Transgenic mice with reduced VMAT2 expression also show reduced amphetamine-induced DA release (55). Therefore, the abnormalities of DA release observed in the parkin mutant mice may be related to the reduction of VMAT2 levels. Since VMAT2 controls the intraneuronal storage of DA, preventing its intracytoplasmic oxidation and preparing it for exocytotic release, the reduction of VMAT2 levels could enhance the neurotoxicity of high intracytoplasmic DA concentrations (56). There is a substantial amount of information indicating that VMAT2 and DAT are altered in patients with PD (57) and in presymptomatic individuals (58) and that their activity, as measured by modern neuroimaging techniques, can be used to measure the density of DA terminals while aging (59) and the severity of DA cell presynaptic terminal loss during the progression of PD (60).

Examination of hippocampal electrophysiology demonstrates that abnormal neurotransmitter release in parkin mutant mice is not restricted to the nigrostriatal DA pathway but is also evident as significant deficits in glutamate neurotransmitter release at the level of the Schaffer collateral-CA1 synapses. Similar deficits in hippocampal electrophysiology have been observed in {alpha} synuclein KO mice (61). The inhibition of neurotransmitter release in the absence of parkin is consistent with previous observations in which parkin has been shown to be localized to the interface between the synaptic vesicles and the cytoplasm (62) and to control the degradation of protein substrates, e.g. Cdcrel-1, that have been implicated in the inhibition of synaptic transmission (30).

Dopamine neurotransmission is also altered in mice with mutations of {alpha}-synuclein. For example, similar to parkin mutant mice, mice lacking {alpha}-synuclein develop normally, do not display loss of dopaminergic neurons, but have decreased locomotor responses to amphetamine and reduced striatal dopamine levels (63). By contrast, overexpression of A53T mutated {alpha}-synuclein in mice induces a more pronounced phenotype characterized by a severe movement disorder leading to paralysis and death (64). Moreover, in contrast to mesencephalic neurons from parkin mutant mice where KCl-induced dopamine release is unaffected and amphetamine-induced dopamine release is decreased, in mesencephalic neurons overexpressing the A53T {alpha}-synuclein mutation, KCl-induced dopamine release is decreased and amphetamine-induced dopamine release is increased (65). Expression of the A53T mutation in PC12 cells also produces loss of KCl-induced dopamine release and alterations of the ubiquitin-dependent degradation system (66).

The alterations in dopamine and glutamate neurotransmission could be at the origin of some of the motor and cognitive deficits in parkin mutant mice, which are also present as presymptomatic symptoms in patients with PD prior to the development of overt clinical symptoms. For example, the decline in spatial working memory observed in mutant mice in the spontaneous alternation task has also been observed in PD patients with mild clinical symptoms (67). PD patients with severe clinical symptoms display impairment of spatial, verbal and visual working memory (67). The reduced exploration observed in mutant mice in the open field studies is probably related to a lack of curiosity and novelty-seeking behaviour, rather than to akinesia or cognitive deficits, since other motor and behavioral deficits, such as akinesia or abnormal performance of routine activities were not observed. In addition, it is possible that the cognitive deficit in the hanging grip test could be explained, at least in part, by the mutant mice having a more submissive character. The presence of similar personality traits, including industriousness, punctuality, inflexibility, cautiousness and lack of novelty seeking have been observed to predate the onset of motor illness in presymptomatic PD patients (68,69). Moreover, a high degree of submissive behaviour has been observed in depressed patients (70) and depression is frequently a complicating factor in patients with PD (71). These behavioral patterns in PD patients and mutant mice are probably related to abnormalities of the phasic release of dopamine and other neurotransmitters when a high output is required from these neuronal systems, rather than to neuronal loss in these systems, with normal dopamine function being maintained during activities that do not require a high degree of activation.

