Human Molecular Genetics Advance Access originally published online on July 22, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Human Molecular Genetics, 2003, Vol. 12, No. 18 2277-2291
DOI: 10.1093/hmg/ddg239
© 2003 Oxford University Press
Parkin gene inactivation alters behaviour and dopamine neurotransmission in the mouse



1Functional Genomics Department, Aventis Pharma SA, 13 Quai Jules Guesde, F-94400 Vitry-sur-Seine, France, 2INSERM U289, Groupe Hopitalier Pitié-Salpêtrière, 47, Bd de l'Hôpital, 75651 Paris Cedex 13, France, 3Department of Research, Hospital Ramon y Cajal, Carretera de Colmenar km. 9,100, 28034 Madrid, Spain, 4CNRS UMR 7593, Hopitalier Pitié-Salpêtrière, 47, Bd de l'Hôpital, 75651 Paris Cedex 13, France, 5CNS Department, Aventis Pharma SA, 13 Quai Jules Guesde, F-94400 Vitry-sur-Seine, France, 6Department of Neurology, Fundación Jiménez Díaz, Universidad Autónoma de Madrid, Avda. de Reyes Católicos, 2. 28040 Madrid, Spain and 7Département de Génétique, Cytogénétique et Embryologie, Groupe Hopitalier Pitié-Salpêtrière, AP-HP, 47, Bd de l'Hôpital, 75651 Paris Cedex 13, France
Received April 10, 2003; Revised June 13, 2003; Accepted July 10, 2003
| ABSTRACT |
|---|
|
|
|---|
Mutations of the parkin gene are the most frequent cause of early onset autosomal recessive parkinsonism (EO-AR). Here we show that inactivation of the parkin gene in mice results in motor and cognitive deficits, inhibition of amphetamine-induced dopamine release and inhibition of glutamate neurotransmission. The levels of dopamine are increased in the limbic brain areas of parkin mutant mice and there is a shift towards increased metabolism of dopamine by MAO. Although there was no evidence for a reduction of nigrostriatal dopamine neurons in the parkin mutant mice, the level of dopamine transporter protein was reduced in these animals, suggesting a decreased density of dopamine terminals, or adaptative changes in the nigrostriatal dopamine system. GSH levels were increased in the striatum and fetal mesencephalic neurons from parkin mutant mice, suggesting that a compensatory mechanism may protect dopamine neurons from neuronal death. These parkin mutant mice provide a valuable tool to better understand the preclinical deficits observed in patients with PD and to characterize the mechanisms leading to the degeneration of dopamine neurons that could provide new strategies for neuroprotection.
| INTRODUCTION |
|---|
|
|
|---|
Parkinson's Disease (PD) is the second most frequent neurodegenerative disorder with a prevalence of 0.20.3% in the population of Europe and North America (1,2). Clinically, PD is best characterized by akinesia or bradykinesia, rigidity, resting tremor and postural abnormalities (3,4). In addition, other neurological deficits, such as peculiar personality traits, cognitive and autonomic dysfunction, depression and sleep disorders often take place (3). The major pathological hallmark of PD is the degeneration of dopaminergic neurons of the substantia nigra, predominantly the ventrolateral portion of the pars compacta that innervates the dorsal striatum. Other monoamine brain nuclei are also damaged, but to a lesser extent than in the substantia nigra. Most PD patients present intracellular eosinophillic inclusions, known as Lewy bodies (5). These inclusions are immunoreactive for several proteins, such as
-synuclein and ubiquitin, but are not exclusive to PD since they have been observed in other neurological disorders (6,7).
Most cases of PD are sporadic and have been associated with a number of risk factors, including exposure to pesticides, drinking well water, and recent industrialization. This suggests that the pathogenesis of the disease may be related to excessive oxidative stress, lack of free radical scavenging products or abnormalities of mitochondrial energy production (8,9). Indeed, blockade of the mitochondrial respiratory chain or generation of oxidative stress by different pharmacological tools has been used to generate most of the experimental models of PD in laboratory animals (1013). In addition to the sporadic forms of PD, familial aggregation is present in up to 25% of PD cases. A subset of these families correspond to monogenic forms of PD; a few families with mutations in genes encoding for
-synuclein (14) and Nurr1 (15) are associated with autosomal dominant forms of the disease. However, the majority of familial cases are associated with mutations of the parkin gene (16), which causes the most common form of autosomal recessive parkinsonism (17) and accounts for approximately 15% of the isolated cases with onset before the age of 45 (18).
In most families with PD related to parkin gene mutations, the disease onset is before age 40 and the clinical response to L-DOPA is good (16,19,20). The majority of patients with homozygous or combined heterozygous mutations of the parkin gene have severe loss of nigral dopaminergic neurons, but without Lewy bodies (2124). However, PD patients with parkin mutations can also display atypical phenotypes of late onset, autosomal dominant transmission and Lewy bodies in their brain (17,2527). Age at onset of parkinsonism related to parkin mutations is extremely variable, even within the same family or among carriers of the same mutation (20,28). In addition, a single parkin mutation is detected in some patients (29), suggesting that this situation could represent a risk factor for PD. Therefore, the reduction of parkin protein function, and not only total absence of parkin function or a dominant negative effect of specific mutations, is enough to produce parkinsonism in some individuals. The pathogenic impact of parkin mutations may also be modulated by other factors.
Parkin is encoded by a gene containing 12 exons. Many different mutations, including deletions and multiplications of one or several exons, point mutations that alter the open reading frame producing premature stop codons and truncated proteins or changes of a single amino acid in critical regions of the protein have been identified in all exons, including exon 3 (17,19). Parkin is a protein of 465 amino acids with a ubiquitin homology domain at the N terminal, and two ring fingers plus one in between ring sequence towards the C terminal. As with many RING-finger-containing proteins, parkin acts as an E3 ubiquitin protein ligase and has been shown to bind to and ubiquitinate a number of specific protein substrates, including Cdcrel-1 (30), Pael-R (31), synphilin-1 (32) and glycosylated
-synuclein (33).
To date, the mechanism(s) by which parkin mutations and deregulation of parkin substrates lead to dopamine neuronal loss and the onset of parkinsonian symptoms is unknown. To further understand the mechanisms by which mutations in parkin lead to the onset of parkinsonism, we have generated a transgenic animal model in which the parkin gene has been inactivated. Here we report the construction of a parkin mutant mouse and a characterization of the phenotype resulting from preventing the functional expression of the parkin protein.
| RESULTS |
|---|
|
|
|---|
Absence of parkin protein in parkin exon 3 deleted mice
A 12 kb fragment containing mouse parkin exon 3 was isolated from the 129SV genomic phage library. A targeting vector was assembled to replace the 3' end of exon 3 and a substantial part of intron 4 by a neomycin-resistance cassette (Fig. 1A). The successful deletion was confirmed at the genome level by Southern blot (Fig. 1B). Northern blot analysis revealed that the tree parkin mRNA disappeared in the mutant mice and is replaced by a single new band. Using parkin exon 2, 3 or 4 as a probe, we demonstrated a splice between exon 2 and 4 and skipping of exon 3 in the parkin mRNA present in the mutant mice (Fig. 1C). This result was confirmed by RTPCR experiments and sequencing of the amplification products (data not shown). The consequence of such aberrant splicing in this putative coding mRNA is the change of the ORF from position codon 57 and the appearance of a stop codon at position 105. Germ line transmission was obtained with chimeric mice. Mice carrying the homozygous mutation were viable and fertile. Studies of mortality in the colony showed no excess mortality when compared with wild-type animals reared in parallel and mutant mice had the same average litter size as wild type mice (7.6±0.6 versus 8.3±0.6 young/litter; n=32 and 24, respectively).
|
Western blots using an antibody raised against amino acids 7192 of the parkin protein indicated that the 4850 kDa band, corresponding to the parkin protein, had disappeared in the parkin mutant mice (Fig. 1D). These mutants can therefore be considered to have lost their ability to produce the parkin protein.
Clinical phenotype and brain morphology
Transgenic parkin mice appeared to be normal with no modification of behaviour or handicap. The oldest homozygous transgenic mice, of both mixed (C57BL6/129SV) and pure (129SV) background, did not show any overt behavioural changes up to 24 months of age. No differences in brain morphology, brain weight and brain size were observed and there was no evidence of muscle degeneration (data not shown). These findings are in contrast to those found in Drosophila parkin mutants that display a reduced lifespan, male sterility and muscle degeneration (34). Histological sections of the brain at the levels of the striatum, hippocampus, brain stem and cerebellum stained with haematoxylin and eosin also did not reveal any changes (data not shown). However, body weight was reduced from weaning to 500 days of age in both male and female parkin mutant mice (Fig. 2) and body temperature, measured rectally, was reduced in parkin mutant mice at 4 months (37.2±0.2°C in parkin mutant mice versus 38.5±0.16°C in wild-type mice, P<0.001, n=14).
|
Protein markers of dopaminergic neurons
Tyrosine hydroxylase (TH) immunoreactivity in the substantia nigra and striatum of female mice was similar in wild type and parkin mutant mice at 15 months of age. Quantitative analysis showed no statistically significant difference in the number of TH-positive perikaria in the substantia nigra or in TH optical density in the striatum between the two groups (Fig. 3AF). No differences in TH staining were observed up to 24 months of age (data not shown). This lack of effect on TH staining was confirmed by western blot where no differences in the levels of TH protein were observed between male parkin mutant mice and controls at 15 months of age in the striatum (Fig. 3G and H) or in the limbic region, diencephalon and brain stem (data not shown). In addition, there was no difference in
-synuclein, ubiquitin, synapsin, synaptophysin, Map2 and Neu N staining in mutant mice at 24 months of age (data not shown). By contrast, although immunohistochemical examination of dopamine transporter (DAT) staining in wild-type and mutant mice at 15 months of age showed no significant differences (data not shown), the levels of DAT and VMAT2, measured by western blot, were significantly reduced in the striatum of parkin mutant mice (Fig. 3G and H).
|
Deficits in learning and exploration in parkin mutant mice
Parkin mutant mice display reduced exploratory behaviour in unfamiliar environments (Fig. 4A) and decreased spontaneous alternation in the exploration of the unknown arm of a T-maze (Fig. 4B), a test used to reveal deficits in working memory. This indicates that mutant mice are less willing to explore and/or less able to remember what they had recently explored. In the hanging thread test no differences were observed between wild-type and mutant mice with respect to maximal hanging time (Fig. 4C), or the number of animals refusing the test during the first trial (data not shown), which could indicate no differences in muscular tonus between both groups. However, during re-exposure to the test 3 months later, the number of animals rejecting the challenge was greater in the wild-type than in the mutant group (Fig. 4C). This could be interpreted as abnormal learning by the mutant mice, although other explanations, such as a more submissive character are also possible.
|
Spontaneous and amphetamine-induced motor activity
Amphetamine (0.5 mg/kg) reduced locomotor activity in both mutant and wild type mice, and the percentage reduction with respect to the baseline was similar for both groups (Fig. 4E). Spontaneous motor activity in familiar environments was reduced in parkin mutant mice at 6 months of age (Fig. 4D). Amphetamine (15 mg/kg) significantly increased motor activation in wild-type, but not in parkin mutant mice (Fig. 4E). Since amphetamine is thought to release newly formed, mostly cytoplasmic, catecholamines, rather than vesicular catecholamines, these findings suggest that deregulation of parkin function alters the handling of intracytoplasmic neurotransmitters.
Monoamine metabolism in parkin mutant mice
The levels of 5-HT and 5-HIAA in the striatum, limbic system, diencephalon and brainstem were similar in both wild type and mutant animals at 11 months of age (Table 1 and Fig. 5AD), suggesting that the metabolism of 5-HT is not altered by parkin dysfunction. The endogenous levels of dopamine were increased in the limbic regions of parkin mutant mice and the ratios of DOPAC/DA and DOPAC/3-MT were also increased in mutant mice (Table 1 and Fig. 5AD). Increased dopamine levels and increased dopamine metabolism to DOPAC via monoamino oxidase (MAO), an enzyme considered to be mostly intraneuronal, and to 3-MT via catechol-ortho-methyl-tranferase (COMT), an enzyme considered mostly extraneuronal, suggests that parkin dysfunction impairs the release of dopamine and increases intraneuronal dopamine metabolism via MAO.
|
|
To determine which cellular compartment of dopamine is shifted to intraneuronal oxidation, we investigated the turnover of catecholamines after inhibition of their synthesis by
-methyl-tyrosine (
-MT). The rate of depletion of catecholamines in
-MT-treated animals was similar in both mutant and wild-type animals (data not shown), suggesting that the turnover is similar in both groups. Since the short term effects of
-MT on catecholamines are mostly related to the turnover of the newly synthesized intracytoplasmic pool of catecholamines, rather than the vesicular pool of catecholamines, our data suggest that the increased production of DOPAC in the absence of parkin is not mediated by changes in dopamine turnover, but due to intracytoplasmatic dopamine being unprotected against metabolism by MAO. The increased dopamine metabolism by MAO was associated with an increase in the levels of reduced GSH in the striatum (Fig. 5E), the brain area with the highest levels of dopamine, but not in other brain areas (data not shown). There were no significant differences in the GSSG levels (data not shown). To further evaluate the changes of GSH in dopamine rich areas, we measured GSH levels in neuronal enriched cultured cells from ventral fetal mid brain. We found that there was an increase of GSH levels in dopamine rich areas of parkin mutant mice from the fetal period (Fig. 5F).
[3H]-DA release and [3H]-DA uptake in fetal midbrain neuronal-enriched cultures
Both basal release of [3H]-DA and K+-evoked [3H]-DA release, which is mainly an index of vesicular dopamine release, were similar in neuronal cultures from wild type and parkin mutant mice (Fig. 6A). However, amphetamine-induced [3H]-DA release, which is mainly an index of newly synthesized neurotransmitter release, was significantly decreased in neuronal cultures from parkin mutant mice compared to wild-type (Fig. 6A). [3H]-DA uptake was also significantly decreased in fetal midbrain cultures from parkin mutant mice compared with wild type (Fig. 6B). This data is in agreement with the reduction of DAT protein levels, suggesting that there is a decrease in both dopamine transporter protein expression and function in parkin mutant mice.
|
Deficits in glutamate synaptic transmission in parkin mutant mice
The deficits in dopamine neurotransmission prompted us to examine the effects of parkin deletion on the pre- and postsynaptic properties of other synaptic systems. To this end, we examined glutamatergic synaptic transmission in hippocampal slices from wild type and parkin mutant mice. First, we analyzed basal synaptic transmission by applying isolated stimuli of increasing intensity to the Schaffer collaterals. The shape of the resulting glutamatergic extracellular field excitatory post-synaptic potentials (EPSPs) appeared identical in slices from parkin mutant mice and wild-type controls. There was also no evidence for abnormal excitability, such as traces of repeated action-potential firing. However, the amplitude of the EPSPs was smaller in the parkin mutant mice (Fig. 7A and B).
|
We then examined paired pulse facilitation (PPF), a phenomenon whereby the second pulse of a pair applied in rapid succession elicits increased EPSP when the interval is sufficiently short (<500 ms). This phenomenon reflects neurotransmitter release (35). We observed a slight increase in PPF in parkin mutant animals (Fig. 7C). We therefore activated the pathway in a more sustained manner by applying trains of 30 pulses at a fixed frequency of 14 Hz. Under these conditions of low-frequency stimulation, the size of the EPSPs in the parkin mutant animals were further increased (Fig. 7D). Previous studies have established that manipulations that decrease neurotransmitter release result in increased synaptic facilitation in the hippocampal slice (3537). Therefore, the observation of a decreased EPSP size in response to single stimulation, together with an enhanced facilitation upon repeated stimulation, suggests that deletion of parkin results in decreased presynaptic glutamate release. By contrast, there was no difference in the ability to induce long-term potentiation (LTP) in slices from wild-type and parkin mutant groups (Fig. 7E), suggesting that postsynaptic glutamate-mediated events are not altered in this brain region.
| DISCUSSION |
|---|
|
|
|---|
We have generated and characterized a knock out mouse model in which exon 3 of the parkin gene has been deleted by homologous recombination. Deletion of exon 3 has been shown to be one of the most common parkin mutations found in patients with autosomal recessive early-onset parkinsonism (17,19). As in parkinsonian patients with parkin mutations, deletion of parkin exon 3 in mice abolishes their capacity to produce the parkin protein. These mice therefore reproduce the key protein deficit that is responsible for the pathogenesis of the most frequent cause of autosomal recessive parkinsonism. The parkin mutant mice are viable and reproduce successfully, but display behavioural, biochemical and electrophysiological changes that could help explain some aspects of the pathogenesis of PD. In addition, parkin mutant mice display decreased body weight and temperature. The significance of the body weight and temperature changes is unclear, since similar changes have been observed in other transgenic models. However, it is noteworthy that both parkin and dopaminergic signalling have been implicated in the control of body weight and thermoregulation (3841).
Loss of parkin function is associated with deregulation of dopamine handling. Thus, the endogenous levels of dopamine, but not the turnover of dopamine, are increased in brain areas rich in dopamine terminals and the ratio of the MAO-derived dopamine metabolite, DOPAC, over the COMT-derived dopamine metabolite, 3-MT, was significantly greater in parkin mutant mice. These changes suggest that abolition of parkin function interferes with dopamine release. Since MAO-mediated metabolism of dopamine is considered to be mainly intracellular and COMT activity is mostly extracellular, these findings suggest that there is a shift towards increased intraneuronal dopamine metabolism by MAO in parkin mutant mice. The increase in the oxidative reduction of dopamine by MAO should result in enhanced production of H2O2, since MAO generates one molecule of DOPAC and H2O2 per molecule of dopamine metabolized. Increasing the production of H2O2 could cause neuronal damage, due to excessive production of free radicals, if the normal scavenging systems are not able to cope with the excess of oxidative stress (42). Moreover, a number of studies have implicated oxidative stress in the neuronal death associated with PD (43) and severe reductions in the levels of GSH have been observed in the substantia nigra of PD patients (44,45). Decreased GSH levels have also been reported in human neuroblastoma and human teratoma cells transfected with mutant parkin proteins through a mechanism that appears to be independent of parkin ubiquitin ligase activity (46).