It is clear from the above that the absence of parkin results in abnormal processing of dopamine, deficits in glutamate synaptic transmission and impairment of certain aspects of motor activity and memory. However, in contrast to PD, all of these phenotypic changes occur in the absence of clear evidence of parkinsonism, cell loss in the nigrostriatal dopamine system or accumulation of ubiquitinated {alpha}-synuclein aggregates. Locomotor defects have also been observed in the absence of general neuronal degeneration and dopaminergic neuron loss in Drosophila parkin mutants (34). In the Drosophila parkin model the locomotor defects are mediated by apoptotic muscle degeneration, which is not observed in our mouse model. Absence of nigral cell loss, despite {alpha} synuclein pathology and cell loss in other CNS areas, has also been observed in transgenic {alpha} synuclein mice (64). This suggests that the nigrostriatal dopamine system in mice and Drosophila is less vulnerable to neuronal loss in the absence of parkin than humans. This could be explained by the lack of neuromelanin formation in mice or the low levels of GSH in primates. In addition, parkin could work in concert with other factors to induce the degeneration of dopaminergic neurons and/or compensatory changes could protect against parkin loss of function. A key role for such regulatory factors has been observed in dopaminergic neurons where L-DOPA and catecholamines can produce neurotoxic (72,73) or neurotrophic (47,74–76) effects, depending on the concentration of GSH and other free radical scavengers (77–79). The presence of such compensatory mechanisms could explain, at least in part, the lack of a clear parkinsonian phenotype in parkin mutant mice and the large variability in age of onset and clinical severity of parkinsonism related to mutations of parkin, even in members of the same family (19,20).

In conclusion, this parkin mutant mouse model displays a number of behavioural and biochemical changes which reproduce some of the presymptomatic aspects of PD. However, these mice do not display a clear parkinsonian phenotype. This model therefore provides a valuable tool to better understand some of the preclinical deficits observed in patients with PD and to further examine the potential compensatory mechanisms that prevent the onset of a parkinsonian phenotype and which could provide new strategies for neuroprotection.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
REFERENCES
 
Inactivation of the parkin gene: cloning of the mouse parkin gene and creation of the targeting vector
A genomic phage library from the 129SvJ mouse strain (Stratagene, lambda FIX II ref. 946313) was screened with a rat parkin cDNA probe. A clone containing a 12kb genomic fragment was identified and shown to contain exon 3 of the mouse parkin gene, plus about 2.4 kb of intron 2 at its 5' end.

Two oligonucleotides were synthesized to amplify a sequence of 1092 bp containing 1030 bp at the 3' end of intron 2 and 62 bp at the 5' end of exon 3. The oligonucleotide used at the 5' end carries an EcoRI cloning site (ccg gaa ttc gtg tcc ttg gtg gta gat tca), whereas that used at the 3' end carries a BamHI (cgc gga tcc tga ctt ctc ctc cgt ggt ctc). The XhoI site on the PCR fragment was destroyed and then the fragment was cloned at sites EcoRI and BamHI in the pPN2T plasmid, provided by Dr E. Rubin's laboratory (Berkeley, CA, USA). This plasmid contains a positive selection cassette (neomycin gene), plus two negative selection cassettes (TK gene).

The long arm of the homologous recombination vector was obtained by cloning a 7 kb EcoRI–SalI fragment from the 12 kb genomic fragment in a Bluescript plasmid. The EcoRI site is 179 bp from the 5' extremity of the exon 3. The NotI site of this DNA fragment was then destroyed. New sites of NotI and XhoI cloning were then introduced into the SalI site and the EcoRI site of the polylinker, respectively. Sequencing revealed that the EcoRI site was removed. The 7 kb genomic fragment was cloned in the previous plasmid containing the BamHI–EcoRI fragment plus the Neo and TK genes by using NotI–XhoI sites. In this construction, the parkin gene was interrupted by the neomycin resistance cassette within exon 3. The first 62 nucleic acids of exon 3 were preserved. The introduced deletion covers an area of 1097 bp, encompassing the last 179 nucleic acids of exon 3 and the first 918 nucleic acids of intron 3.

Tools for homologous recombination
PCRs.
Three oligonucleotide pairs were used to select the recombinant ES cells; pair A, tttccaaatgtgtcagtttc/tttgagtaagagccactaagg; pair B, tgttccacatacacttcattc/tttgagtaagagccactaagg; pair C, cagtattgttttgccaagttc/tttgagtaagagccactaagg.

The PCR conditions were as follows: reaction mixture containing 50 fg of DNA, 1.5 µl of four dNPTs 4x25 mM, 4 µl of each oligonucleotide at 100 ng/µl, 10 µl of MgCl2 1 mM, 10 µl of buffer Taq 10x, 0.5 µl of Taq polymerase in 5 U/µl (Perkin Elmer) and 100 µl of water QSP. Amplification cycles were 8 min at 95°C, then 50 cycles at 95°C (0.5 min), 53°C (0.5 min), 72°C (1 min) and finally 10 min at 72°C.

Southern blots.
A 1.3 kb probe, external to the recombination vector and located in the 5' of this, makes it possible to discriminate a wild allele of the Parkin gene from a mutated allele after having performed homologous recombination. After enzymatic digestion by the endonuclease BamHI, the marked probe revealed a fragment of 6 kb for the wild allele and a fragment of 5 kb for the mutated allele. The methods for Southern blots were as described by Sambrook et al. (80)

Cell culture.
The homologous recombination vector was electroporated into 129SV ES CK35 cells obtained from the Pasteur Institute. 288 clones resistant to double selection (Neo/TK) were plated. Analysis of the genetic content of these cells by PCR and then by Southern blot made it possible to select 41 clones showing evidence of homologous recombination in the parkin gene.

Mutant mice.
Two clones were microinjected into blastocystes from C57BL6 mice. Germ line transmission was obtained from the chimera mice of the two microinjected clones. The parkin mutation was maintained in a pure 129SV and in a mixed 129SV/C57BL6 (50/50) genetic background.

Analysis of parkin protein expression
Antibody production.
An antibody to mouse parkin was raised in rabbits following the methods described by Stichel et al. (81). Briefly, a peptide was synthesized corresponding to residues 71–92 of the mouse parkin protein and this was coupled to GFAP. New Zealand White rabbits were injected s.c. with 150–250 µg of protein emulsified in Keyhole Limpet Haemacyonin and then boosted nine times. Rabbits were bled 2 weeks after the last boost and serum purified by affinity column and used for immunoblotting studies.

Western blots.
Tissue samples from parkin mutant and wildtype control mice were homogenized with a tissue mincer in a lysis buffer composed of 50 mM HEPES pH 7.5, 150 mM NaCl, 1 mM EGTA, 10% (w/v) glycerol, 1% Triton X-100 (v/v), 1.5 mM MgCl2, and a protease inhibitor cocktail. The protein concentration in the crude preparation was measured according to the standard Bradford assay. Blots were performed on homogenates from mouse brain on 10% acrylamide gels with MOPS running buffer (NuPAGE, Invitrogen). Parkin antibody, as above, was used at 1/500 and revealed with peroxidase-conjugated goat anti-rabbit (Jackson ImmunoResearch) at 1/8000. Protein was revealed with an ECL kit (Amersham-Pharmacia).

Phenotype
Breeding colonies were established on the 129SV background or on a mixed 50/50% 129SV/C57BL6 background and their offspring used for experimentation. Litter size and mortality were observed and recorded in the breeding colony. After weaning, mice were maintained in same-sex groups of four to six per cage under normal animal house conditions with constant temperature (21±1°C) and a 12 h light/dark cycle. Unless otherwise stated, animals of mixed background were used as these animals reproduced more prolifically.

Behaviour
Behavioural studies were carried out by operators blinded to the genotype of the animals being tested:

  1. Long-term behavioural observations—both male and female transgenic mice and wild-type animals were observed at monthly intervals, up to the age of 24 months.
  2. Growth rate and body temperature—groups of mice were monitored for changes in body weight at regular intervals using a Mettlar Toledo balance. Body temperature was measured via a rectal probe lubricated with saline.
  3. Open field activity—animals were placed in a Perspex box (41x28 cm) with a cross dividing it into four equal compartments. The blinded operator sat at 2 m distance from the cage and counted each time the animal traversed the lines of the cross over two consecutive periods of 3 min.
  4. Spontaneous alternation—animals were placed in a T maze with one arm blocked and allowed 3 min to explore the maze. Fifteen minutes later they were placed in the same maze, this time with both arms open, and allowed to enter into the arm of their choice and the latency and arm choice recorded. Where the animal had been allowed access to one arm in the first trial and they chose the other arm in the second trial, alternation was considered to have taken place. This is a valid cue for good working memory performance and normally, in almost 100% of cases, animals alternate, following a strong exploratory motivation. However, alternation is only possible if the subjects remember the exploration of the first arm (first trial). This is a test classically used to estimate spatial working memory in rodents using a motor task without food deprivation (no food motivation and reinforcement) (82), the only reinforcement being the strength of the animals' novel environment exploration.
  5. Grip strength—animals were measured using the Columbus grip strength meter. Animals were allowed three attempts to hold on while being pulled backwards across the grid attached to the force-meter. The highest force obtained, normally the first reading, was recorded.
  6. Hanging thread—animals were placed on a 50 cm cotton thread (in the middle of the thread, 25 cm from each platform) suspended between two platforms 25 cm from the ground. The animal's forelegs were placed on the thread, immediately inducing a grasping behaviour. To reach any of the two platforms, the mice had to place their back legs on the thread. Both the time on the wire and the time until a back leg was placed on the wire were recorded. Refusal to grip was also noted. Animals underwent three tests per session and were re-tested at 3 monthly intervals.
  7. Exploratory behaviour, social interaction and motor activity were measured in drug-naive animals and after pharmacological treatment with amphetamine. Spontaneous motor activity was measured over a 30 min period, after 30 min of adaptation, using automated activity cages with photoelectric cells without drug treatment and after amphetamine (0.5, 1 and 5 mg/kg i.p.). In amphetamine treated mice, the animals were returned to the activity cages 40 min after the treatment and then recorded.