In parkin mutant mice we have detected reduced levels of DAT in the striatum, which suggests an initial damage to the presynaptic terminals of nigrostriatal dopamine neurons. However, since there is no obvious loss of nigrostriatal dopamine neurons in parkin mutant mice, it is possible that these animals develop more powerful free radical protecting systems than the wild-type. Evidence supporting this possibility is provided by the observation that the levels of GSH are selectively increased in the striatum, the brain area with the highest dopamine levels, as well as in neuronal cultures from the dopamine rich ventral midbrain of parkin mutant mice. GSH is a critical factor that regulates the neurotoxic or neurotrophic effects of catecholamines and other free radical donors on DA neurons (4749). For example, increasing catecholamine levels, similar to those observed in parkin mutant mice, also increases GSH levels and produces neuroprotective effects in both cultured fetal rat neurons and neuroblastoma cells and inhibition of this increased GSH formation switches the neuroprotective effects of catecholamines to a neurotoxic action (4749). Since we found increased GSH levels in both fetal neurons and brain regions of postnatal animals, this mechanism of neuroprotection appears to be active from the very early stages of dopamine cell development.
The parkin mutant mice also show a number of deficits in dopamine function, such as abnormal baseline motor activity, lack of amphetamine-induced increased locomotor activity, reduced amphetamine-induced dopamine release in fetal neuronal cultures, as well as decreased levels of VMAT2 and DAT protein and reduced [3H]-DA uptake. Amphetamine mainly increases the release of dopamine from the intracytoplasmic rather than the vesicular pool (5054). Since the release of dopamine evoked by KCl, which is considered as an index of vesicular release, was unaffected in fetal neuronal cultures from mutant mice, this indicates that the reduction of amphetamine-induced dopamine release is mediated by alterations in the intracytoplasmic pool of dopamine.
The changes observed in VMAT2 and DAT protein levels and the reduction of [3H]-DA uptake may be related to the pathogenetic mechanisms of parkin dysfunction, or they could signal the first indication of initial damage to the dopamine nigrostriatal terminals. However, we cannot exclude a contribution of adaptative modifications in response to other changes in DA metabolism. Transgenic mice with reduced VMAT2 expression also show reduced amphetamine-induced DA release (55). Therefore, the abnormalities of DA release observed in the parkin mutant mice may be related to the reduction of VMAT2 levels. Since VMAT2 controls the intraneuronal storage of DA, preventing its intracytoplasmic oxidation and preparing it for exocytotic release, the reduction of VMAT2 levels could enhance the neurotoxicity of high intracytoplasmic DA concentrations (56). There is a substantial amount of information indicating that VMAT2 and DAT are altered in patients with PD (57) and in presymptomatic individuals (58) and that their activity, as measured by modern neuroimaging techniques, can be used to measure the density of DA terminals while aging (59) and the severity of DA cell presynaptic terminal loss during the progression of PD (60).
Examination of hippocampal electrophysiology demonstrates that abnormal neurotransmitter release in parkin mutant mice is not restricted to the nigrostriatal DA pathway but is also evident as significant deficits in glutamate neurotransmitter release at the level of the Schaffer collateral-CA1 synapses. Similar deficits in hippocampal electrophysiology have been observed in
synuclein KO mice (61). The inhibition of neurotransmitter release in the absence of parkin is consistent with previous observations in which parkin has been shown to be localized to the interface between the synaptic vesicles and the cytoplasm (62) and to control the degradation of protein substrates, e.g. Cdcrel-1, that have been implicated in the inhibition of synaptic transmission (30).
Dopamine neurotransmission is also altered in mice with mutations of
-synuclein. For example, similar to parkin mutant mice, mice lacking
-synuclein develop normally, do not display loss of dopaminergic neurons, but have decreased locomotor responses to amphetamine and reduced striatal dopamine levels (63). By contrast, overexpression of A53T mutated
-synuclein in mice induces a more pronounced phenotype characterized by a severe movement disorder leading to paralysis and death (64). Moreover, in contrast to mesencephalic neurons from parkin mutant mice where KCl-induced dopamine release is unaffected and amphetamine-induced dopamine release is decreased, in mesencephalic neurons overexpressing the A53T
-synuclein mutation, KCl-induced dopamine release is decreased and amphetamine-induced dopamine release is increased (65). Expression of the A53T mutation in PC12 cells also produces loss of KCl-induced dopamine release and alterations of the ubiquitin-dependent degradation system (66).
The alterations in dopamine and glutamate neurotransmission could be at the origin of some of the motor and cognitive deficits in parkin mutant mice, which are also present as presymptomatic symptoms in patients with PD prior to the development of overt clinical symptoms. For example, the decline in spatial working memory observed in mutant mice in the spontaneous alternation task has also been observed in PD patients with mild clinical symptoms (67). PD patients with severe clinical symptoms display impairment of spatial, verbal and visual working memory (67). The reduced exploration observed in mutant mice in the open field studies is probably related to a lack of curiosity and novelty-seeking behaviour, rather than to akinesia or cognitive deficits, since other motor and behavioral deficits, such as akinesia or abnormal performance of routine activities were not observed. In addition, it is possible that the cognitive deficit in the hanging grip test could be explained, at least in part, by the mutant mice having a more submissive character. The presence of similar personality traits, including industriousness, punctuality, inflexibility, cautiousness and lack of novelty seeking have been observed to predate the onset of motor illness in presymptomatic PD patients (68,69). Moreover, a high degree of submissive behaviour has been observed in depressed patients (70) and depression is frequently a complicating factor in patients with PD (71). These behavioral patterns in PD patients and mutant mice are probably related to abnormalities of the phasic release of dopamine and other neurotransmitters when a high output is required from these neuronal systems, rather than to neuronal loss in these systems, with normal dopamine function being maintained during activities that do not require a high degree of activation.
It is clear from the above that the absence of parkin results in abnormal processing of dopamine, deficits in glutamate synaptic transmission and impairment of certain aspects of motor activity and memory. However, in contrast to PD, all of these phenotypic changes occur in the absence of clear evidence of parkinsonism, cell loss in the nigrostriatal dopamine system or accumulation of ubiquitinated
-synuclein aggregates. Locomotor defects have also been observed in the absence of general neuronal degeneration and dopaminergic neuron loss in Drosophila parkin mutants (34). In the Drosophila parkin model the locomotor defects are mediated by apoptotic muscle degeneration, which is not observed in our mouse model. Absence of nigral cell loss, despite
synuclein pathology and cell loss in other CNS areas, has also been observed in transgenic
synuclein mice (64). This suggests that the nigrostriatal dopamine system in mice and Drosophila is less vulnerable to neuronal loss in the absence of parkin than humans. This could be explained by the lack of neuromelanin formation in mice or the low levels of GSH in primates. In addition, parkin could work in concert with other factors to induce the degeneration of dopaminergic neurons and/or compensatory changes could protect against parkin loss of function. A key role for such regulatory factors has been observed in dopaminergic neurons where L-DOPA and catecholamines can produce neurotoxic (72,73) or neurotrophic (47,7476) effects, depending on the concentration of GSH and other free radical scavengers (7779). The presence of such compensatory mechanisms could explain, at least in part, the lack of a clear parkinsonian phenotype in parkin mutant mice and the large variability in age of onset and clinical severity of parkinsonism related to mutations of parkin, even in members of the same family (19,20).
In conclusion, this parkin mutant mouse model displays a number of behavioural and biochemical changes which reproduce some of the presymptomatic aspects of PD. However, these mice do not display a clear parkinsonian phenotype. This model therefore provides a valuable tool to better understand some of the preclinical deficits observed in patients with PD and to further examine the potential compensatory mechanisms that prevent the onset of a parkinsonian phenotype and which could provide new strategies for neuroprotection.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Inactivation of the parkin gene: cloning of the mouse parkin gene and creation of the targeting vector
A genomic phage library from the 129SvJ mouse strain (Stratagene, lambda FIX II ref. 946313) was screened with a rat parkin cDNA probe. A clone containing a 12kb genomic fragment was identified and shown to contain exon 3 of the mouse parkin gene, plus about 2.4 kb of intron 2 at its 5' end.
Two oligonucleotides were synthesized to amplify a sequence of 1092 bp containing 1030 bp at the 3' end of intron 2 and 62 bp at the 5' end of exon 3. The oligonucleotide used at the 5' end carries an EcoRI cloning site (ccg gaa ttc gtg tcc ttg gtg gta gat tca), whereas that used at the 3' end carries a BamHI (cgc gga tcc tga ctt ctc ctc cgt ggt ctc). The XhoI site on the PCR fragment was destroyed and then the fragment was cloned at sites EcoRI and BamHI in the pPN2T plasmid, provided by Dr E. Rubin's laboratory (Berkeley, CA, USA). This plasmid contains a positive selection cassette (neomycin gene), plus two negative selection cassettes (TK gene).
The long arm of the homologous recombination vector was obtained by cloning a 7 kb EcoRISalI fragment from the 12 kb genomic fragment in a Bluescript plasmid. The EcoRI site is 179 bp from the 5' extremity of the exon 3. The NotI site of this DNA fragment was then destroyed. New sites of NotI and XhoI cloning were then introduced into the SalI site and the EcoRI site of the polylinker, respectively. Sequencing revealed that the EcoRI site was removed. The 7 kb genomic fragment was cloned in the previous plasmid containing the BamHIEcoRI fragment plus the Neo and TK genes by using NotIXhoI sites. In this construction, the parkin gene was interrupted by the neomycin resistance cassette within exon 3. The first 62 nucleic acids of exon 3 were preserved. The introduced deletion covers an area of 1097 bp, encompassing the last 179 nucleic acids of exon 3 and the first 918 nucleic acids of intron 3.
Tools for homologous recombination
PCRs.
Three oligonucleotide pairs were used to select the recombinant ES cells; pair A, tttccaaatgtgtcagtttc/tttgagtaagagccactaagg; pair B, tgttccacatacacttcattc/tttgagtaagagccactaagg; pair C, cagtattgttttgccaagttc/tttgagtaagagccactaagg.
The PCR conditions were as follows: reaction mixture containing 50 fg of DNA, 1.5 µl of four dNPTs 4x25 mM, 4 µl of each oligonucleotide at 100 ng/µl, 10 µl of MgCl2 1 mM, 10 µl of buffer Taq 10x, 0.5 µl of Taq polymerase in 5 U/µl (Perkin Elmer) and 100 µl of water QSP. Amplification cycles were 8 min at 95°C, then 50 cycles at 95°C (0.5 min), 53°C (0.5 min), 72°C (1 min) and finally 10 min at 72°C.
Southern blots.
A 1.3 kb probe, external to the recombination vector and located in the 5' of this, makes it possible to discriminate a wild allele of the Parkin gene from a mutated allele after having performed homologous recombination. After enzymatic digestion by the endonuclease BamHI, the marked probe revealed a fragment of 6 kb for the wild allele and a fragment of 5 kb for the mutated allele. The methods for Southern blots were as described by Sambrook et al. (80)
Cell culture.
The homologous recombination vector was electroporated into 129SV ES CK35 cells obtained from the Pasteur Institute. 288 clones resistant to double selection (Neo/TK) were plated. Analysis of the genetic content of these cells by PCR and then by Southern blot made it possible to select 41 clones showing evidence of homologous recombination in the parkin gene.
Mutant mice.
Two clones were microinjected into blastocystes from C57BL6 mice. Germ line transmission was obtained from the chimera mice of the two microinjected clones. The parkin mutation was maintained in a pure 129SV and in a mixed 129SV/C57BL6 (50/50) genetic background.
Analysis of parkin protein expression
Antibody production.
An antibody to mouse parkin was raised in rabbits following the methods described by Stichel et al. (81). Briefly, a peptide was synthesized corresponding to residues 7192 of the mouse parkin protein and this was coupled to GFAP. New Zealand White rabbits were injected s.c. with 150250 µg of protein emulsified in Keyhole Limpet Haemacyonin and then boosted nine times. Rabbits were bled 2 weeks after the last boost and serum purified by affinity column and used for immunoblotting studies.
Western blots.
Tissue samples from parkin mutant and wildtype control mice were homogenized with a tissue mincer in a lysis buffer composed of 50 mM HEPES pH 7.5, 150 mM NaCl, 1 mM EGTA, 10% (w/v) glycerol, 1% Triton X-100 (v/v), 1.5 mM MgCl2, and a protease inhibitor cocktail. The protein concentration in the crude preparation was measured according to the standard Bradford assay. Blots were performed on homogenates from mouse brain on 10% acrylamide gels with MOPS running buffer (NuPAGE, Invitrogen). Parkin antibody, as above, was used at 1/500 and revealed with peroxidase-conjugated goat anti-rabbit (Jackson ImmunoResearch) at 1/8000. Protein was revealed with an ECL kit (Amersham-Pharmacia).
Phenotype
Breeding colonies were established on the 129SV background or on a mixed 50/50% 129SV/C57BL6 background and their offspring used for experimentation. Litter size and mortality were observed and recorded in the breeding colony. After weaning, mice were maintained in same-sex groups of four to six per cage under normal animal house conditions with constant temperature (21±1°C) and a 12 h light/dark cycle. Unless otherwise stated, animals of mixed background were used as these animals reproduced more prolifically.
Behaviour
Behavioural studies were carried out by operators blinded to the genotype of the animals being tested:
- Long-term behavioural observationsboth male and female transgenic mice and wild-type animals were observed at monthly intervals, up to the age of 24 months.
- Growth rate and body temperaturegroups of mice were monitored for changes in body weight at regular intervals using a Mettlar Toledo balance. Body temperature was measured via a rectal probe lubricated with saline.
- Open field activityanimals were placed in a Perspex box (41x28 cm) with a cross dividing it into four equal compartments. The blinded operator sat at 2 m distance from the cage and counted each time the animal traversed the lines of the cross over two consecutive periods of 3 min.
- Spontaneous alternationanimals were placed in a T maze with one arm blocked and allowed 3 min to explore the maze. Fifteen minutes later they were placed in the same maze, this time with both arms open, and allowed to enter into the arm of their choice and the latency and arm choice recorded. Where the animal had been allowed access to one arm in the first trial and they chose the other arm in the second trial, alternation was considered to have taken place. This is a valid cue for good working memory performance and normally, in almost 100% of cases, animals alternate, following a strong exploratory motivation. However, alternation is only possible if the subjects remember the exploration of the first arm (first trial). This is a test classically used to estimate spatial working memory in rodents using a motor task without food deprivation (no food motivation and reinforcement) (82), the only reinforcement being the strength of the animals' novel environment exploration.
- Grip strengthanimals were measured using the Columbus grip strength meter. Animals were allowed three attempts to hold on while being pulled backwards across the grid attached to the force-meter. The highest force obtained, normally the first reading, was recorded.
- Hanging threadanimals were placed on a 50 cm cotton thread (in the middle of the thread, 25 cm from each platform) suspended between two platforms 25 cm from the ground. The animal's forelegs were placed on the thread, immediately inducing a grasping behaviour. To reach any of the two platforms, the mice had to place their back legs on the thread. Both the time on the wire and the time until a back leg was placed on the wire were recorded. Refusal to grip was also noted. Animals underwent three tests per session and were re-tested at 3 monthly intervals.
- Exploratory behaviour, social interaction and motor activity were measured in drug-naive animals and after pharmacological treatment with amphetamine. Spontaneous motor activity was measured over a 30 min period, after 30 min of adaptation, using automated activity cages with photoelectric cells without drug treatment and after amphetamine (0.5, 1 and 5 mg/kg i.p.). In amphetamine treated mice, the animals were returned to the activity cages 40 min after the treatment and then recorded.
Histology and western blots
Male and female mice were used at different ages (224 months) for these experiments. Animals were anaesthetized with pentobarbital (130 mg/kg; Sigma, St Quentin, France) and transcardially perfused with 4% paraformaldehyde in 0.1 M phosphate buffer saline (PBS). Brains were removed, postfixed, and cryoprotected. Routine histological sections at the level of the striatum, hippocampus, brain stem and cerebellum were stained with haematoxylin and eosin. Immunohistochemistry was performed, as described previously (83), on free-floating cryomicrotome-cut sections (20 µm in thickness) from the whole brain. After incubation in 1% H2O2, followed by 0.2% Triton X-100 and then 2% normal goat serum in 0.1 PBS0.2% gelatin, the sections were stained overnight at 4°C using a polyclonal antibody against tyrosine hydroxylase (TH) (1/1000; rabbit polyclonal; Pel Freez, Rogers, AR, USA), dopamine transporter (DAT) (1/10000; kindly provided by B. Giros),
-synuclein (1/2000; affinity-purified rabbit polyclonal AB5038P; Chemicon International), ubiquitin (1/3000; rabbit polyclonal; Dako), synapsin (1/2000; polyclonal rabbit; Sigma), synaptophysin (1/1000; monoclonal mouse; Sigma), Map2 (1/500; monoclonal mouse; Sigma) or NeuN (1/2000; monoclonal mouse; Chemicon International). Sections were then treated with biotinylated anti-rabbit (1/200) secondary antibodies (Vectastain; Vector Laboratory, Burlingame, CA, USA), and subsequently incubated with avidinbiotinylated horseradish peroxidase complex. The peroxidase was revealed by incubation with 0.05% 3,3'-diaminobenzidine tetrahydrochloride containing 0.015% hydrogen peroxide. All sections were stained simultaneously for animals of the same age using the same solutions. The total number of TH-stained cells with clearly visible nuclear borders was estimated, using a previously described method and an image analysis system (84) (Visioscan 2000, Biocom, Les Ulis, France). All sections were coded and examined blind. In the striatum, measurement of optical density of TH immunostaining, as an index of the density of dopaminergic axons and nerve terminals, was performed using the same image analysis system.