Histology and western blots
Male and female mice were used at different ages (2–24 months) for these experiments. Animals were anaesthetized with pentobarbital (130 mg/kg; Sigma, St Quentin, France) and transcardially perfused with 4% paraformaldehyde in 0.1 M phosphate buffer saline (PBS). Brains were removed, postfixed, and cryoprotected. Routine histological sections at the level of the striatum, hippocampus, brain stem and cerebellum were stained with haematoxylin and eosin. Immunohistochemistry was performed, as described previously (83), on free-floating cryomicrotome-cut sections (20 µm in thickness) from the whole brain. After incubation in 1% H2O2, followed by 0.2% Triton X-100 and then 2% normal goat serum in 0.1 PBS–0.2% gelatin, the sections were stained overnight at 4°C using a polyclonal antibody against tyrosine hydroxylase (TH) (1/1000; rabbit polyclonal; Pel Freez, Rogers, AR, USA), dopamine transporter (DAT) (1/10000; kindly provided by B. Giros), {alpha}-synuclein (1/2000; affinity-purified rabbit polyclonal AB5038P; Chemicon International), ubiquitin (1/3000; rabbit polyclonal; Dako), synapsin (1/2000; polyclonal rabbit; Sigma), synaptophysin (1/1000; monoclonal mouse; Sigma), Map2 (1/500; monoclonal mouse; Sigma) or NeuN (1/2000; monoclonal mouse; Chemicon International). Sections were then treated with biotinylated anti-rabbit (1/200) secondary antibodies (Vectastain; Vector Laboratory, Burlingame, CA, USA), and subsequently incubated with avidinbiotinylated horseradish peroxidase complex. The peroxidase was revealed by incubation with 0.05% 3,3'-diaminobenzidine tetrahydrochloride containing 0.015% hydrogen peroxide. All sections were stained simultaneously for animals of the same age using the same solutions. The total number of TH-stained cells with clearly visible nuclear borders was estimated, using a previously described method and an image analysis system (84) (Visioscan 2000, Biocom, Les Ulis, France). All sections were coded and examined blind. In the striatum, measurement of optical density of TH immunostaining, as an index of the density of dopaminergic axons and nerve terminals, was performed using the same image analysis system.

Muscle samples from five transgenic and five wild-type male mice at 20 months of age were embebbed in paraffin, cut on a microtome in 5 µm sections and mounted on 2x gelatinized slides. A Masson Trichrome staining was performed, and slides were examined by optic microscopy.

Samples (25 µg) of striatum, limbic region, diencephalon and brain stem were analyzed for TH and DAT proteins by western blots, according to Mena et al. (85). Samples (40 µg) of striatum were analysed for VMAT2 protein by western blots, according to Handler et al. (86). The membranes were incubated with mouse anti-TH from Chemicon (1:10 000), mouse anti-DAT from Chemicon (1:5000), rabbit anti-VMAT2 from Chemicon (1:500) and mouse anti-ß-actin from Sigma (1:10 000), as a control of charge. For VMAT2 detection, an enchanced chemiluminescence (SuperSignal West Dura Extended Duration Substrate) kit from Pierce Chemical was used.

Pharmacology
Monoamines and their metabolites.
Endogenous monoamine and metabolite levels in brain regions: After decapitation, brain parts were dissected, according to Carlsson and Lindqvist (87) into the dopamine (DA)-rich limbic portion, the corpora striata, the rest of the cerebral hemispheres, the diencephalon and the lower brain stem. The brain parts were frozen on dry ice and the levels of DA and its metabolites, 3-methoxy-tyramine (3-MT), 3,4-dihydroxyphenylacetic acid (DOPAC) and homovanillic acid (HVA), noradrenaline (NA) and its metabolite, 4-hydroxy-3-methoxy-phenyl-glycol (MHPG), serotonin (5-HT) and its metabolite, 5-hydroxy-indole-acetic acid (5-HIAA), were measured by HPLC with an ESA coulochem detector, according to Mena et al. (85). Briefly, the tissue was sonicated in 8 vols (w/v) of 0.4 N perchloric acid with 0.5 mM Na2S2O5 and 2% EDTA and then centrifuged for 10 min. Monoamine levels were determined from 20 µl of the resulting supernatant.

Catecholamine turnover.
Endogenous whole brain levels of NA and DA, with and without catecholamine synthesis inhibition by alpha-methyltyrosine ({alpha}-MT), were measured. Mice were sacrificed 1 h after being injected with {alpha}-MT (250 mg/kg, i.p.) (88).

Measurement of glutathione levels.
Total glutathione (GSH) levels were measured by the method of Tietze (89). Briefly, cells from fetal midbrain cultures or brain samples were sonicated in 0.4 N PCA and centrifuged, and the supernatants were neutralized with 4 vols of NaH2PO4, 0.1 M (5 mM EDTA), pH 7.5. GSH content was measured in a P96 automatic reader by the addition of DTNB (0.6 mM), NADPH (0.2 mM), GSH reductase (1 U) and the reaction monitored at 412 nM for 6 min. Oxidized glutathione (GSSG) was measured in the cells by the method of Griffith (90). Reduced GSH, after PCA extraction and pH neutralization, was derivatized with 2-vinylpyridine at room temperature for 1 h and the reaction carried out as above. GSH was obtained by subtracting GSSG levels from total GSH levels (47).

DA uptake and release in fetal midbrain neuronal cultures.
Neuronal-enriched cultures from embryonic wild type and parkin mutant mice midbrain E-13 (crown–rump length 10–12 mm) were obtained and prepared, according to Mena et al. (91). The cells were seeded in B27/Neurobasal TM medium with 15% fetal calf serum (B27/NBL-FCS) at a density of 2x105 cells/cm2 in multiwells or glass cover slides coated with poly-D-lysine (4.5 µg/cm2) in 0.1 M borate buffer, pH 8.4. The cultures were kept in a humidified chamber at 37°C in a 5% CO2 atmosphere for 6–7 days in vitro. Twenty-four hours after plating, the cells were changed to serum-free defined medium (B27/NBL), as previously reported (91).

Basal and K+- and amphetamine-induced [3H]-DA release was investigated in cells after 6–7 days in culture. Each culture was washed once with 0.5 ml of Krebs–Ringer–HEPES buffer (KRH), and then loaded with [3H]-DA by incubating them for 20 min at 37°C with KRH containing [3H]-DA (5x10-8 M) and desipramine (5x10-5 M). After loading, the cells were rinsed four times with KRH. The basal release of [3H]-DA was measured in cultures incubated for 5 min at 23°C with 0.5 ml of KRB. K+- or amphetamine-induced [3H]-DA release was measured in similarly treated cultures, but with added KCl (50 mM) or amphetamine (10 µM). The radioactivity in the media was measured by liquid scintillation spectrometry. At the end of the experiment, residual intracellular radioactivity was extracted from the cells by incubating them for 30 min with 0.2 ml of NaOH (0.4 N), and then counted. [3H]-DA release is expressed as a percentage of the total intracellular content of [3H]-DA present in each culture at the time of the release incubation, to correct for variations in the amount of [3H]-DA taken up by different cultures.

High affinity [3H]-DA uptake was measured after incubation of the cells with 10-8M [3H]-DA (70 Ci/mmol), in the presence of pargyline 10-5M and ascorbic acid 10-3 M, at 37°C for 20 min. Non-specific uptake/binding was calculated in the presence of 10-5 M mazindol (77). Proteins were measured according to the BCA assay.