Muscle samples from five transgenic and five wild-type male mice at 20 months of age were embebbed in paraffin, cut on a microtome in 5 µm sections and mounted on 2x gelatinized slides. A Masson Trichrome staining was performed, and slides were examined by optic microscopy.
Samples (25 µg) of striatum, limbic region, diencephalon and brain stem were analyzed for TH and DAT proteins by western blots, according to Mena et al. (85). Samples (40 µg) of striatum were analysed for VMAT2 protein by western blots, according to Handler et al. (86). The membranes were incubated with mouse anti-TH from Chemicon (1:10 000), mouse anti-DAT from Chemicon (1:5000), rabbit anti-VMAT2 from Chemicon (1:500) and mouse anti-ß-actin from Sigma (1:10 000), as a control of charge. For VMAT2 detection, an enchanced chemiluminescence (SuperSignal West Dura Extended Duration Substrate) kit from Pierce Chemical was used.
Pharmacology
Monoamines and their metabolites.
Endogenous monoamine and metabolite levels in brain regions: After decapitation, brain parts were dissected, according to Carlsson and Lindqvist (87) into the dopamine (DA)-rich limbic portion, the corpora striata, the rest of the cerebral hemispheres, the diencephalon and the lower brain stem. The brain parts were frozen on dry ice and the levels of DA and its metabolites, 3-methoxy-tyramine (3-MT), 3,4-dihydroxyphenylacetic acid (DOPAC) and homovanillic acid (HVA), noradrenaline (NA) and its metabolite, 4-hydroxy-3-methoxy-phenyl-glycol (MHPG), serotonin (5-HT) and its metabolite, 5-hydroxy-indole-acetic acid (5-HIAA), were measured by HPLC with an ESA coulochem detector, according to Mena et al. (85). Briefly, the tissue was sonicated in 8 vols (w/v) of 0.4 N perchloric acid with 0.5 mM Na2S2O5 and 2% EDTA and then centrifuged for 10 min. Monoamine levels were determined from 20 µl of the resulting supernatant.
Catecholamine turnover.
Endogenous whole brain levels of NA and DA, with and without catecholamine synthesis inhibition by alpha-methyltyrosine (
-MT), were measured. Mice were sacrificed 1 h after being injected with
-MT (250 mg/kg, i.p.) (88).
Measurement of glutathione levels.
Total glutathione (GSH) levels were measured by the method of Tietze (89). Briefly, cells from fetal midbrain cultures or brain samples were sonicated in 0.4 N PCA and centrifuged, and the supernatants were neutralized with 4 vols of NaH2PO4, 0.1 M (5 mM EDTA), pH 7.5. GSH content was measured in a P96 automatic reader by the addition of DTNB (0.6 mM), NADPH (0.2 mM), GSH reductase (1 U) and the reaction monitored at 412 nM for 6 min. Oxidized glutathione (GSSG) was measured in the cells by the method of Griffith (90). Reduced GSH, after PCA extraction and pH neutralization, was derivatized with 2-vinylpyridine at room temperature for 1 h and the reaction carried out as above. GSH was obtained by subtracting GSSG levels from total GSH levels (47).
DA uptake and release in fetal midbrain neuronal cultures.
Neuronal-enriched cultures from embryonic wild type and parkin mutant mice midbrain E-13 (crownrump length 1012 mm) were obtained and prepared, according to Mena et al. (91). The cells were seeded in B27/Neurobasal TM medium with 15% fetal calf serum (B27/NBL-FCS) at a density of 2x105 cells/cm2 in multiwells or glass cover slides coated with poly-D-lysine (4.5 µg/cm2) in 0.1 M borate buffer, pH 8.4. The cultures were kept in a humidified chamber at 37°C in a 5% CO2 atmosphere for 67 days in vitro. Twenty-four hours after plating, the cells were changed to serum-free defined medium (B27/NBL), as previously reported (91).
Basal and K+- and amphetamine-induced [3H]-DA release was investigated in cells after 67 days in culture. Each culture was washed once with 0.5 ml of KrebsRingerHEPES buffer (KRH), and then loaded with [3H]-DA by incubating them for 20 min at 37°C with KRH containing [3H]-DA (5x10-8 M) and desipramine (5x10-5 M). After loading, the cells were rinsed four times with KRH. The basal release of [3H]-DA was measured in cultures incubated for 5 min at 23°C with 0.5 ml of KRB. K+- or amphetamine-induced [3H]-DA release was measured in similarly treated cultures, but with added KCl (50 mM) or amphetamine (10 µM). The radioactivity in the media was measured by liquid scintillation spectrometry. At the end of the experiment, residual intracellular radioactivity was extracted from the cells by incubating them for 30 min with 0.2 ml of NaOH (0.4 N), and then counted. [3H]-DA release is expressed as a percentage of the total intracellular content of [3H]-DA present in each culture at the time of the release incubation, to correct for variations in the amount of [3H]-DA taken up by different cultures.
High affinity [3H]-DA uptake was measured after incubation of the cells with 10-8M [3H]-DA (70 Ci/mmol), in the presence of pargyline 10-5M and ascorbic acid 10-3 M, at 37°C for 20 min. Non-specific uptake/binding was calculated in the presence of 10-5 M mazindol (77). Proteins were measured according to the BCA assay.
Hippocampal electrophysiology.
Hippocampal slices (
500 µM thick) were prepared from male parkin mutant mice of 6468 weeks. Age- and sex-matched wild-type mice were used as controls. Slices were incubated in a submersion-type recording chamber through which artificial cerebrospinal fluid (ACSF: 124 mM NaCl, 3 mM KCl, 1.25 mM NaH2PO4, 1.3 mM MgSO4, 2 mM CaCl2, 26 mM NaHCO3 and 10 mM glucose) was continuously perfused at 2.53 ml/min. ACSF was bubbled with a mixture of 95% O2/5% CO2 and maintained at 31.5±0.5°C. Test stimulations (0.1 ms duration) were delivered at constant intensity through bipolar stainless steel electrodes placed in the stratum radiatum of the CA1 area. Extracellular field excitatory post-synaptic potentials (EPSPs) were recorded with a monopolar tungsten electrode placed in the same region on the trajectory of the Schaffer collaterals. The following features of synaptic physiology were assessed: basal transmission, paired-pulse facilitation, repetitive low-frequency stimulation and long-term potentiation. The latter three properties were evaluated at a stimulation strength eliciting EPSPs of approximately half the maximal size. Analysis of paired-pulse facilitation was performed by delivering five pairs of stimuli at decreasing intervals (400, 200, 100, 50 and 25 ms). Response to low-frequency stimulation was explored by delivering two sets of 30 stimuli at 70 ms intervals repeated 30 s apart and averaged. To induce long-term potentiation, repeated brief trains of high frequency stimulation were delivered following a protocol consisting of five bursts of five pulses, each burst at 100 Hz, with 200 ms between bursts (theta-burst stimulation).
Data analysis
All data presented are expressed as the mean±SEM. The results were statistically evaluated for significance by using one-way analysis of variance, followed by Student's t-test, the NewmanKeuls multiple comparison test or Bonferoni post hoc test. Means among groups were considered significantly different when P<0.05.
| ACKNOWLEDGEMENTS |
|---|
This work was supported by grants from the Comunidad Autonoma de Madrid, grant CAM 8.5/49/2001 and Fondo de Investigaciones Sanitarias, FIS 2002/PI20265 to J.G.Y. and M.A.M., and from the Association France Parkinson to A.B. The authors thank Mrs Rosario Villaverde and Elodie Martín for technical help and Thomas Debeir, Rita Raisman, Patrick Michel and Etienne Hirsch for helpful discussions. This paper is dedicated to the memory of Nacer Abbas.
| FOOTNOTES |
|---|
* To whom correspondence should be addressed. Tel: +33 158932645; Fax: +33 158933685; Email: thomas.rooney{at}aventis.com
The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors. ![]()
| REFERENCES |
|---|
|
|
|---|
- de Rijk, M.C., Launer, L.J., Berger, K., Breteler, M.M., Dartigues, J.F., Baldereschi, M., Fratiglioni, L., Lobo, A., Martinez-Lage, J., Trenkwalder, C. and Hofman, A. (2000) Prevalence of Parkinson's disease in Europe: A collaborative study of population-based cohorts. Neurologic Diseases in the Elderly Research Group, Neurology, 54, S2123.[Web of Science][Medline]
- Elbaz, A., Bower, J.H., Maraganore, D.M., McDonnell, S.K., Peterson, B.J., Ahlskog, J.E., Schaid, D.J. and Rocca, W.A. (2002) Risk tables for parkinsonism and Parkinson's disease. J. Clin. Epidemiol., 55, 2531.[CrossRef][Web of Science][Medline]
- Jankovic, J. (1992) Pathophysiology and clinical assessment of motor symptoms in Parkinson's disease. In Koller, W.C. (ed.), Handbook of Parkinson's Disease. Marcel Dekker, New York, pp. 129157.
- Louis, E.D., Levy, G., Cote, L.J., Mejia, H., Fahn, S. and Marder, K. (2002) Diagnosing Parkinson's disease using videotaped neurological examinations: validity and factors that contribute to incorrect diagnoses. Mov. Disord., 17, 513517.[CrossRef][Web of Science][Medline]
- Forno, L.S. (1996) Neuropathology of Parkinson's disease. J. Neuropathol. Exp. Neurol., 55, 259272.[Web of Science][Medline]
- Dickson, D.W. (2001) Alpha-synuclein and the Lewy body disorders. Curr. Opin. Neurol., 14, 423432.[CrossRef][Web of Science][Medline]
-
Schneider, J.A., Bienias, J.L., Gilley, D.W., Kvarnberg, D.E., Mufson, E.J. and Bennett, D.A. (2002) Improved detection of substantia nigra pathology in Alzheimer's disease. J. Histochem. Cytochem., 50, 99106.
[Abstract/Free Full Text] - Beal, M.F. (2002) Oxidatively modified proteins in aging and disease. Free Radic. Biol. Med., 32, 797803.[CrossRef][Web of Science][Medline]
- Schapira, A.H., Gu, M., Taanman, J.W., Tabrizi, S.J., Seaton, T., Cleeter, M. and Cooper, J.M. (1998) Mitochondria in the etiology and pathogenesis of Parkinson's disease. Ann. Neurol., 44, S8998.[Web of Science][Medline]
- Betarbet, R., Sherer, T.B. and Greenamyre, J.T. (2002) Animal models of Parkinson's disease. Bioessays, 24, 308318.[CrossRef][Web of Science][Medline]
- Feger, J., Pessiglione, M., Francois, C., Tremblay, L. and Hirsch, E. (2002) Experimental models of Parkinson's disease. Ann. Pharm. Fr., 60, 321.[Medline]
- Gerlach, M. and Riederer, P. (1996) Animal models of Parkinson's disease: an empirical comparison with the phenomenology of the disease in man. J. Neural Transm., 103, 9871041.[CrossRef][Web of Science][Medline]
- Grunblatt, E., Mandel, S. and Youdim, M.B. (2000) Neuroprotective strategies in Parkinson's disease using the models of 6- hydroxydopamine and MPTP. Ann. NY Acad. Sci., 899, 262273.[CrossRef][Web of Science][Medline]
-
Polymeropoulos, M.H., Lavedan, C., Leroy, E., Ide, S.E., Dehejia, A., Dutra, A., Pike, B., Root, H., Rubenstein, J., Boyer, R. et al. (1997) Mutation in the alpha-synuclein gene identified in families with Parkinson's disease. Science, 276, 20452047.
[Abstract/Free Full Text] - Le, W.D., Xu, P., Jankovic, J., Jiang, H., Appel, S.H., Smith, R.G. and Vassilatis, D.K. (2003) Mutations in NR4A2 associated with familial Parkinson disease. Nat. Genet., 33, 8589.[CrossRef][Web of Science][Medline]
- Kitada, T., Asakawa, S., Hattori, N., Matsumine, H., Yamamura, Y., Minoshima, S., Yokochi, M., Mizuno, Y. and Shimizu, N. (1998) Mutations in the parkin gene cause autosomal recessive juvenile parkinsonism. Nature, 392, 605608.[CrossRef][Medline]
-
Lucking, C.B., Durr, A., Bonifati, V., Vaughan, J., De Michele, G., Gasser, T., Harhangi, B.S., Meco, G., Denefle, P., Wood, N.W. et al. (2000) Association between early-onset Parkinson's disease and mutations in the parkin gene. French Parkinson's Disease Genetics Study Group. New Engl. J. Med., 342, 15601567.
[Abstract/Free Full Text] -
Periquet, M., Latouche, M., Lohmann, E., Rawal, N., De Michele, G., Ricard, S., Teive, H., Fraix, V., Vidailhet, M., Nicholl, D. et al. (2003) Parkin mutations are frequent in patients with isolated early-onset parkinsonism. Brain, 126, 12711278.
[Abstract/Free Full Text] -
Abbas, N., Lucking, C.B., Ricard, S., Durr, A., Bonifati, V., De Michele, G., Bouley, S., Vaughan, J.R., Gasser, T., Marconi, R. et al. (1999) A wide variety of mutations in the parkin gene are responsible for autosomal recessive parkinsonism in Europe. French Parkinson's Disease Genetics Study Group and the European Consortium on Genetic Susceptibility in Parkinson's Disease. Hum. Mol. Genet., 8, 567574.
[Abstract/Free Full Text] -
Hoenicka, J., Vidal, L., Morales, B., Ampuero, I., Jimenez-Jimenez, F.J., Berciano, J., del Ser, T., Jimenez, A., Ruiz, P.G. and de Yebenes, J.G. (2002) Molecular findings in familial Parkinson disease in Spain. Arch. Neurol., 59, 966970.
[Abstract/Free Full Text] - Hayashi, S., Wakabayashi, K., Ishikawa, A., Nagai, H., Saito, M., Maruyama, M., Takahashi, T., Ozawa, T., Tsuji, S. and Takahashi, H. (2000) An autopsy case of autosomal-recessive juvenile parkinsonism with a homozygous exon 4 deletion in the parkin gene. Mov. Disord., 15, 884888.[CrossRef][Web of Science][Medline]
-
Mori, H., Kondo, T., Yokochi, M., Matsumine, H., Nakagawa-Hattori, Y., Miyake, T., Suda, K. and Mizuno, Y. (1998) Pathologic and biochemical studies of juvenile parkinsonism linked to chromosome 6q. Neurology, 51, 890892.
[Abstract/Free Full Text] -
Takahashi, H., Ohama, E., Suzuki, S., Horikawa, Y., Ishikawa, A., Morita, T., Tsuji, S. and Ikuta, F. (1994) Familial juvenile parkinsonism: clinical and pathologic study in a family. Neurology, 44, 437441.
[Abstract/Free Full Text] -
Van de Warrenburg, B.P., Lammens, M., Lucking, C.B. Denefle, P., Wesseling, P., Booij, J., Praamstra, P., Quinn, N., Brice, A. and Horstink, M.W. (2001) Clinical and pathologic abnormalities in a family with parkinsonism and parkin gene mutations. Neurology, 56, 555557.
[Abstract/Free Full Text] - Farrer, M., Chan, P., Chen, R., Tan, L., Lincoln, S., Hernandez, D., Forno, L., Gwinn-Hardy, K., Petrucelli, L. et al. (2001) Lewy bodies and parkinsonism in families with parkin mutations. Ann. Neurol., 50, 293300.[CrossRef][Web of Science][Medline]
- Klein, C., Pramstaller, P.P., Kis, B., Page, C.C., Kann, M., Leung, J., Woodward, H., Castellan, C.C., Scherer, M., Vieregge, P. et al. (2000) Parkin deletions in a family with adult-onset, tremor-dominant parkinsonism: expanding the phenotype. Ann. Neurol., 48, 6571.[CrossRef][Web of Science][Medline]
- Morales, B., Martínez, A., Gonzalo I. Vidal, L., Gomez-Tortosa, E., Rabano, A., Ampuero, I., Sánchez, M., Hoenicka, J. and Garcia de Yebenes, J. (2002) SteeleRichardsonOlzewsky syndrome in a patient with a single C212Y mutation in the parkin protein. Mov. Disord., 17, 13741380.[CrossRef][Web of Science][Medline]
- Lohmann, E., Periquet, M., Bonifati, V., Wood, N.W., De Michele, G., Bonnet, A.M., Fraix, V., Broussolle, E., Horstink, M.W., Vidailhet, M., Verpillat, P. et al. (2003) How much phenotypic variation can be attributed to parkin genotype? The French Parkinson's Disease Genetics Study Group and the European Consortium on Genetic Susceptibility in Parkinson's Disease. Ann. Neurol., 54, 176185.[CrossRef][Web of Science][Medline]
- West, A., Periquet, M., Lincoln, S., Lucking, C.B., Nicholl, D., Bonifati, V., Rawal, N., Gasser, T., Lohmann, E., Deleuze J.F. et al. (2002) Complex relationship between Parkin mutations and Parkinson disease. Am. J. Med. Genet., 114, 584591.[CrossRef][Web of Science][Medline]
-
Zhang, Y., Gao, J., Chung, K.K., Huang, H., Dawson, V.L. and Dawson, T.M. (2000) Parkin functions as an E2-dependent ubiquitin-protein ligase and promotes the degradation of the synaptic vesicle-associated protein, CDCrel-1. Proc. Natl Acad. Sci. USA, 97, 1335413359.
[Abstract/Free Full Text] - Imai, Y., Soda, M., Inoue, H., Hattori, N., Mizuno, Y. and Takahashi, R. (2001) An unfolded putative transmembrane polypeptide, which can lead to endoplasmic reticulum stress, is a substrate of Parkin. Cell, 105, 891902.[CrossRef][Web of Science][Medline]
- Chung, K.K., Zhang, Y., Lim, K.L., Tanaka, Y., Huang, H., Gao, J., Ross, C.A., Dawson, V.L. and Dawson, T.M. (2001) Parkin ubiquitinates the alpha-synuclein-interacting protein, synphilin-1: implications for Lewy-body formation in Parkinson disease. Nat. Med., 7, 11441150.[CrossRef][Web of Science][Medline]
-
Shimura, H., Schlossmacher, M.G., Hattori, N., Frosch, M.P., Trockenbacher, A., Schneider, R., Mizuno, Y., Kosik, K.S. and Selkoe, D.J. (2001) Ubiquitination of a new form of alpha-synuclein by parkin from human brain: implications for Parkinson's disease. Science, 293, 263269.