Hippocampal electrophysiology.
Hippocampal slices (~500 µM thick) were prepared from male parkin mutant mice of 64–68 weeks. Age- and sex-matched wild-type mice were used as controls. Slices were incubated in a submersion-type recording chamber through which artificial cerebrospinal fluid (ACSF: 124 mM NaCl, 3 mM KCl, 1.25 mM NaH2PO4, 1.3 mM MgSO4, 2 mM CaCl2, 26 mM NaHCO3 and 10 mM glucose) was continuously perfused at 2.5–3 ml/min. ACSF was bubbled with a mixture of 95% O2/5% CO2 and maintained at 31.5±0.5°C. Test stimulations (0.1 ms duration) were delivered at constant intensity through bipolar stainless steel electrodes placed in the stratum radiatum of the CA1 area. Extracellular field excitatory post-synaptic potentials (EPSPs) were recorded with a monopolar tungsten electrode placed in the same region on the trajectory of the Schaffer collaterals. The following features of synaptic physiology were assessed: basal transmission, paired-pulse facilitation, repetitive low-frequency stimulation and long-term potentiation. The latter three properties were evaluated at a stimulation strength eliciting EPSPs of approximately half the maximal size. Analysis of paired-pulse facilitation was performed by delivering five pairs of stimuli at decreasing intervals (400, 200, 100, 50 and 25 ms). Response to low-frequency stimulation was explored by delivering two sets of 30 stimuli at 70 ms intervals repeated 30 s apart and averaged. To induce long-term potentiation, repeated brief trains of high frequency stimulation were delivered following a protocol consisting of five bursts of five pulses, each burst at 100 Hz, with 200 ms between bursts (theta-burst stimulation).

Data analysis
All data presented are expressed as the mean±SEM. The results were statistically evaluated for significance by using one-way analysis of variance, followed by Student's t-test, the Newman–Keuls multiple comparison test or Bonferoni post hoc test. Means among groups were considered significantly different when P<0.05.


   ACKNOWLEDGEMENTS
 
This work was supported by grants from the Comunidad Autonoma de Madrid, grant CAM 8.5/49/2001 and Fondo de Investigaciones Sanitarias, FIS 2002/PI20265 to J.G.Y. and M.A.M., and from the Association France Parkinson to A.B. The authors thank Mrs Rosario Villaverde and Elodie Martín for technical help and Thomas Debeir, Rita Raisman, Patrick Michel and Etienne Hirsch for helpful discussions. This paper is dedicated to the memory of Nacer Abbas.


   FOOTNOTES
 
* To whom correspondence should be addressed. Tel: +33 158932645; Fax: +33 158933685; Email: thomas.rooney{at}aventis.com Back

{dagger} The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors. Back

{ddagger} Deceased. Back


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. de Rijk, M.C., Launer, L.J., Berger, K., Breteler, M.M., Dartigues, J.F., Baldereschi, M., Fratiglioni, L., Lobo, A., Martinez-Lage, J., Trenkwalder, C. and Hofman, A. (2000) Prevalence of Parkinson's disease in Europe: A collaborative study of population-based cohorts. Neurologic Diseases in the Elderly Research Group, Neurology, 54, S21–23.[ISI][Medline]

  2. Elbaz, A., Bower, J.H., Maraganore, D.M., McDonnell, S.K., Peterson, B.J., Ahlskog, J.E., Schaid, D.J. and Rocca, W.A. (2002) Risk tables for parkinsonism and Parkinson's disease. J. Clin. Epidemiol., 55, 25–31.[CrossRef][ISI][Medline]

  3. Jankovic, J. (1992) Pathophysiology and clinical assessment of motor symptoms in Parkinson's disease. In Koller, W.C. (ed.), Handbook of Parkinson's Disease. Marcel Dekker, New York, pp. 129–157.

  4. Louis, E.D., Levy, G., Cote, L.J., Mejia, H., Fahn, S. and Marder, K. (2002) Diagnosing Parkinson's disease using videotaped neurological examinations: validity and factors that contribute to incorrect diagnoses. Mov. Disord., 17, 513–517.[CrossRef][ISI][Medline]

  5. Forno, L.S. (1996) Neuropathology of Parkinson's disease. J. Neuropathol. Exp. Neurol., 55, 259–272.[ISI][Medline]

  6. Dickson, D.W. (2001) Alpha-synuclein and the Lewy body disorders. Curr. Opin. Neurol., 14, 423–432.[CrossRef][ISI][Medline]

  7. Schneider, J.A., Bienias, J.L., Gilley, D.W., Kvarnberg, D.E., Mufson, E.J. and Bennett, D.A. (2002) Improved detection of substantia nigra pathology in Alzheimer's disease. J. Histochem. Cytochem., 50, 99–106.[Abstract/Free Full Text]

  8. Beal, M.F. (2002) Oxidatively modified proteins in aging and disease. Free Radic. Biol. Med., 32, 797–803.[CrossRef][ISI][Medline]

  9. Schapira, A.H., Gu, M., Taanman, J.W., Tabrizi, S.J., Seaton, T., Cleeter, M. and Cooper, J.M. (1998) Mitochondria in the etiology and pathogenesis of Parkinson's disease. Ann. Neurol., 44, S89–98.[ISI][Medline]

  10. Betarbet, R., Sherer, T.B. and Greenamyre, J.T. (2002) Animal models of Parkinson's disease. Bioessays, 24, 308–318.[CrossRef][ISI][Medline]

  11. Feger, J., Pessiglione, M., Francois, C., Tremblay, L. and Hirsch, E. (2002) Experimental models of Parkinson's disease. Ann. Pharm. Fr., 60, 3–21.[Medline]

  12. Gerlach, M. and Riederer, P. (1996) Animal models of Parkinson's disease: an empirical comparison with the phenomenology of the disease in man. J. Neural Transm., 103, 987–1041.[CrossRef][ISI][Medline]

  13. Grunblatt, E., Mandel, S. and Youdim, M.B. (2000) Neuroprotective strategies in Parkinson's disease using the models of 6- hydroxydopamine and MPTP. Ann. NY Acad. Sci., 899, 262–273.[Abstract/Free Full Text]

  14. Polymeropoulos, M.H., Lavedan, C., Leroy, E., Ide, S.E., Dehejia, A., Dutra, A., Pike, B., Root, H., Rubenstein, J., Boyer, R. et al. (1997) Mutation in the alpha-synuclein gene identified in families with Parkinson's disease. Science, 276, 2045–2047.[Abstract/Free Full Text]

  15. Le, W.D., Xu, P., Jankovic, J., Jiang, H., Appel, S.H., Smith, R.G. and Vassilatis, D.K. (2003) Mutations in NR4A2 associated with familial Parkinson disease. Nat. Genet., 33, 85–89.[CrossRef][ISI][Medline]

  16. Kitada, T., Asakawa, S., Hattori, N., Matsumine, H., Yamamura, Y., Minoshima, S., Yokochi, M., Mizuno, Y. and Shimizu, N. (1998) Mutations in the parkin gene cause autosomal recessive juvenile parkinsonism. Nature, 392, 605–608.[CrossRef][Medline]

  17. Lucking, C.B., Durr, A., Bonifati, V., Vaughan, J., De Michele, G., Gasser, T., Harhangi, B.S., Meco, G., Denefle, P., Wood, N.W. et al. (2000) Association between early-onset Parkinson's disease and mutations in the parkin gene. French Parkinson's Disease Genetics Study Group. New Engl. J. Med., 342, 1560–1567.[Abstract/Free Full Text]

  18. Periquet, M., Latouche, M., Lohmann, E., Rawal, N., De Michele, G., Ricard, S., Teive, H., Fraix, V., Vidailhet, M., Nicholl, D. et al. (2003) Parkin mutations are frequent in patients with isolated early-onset parkinsonism. Brain, 126, 1271–1278.[Abstract/Free Full Text]

  19. Abbas, N., Lucking, C.B., Ricard, S., Durr, A., Bonifati, V., De Michele, G., Bouley, S., Vaughan, J.R., Gasser, T., Marconi, R. et al. (1999) A wide variety of mutations in the parkin gene are responsible for autosomal recessive parkinsonism in Europe. French Parkinson's Disease Genetics Study Group and the European Consortium on Genetic Susceptibility in Parkinson's Disease. Hum. Mol. Genet., 8, 567–574.[Abstract/Free Full Text]

  20. Hoenicka, J., Vidal, L., Morales, B., Ampuero, I., Jimenez-Jimenez, F.J., Berciano, J., del Ser, T., Jimenez, A., Ruiz, P.G. and de Yebenes, J.G. (2002) Molecular findings in familial Parkinson disease in Spain. Arch. Neurol., 59, 966–970.[Abstract/Free Full Text]