[Abstract/Free Full Text] -
Greene, J.C., Whitworth, A.J., Kuo, I., Andrews, L.A., Feany, M.B. and Pollanck, L.J. (2003) Mitochondrial pathology and apoptotic muscle degeneration in Drosophila parkin mutants. Proc. Natl Acad. Sci. USA, 100, 40784083.
[Abstract/Free Full Text] - Zucker, R.S. (1989). Short-term synaptic plasticity. A. Rev. Neurosci., 12, 1331.[CrossRef][Web of Science][Medline]
-
Creager, R., Dunwiddie, T. and Lynch, G. (1980) Paired-pulse and frequency facilitation in the CA1 region of the in vitro rat hippocampus. J. Physiol., 299, 409424.
[Abstract/Free Full Text] -
Dunwiddie, T.V. and Haas, H.L. (1985) Adenosine increases synaptic facilitation in the in vitro rat hippocampus: evidence for a presynaptic site of action. J. Physiol., 369, 365377.
[Abstract/Free Full Text] - Beites, C.L., Xie, H., Bowser, R. and Trimble, W.S. (1999) The septin CDCrel-1 binds syntaxin and inhibits exocytosis. Nat. Neurosci., 2, 434439.[CrossRef][Web of Science][Medline]
-
Diaz-Torga, G., Feierstein, C., Libertun, C., Gelman, D., Kelly, M.A., Low, M.J., Rubinstein, M. and Becu-Villalobos, D. (2002) Disruption of the D2 dopamine receptor alters GH and IGF-I secretion and causes dwarfism in male mice. Endocrinology, 143, 12701279.
[Abstract/Free Full Text] - Lipton, J.M. and Clark, W.G. (1986) Neurotransmitters in temperature control. A. Rev. Physiol., 48, 613623.[CrossRef][Web of Science][Medline]
- Boulay, D., Depoortere, R., Perrault, G., Borrelli, E. and Sanger, D.J. (1999) Dopamine D2 receptor knock-out mice are insensitive to the hypolocomotor and hypothermic effects of dopamine D2/D3 receptor agonists. Neuropharmacology, 38, 13891396.[CrossRef][Web of Science][Medline]
- Bharath, S., Hsu, M., Kaur, D., Rajagopalan, S. and Andersen, J.K. (2002) Glutathione, iron and Parkinson's disease. Biochem. Pharmac., 64, 10371048.[CrossRef][Web of Science][Medline]
- Adams, J.D., Chang, M.L. and Klaidman, L.K. (2001) Parkinsons Disease-redox mechanisms. Curr. Med. Chem., 8, 809814.[Web of Science][Medline]
- Riederer, P., Sofic, E., Rausch, W.D., Schmidt, B., Reynolds, G.P., Jellinger, K. and Youdim, M.B. (1989) Transition metals, ferritin, glutathione, and ascorbic acid in parkinsonian brains. J. Neurochem., 52, 515520.[Web of Science][Medline]
- Sofic, E., Lange, K.W., Jellinger, K. and Riederer, P. (1992) Reduced and oxidized glutathione in the substantia nigra of patients with Parkinson's disease. Neurosci. Lett., 142, 128130.[CrossRef][Web of Science][Medline]
-
Hyun, D-H., Lee, M.H., Hattori, N., Kubo, S. I., Mizuno, Y., Halliwell, B. and Jenner, P. (2002) Effect of wild-type or mutant parkin on oxidative damage, nitric oxide, antioxidant defenses, and the proteasome. J. Biol. Chem., 277, 2857228577.
[Abstract/Free Full Text] -
Mena, M.A., Davila, V., Bogaluvsky, J. and Sulzer, D. (1998) A synergistic neurotrophic response to l-dihydroxyphenylalanine and nerve growth factor. Mol. Pharmac., 54, 678686.
[Abstract/Free Full Text] - Rodriguez-Marín, E., Canals, S., Casarejos, M.J., de Bernardo, S., Handler, A. and Mena, M.A. (2001) L-DOPA and glia-conditioned medium have additive effects on tyrosine hydroxylase expression in human catecholamine-rich neuroblastoma NB69 cells. J. Neurochem., 78, 535545.[CrossRef][Web of Science][Medline]
- Canals, S., Casarejos, M.J., de Bernardo, S., Rodriguez-Marín, E. and Mena, M.A. (2001) Glutathione depletion switches nitric oxide neurotrophic effects to cell death in midbrain cultures: implications for Parkinson's disease. J. Neurochem., 79, 11831195.[CrossRef][Web of Science][Medline]
-
Di Chiara, G. and Imperato, A. (1988) Drugs abused by humans preferentially increase synaptic dopamine concentrations in the mesolimbic system of freely moving rats. Proc. Natl Acad. Sci. USA, 85, 52745278.
[Abstract/Free Full Text] -
Rudnick, G. and Wall, S.C. (1992) The molecular mechanism of ecstasy [3,4-methylenedioxy-methamphetamine (MDMA)]: serotonin transporters are targets for MDMA-induced serotonin release. Proc. Natl Acad. Sci. USA, 89, 18171821.
[Abstract/Free Full Text] - Sulzer, D., Maidment, N.T. and Rayport, S. (1993) Amphetamine and other weak bases act to promote reverse transport of dopamine in ventral midbrain neurons. J. Neurochem., 60, 527535.[Web of Science][Medline]
- Sulzer, D., Chen, T.K., Lau, Y.Y., Kristensen, H., Rayport, S. and Ewing, A. (1995) Amphetamine redistributes dopamine from synaptic vesicles to the cytosol and promotes reverse transport. J. Neurosci., 15, 41024108.[Abstract]
- Giros, B., Jaber, M., Jones, S.R., Wightman, R.M. and Caron, M.G. (1996) Hyperlocomotion and indifference to cocaine and amphetamine in mice lacking the dopamine transporter. Nature, 379, 606612.[CrossRef][Medline]
- Patel, J., Mooslehner, K.A., Chan, P.M. Emson, P.C. and Stamford, J.A. (2003) Presynaptic control of striatal dopamine neurotransmission in adult vesicular monoamine transporter 2 (VMAT2) mutant mice. J. Neurochem., 85, 898910.[Web of Science][Medline]
- Shuldinger, S. (1994) A molecular glimpse of vesicular monoamine transporters. J. Neurochem., 62, 20672078.[Web of Science][Medline]
- Miller, G.W., Erickson, J.D., Perez, J.T., Penland, S.N., Mash, D.C., Rye, D.B. and Levey, A.I. (1999) Immunochemical analysis of vesicular monoamine transporter (VMAT2) protein in Parkinson's disease. Exp. Neurol., 156, 138148.[CrossRef][Web of Science][Medline]
- Fernandez, H.H., Friedman, J.H., Fischman, A.J., Noto, R.B. and Lannon, M.C. (2001) Is altropane SPECT more sensitive to fluoroDOPA PET for detecting early Parkinson's disease? Med. Sci. Monit., 7, 13391343.[Medline]
- Moll, G.H., Mehnert, C., Wicker, M., Bock, N., Rothenberger, A., Ruther, E. and Huether, G. (2000) Age-associated changes in the densities of presynaptic monoamine transporters in different regions of the rat brain from early juvenile life to late adulthood. Brain Res. Dev. Brain Res., 7, 251257.[CrossRef]
- Parkinson Study Group (2002) Dopamine transporter brain imaging to assess the effects of pramipexole vs levodopa on Parkinson disease progression. JAMA, 3, 16531661.
-
Cabin, D.E., Shimazu, K., Murphy, D., Cole, N.B., Gottschalk, W., McIlwain, K.L., Orrison, B., Chen, A., Ellis, C.E., Paylor, R. et al. (2002) Synaptic vesicle depletion correlates with attenuated synaptic responses to prolonged repetitive stimulation in mice lacking alpha-synuclein. J. Neurosci., 22, 87978807.
[Abstract/Free Full Text] - Kubo, S.I., Kitami, T., Noda, S., Shimura, H., Uchiyama, Y., Asakawa, S., Minoshima, S., Shimizu, N., Mizuno, Y. and Hattori, N. (2001) Parkin is associated with cellular vesicles. J. Neurochem., 78, 4254.[CrossRef][Web of Science][Medline]
- Abeliovich, A., Schmitz, Y., Farinas, I., Choi-Lundberg, D., Ho, W.H., Castillo, P.E., Shinsky, N., Verdugo, J.M., Armanini, M., Ryan, A. et al. (2000) Mice lacking alpha-synuclein display functional deficits in the nigrostriatal dopamine system. Neuron, 25, 239252.[CrossRef][Web of Science][Medline]
- Giasson, B.I., Duda, J.E., Quinn, S.M., Zhang, B., Trojanowski, J.Q. and Lee, V.M. (2002) Neuronal alpha-synucleinopathy with severe movement disorder in mice expressing A53T human alpha-synuclein. Neuron, 34, 521533.[CrossRef][Web of Science][Medline]
-
Lotharius, J., Barg, S., Wiekop, P., Lundberg, C., Raymon, H.K. and Brundin, P. (2002) Effect of mutant alpha-synuclein on dopamine homeostasis in a new human mesencephalic cell line. J. Biol. Chem., 277, 3888438894.
[Abstract/Free Full Text] -
Stefanis, L., Larsen, K.E., Rideout, H.J., Sulzer, D. and Greene, L.A. (2001) Expression of A53T mutant but not wild-type alpha-synuclein in PC12 cells induces alterations of the ubiquitin-dependent degradation system, loss of dopamine release, and autophagic cell death. J. Neurosci., 21, 95499560.
[Abstract/Free Full Text] - Owen, A.M., Iddon, J.L., Hodges, J.R., Summers, B.A. and Robbins, T.W. (1997) Spatial and non-spatial working memory at different stages of Parkinson's disease. Neuropsychologia, 35, 519532.[CrossRef][Web of Science][Medline]
-
Heberlein, I., Ludin, H.P., Scholz, J. and Vieregge, P. (1998) Personality, depression, and premorbid lifestyle in twin pairs discordant for Parkinson's disease. J. Neurol. Neurosurg. Psychiat., 64, 262266.
[Abstract/Free Full Text] - Menza, M. (2000) The personality associated with Parkinson's disease. Curr. Psychiatry Rep., 2, 421426.[Medline]
- O'Connor, L., Berry, J., Weiss, J. and Gilbert, P. (2002) Guilt, fear, submission, and empathy in depression. J. Affect. Disord., 71, 1319.
-
Cummings, J.L. (1992) Depression and Parkinson's disease. Am. J. Psychiat., 149, 443454.
[Abstract/Free Full Text] - Michel, P.P. and Hefti, F. (1990) Toxicity of 6-hydroxydopamine and dopamine for dopaminergic neurons in culture. J. Neurosci. Res., 26, 428435.[CrossRef][Web of Science][Medline]
- Mena, M.A., Pardo, B., Casarejos, M.J., Fahn, S. and Garcia de Yebenes, J. (1992) Neurotoxicity of levodopa on catecholamine-rich neurons. Mov. Disord., 7, 2331.[Web of Science][Medline]
- Murer, M.G., Dziewczapolski, G., Menalled, L.B., Garcia, M.C., Agid, Y., Gershanik, O. and Raisman-Vozari, R. (1998) Chronic levodopa is not toxic for remaining dopamine neurons, but instead promotes their recovery, in rats with moderate nigrostriatal lesions. Ann. Neurol., 43, 561575.[CrossRef][Web of Science][Medline]
- Troadec, J.D., Marien, M., Darios, F., Hartmann, A., Ruberg, M., Colpaert, F. and Michel, P.P. (2001) Noradrenaline provides long-term protection to dopaminergic neurons by reducing oxidative stress. J. Neurochem., 79, 200210.[CrossRef][Web of Science][Medline]
-
Troadec, J.D., Marien, M., Mourlevat, S., Debeir, T., Ruberg, M., Colpaert, F. and Michel, P.P. (2002) Activation of the mitogen-activated protein kinase (ERK1/2) signaling pathway by cyclic AMP potentiates the neuroprotective effect of the neurotransmitter noradrenaline on dopaminergic neurons. Mol. Pharmac., 62, 10431052.
[Abstract/Free Full Text] - Mena, M.A., Casarejos, M.J., Carazo, A., Paino, C.L. and Garcia de Yebenes, J. (1996) Glia conditioned medium protects fetal rat midbrain neurones in culture from L-DOPA toxicity. Neuroreport, 7, 441445.[Web of Science][Medline]
- Mena, M.A., Casarejos, M.J. and Garcia de Yebenes, J. (1999) The effect of glia-conditioned medium on dopamine neurons in culture. Modulation of apoptosis, tyrosine hydroxylase expression and 1-methyl-4-phenylpyridinium toxicity. J. Neural Transm., 106, 11051123.[CrossRef][Web of Science][Medline]
- Pardo, B., Mena, M.A., Casarejos, M.J., Paino, C.L. and De Yebenes, J.G. (1995). Toxic effects of L-DOPA on mesencephalic cell cultures: protection with antioxidants. Brain Res., 682, 133143.[CrossRef][Web of Science][Medline]
- Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
- Stichel, C., Augustin, M., Kühn, K., Zhu, X., Engels, P., Ullmer, C. and Lübbert, H. (2000) Parkin expression in adult mouse brain. Eur. J. Neurosci., 12, 115.[CrossRef][Web of Science][Medline]
- Jaffard, R., Dubois, M. and Galey, D. (1981) Memory of a choice direction in a T maze as measured by spontaneous alternation in mice: effects of intertribal interval and reward. Behav. Proc., 6, 1121.
- Hirsch, M.D. and Helke, C.J. (1988) Bulbospinal thyrotropin-releasing hormone projections to the intermediolateral cell column: a double fluorescence immunohistochemical-retrograde tracing study in the rat. Neuroscience, 25, 625637.[CrossRef][Web of Science][Medline]
-
Hunot, S., Brugg, B., Ricard, D., Michel, P.P., Muriel, M.P., Ruberg, M., Faucheux, B.A., Agid, Y. and Hirsch, E.C. (1997) Nuclear translocation of NF-kappaB is increased in dopaminergic neurons of patients with parkinson disease. Proc. Natl Acad. Sci. USA, 94, 75317536.
[Abstract/Free Full Text] - Mena, M.A., Casarejos, M.J., Bonin, A., Ramos, J.A. and Garcia de Yebenes, J. (1995) Effects of dibutyryl cyclic AMP and retinoic acid on the differentiation of dopamine neurons: prevention of cell death by dibutyryl cyclic AMP. J. Neurochem., 65, 26122620.[Web of Science][Medline]
- Handler, A., Lobo, M.V.T., Alonso, F.J., Paino, C.L. and Mena, M.A. (2000) Functional implications of the noradrenergic-cholinergic switch induced by retinoic acid in NB69 neuroblastoma cells. J. Neurosci. Res., 60, 311320.[CrossRef][Web of Science][Medline]
- Carlsson, A. and Lindqvist, M. (1973) Effect of ethanol on the hydroxylation of tyrosine and tryptophan in rat brain in vivo. J. Pharm. Pharmac., 25, 437440.[Web of Science][Medline]
- Garcia de Yebenes, J., Carlsson, A. and Mena, M.A. (1978) The effect of taurine on motor behavior, body temperature and monoamine metabolism in rat brain. Naunyn-Smiedeberg Archv. Pharmac., 304, 9599.[CrossRef]
- Tietze, F. (1969) Enzymic method for quantitative determination of nanogram amounts of total and oxidized glutathione: applications to mammalian blood and other tissues. Anal. Biochem., 27, 502522.[CrossRef][Web of Science][Medline]
- Griffith, O.W. (1980) Determination of glutathione and glutathione disulfide using glutathione reductase and 2-vinylpyridine. Anal. Biochem., 106, 207212.[CrossRef][Web of Science][Medline]
-
Mena, M.A., Casarejos, M.J., Carazo, A., Paino, C.L. and Garcia de Yebenes, J. (1997) Glia protect fetal midbrain dopamine neurons in culture from L-DOPA toxicity through multiple mechanisms. J. Neural.Transm., 104, 317328.
This article has been cited by other articles:
![]() |
M. P. Hart and A. Xu Mice Expressing Mutant Parkin Exhibit Hallmark Features of Parkinson's Disease J. Neurosci., June 10, 2009; 29(23): 7392 - 7394. [Full Text] [PDF] |
||||
![]() |
X.-H. Lu, S. M. Fleming, B. Meurers, L. C. Ackerson, F. Mortazavi, V. Lo, D. Hernandez, D. Sulzer, G. R. Jackson, N. T. Maidment, et al. Bacterial Artificial Chromosome Transgenic Mice Expressing a Truncated Mutant Parkin Exhibit Age-Dependent Hypokinetic Motor Deficits, Dopaminergic Neuron Degeneration, and Accumulation of Proteinase K-Resistant {alpha}-Synuclein J. Neurosci., February 18, 2009; 29(7): 1962 - 1976. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. D. Helton, T. Otsuka, M.-C. Lee, Y. Mu, and M. D. Ehlers Pruning and loss of excitatory synapses by the parkin ubiquitin ligase PNAS, December 9, 2008; 105(49): 19492 - 19497. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Mena and J. Garcia de Yebenes Glial Cells as Players in Parkinsonism: The "Good," the "Bad," and the "Mysterious" Glia Neuroscientist, December 1, 2008; 14(6): 544 - 560. [Abstract] [PDF] |
||||
![]() |
T. C. Frank-Cannon, T. Tran, K. A. Ruhn, T. N. Martinez, J. Hong, M. Marvin, M. Hartley, I. Trevino, D. E. O'Brien, B. Casey, et al. Parkin Deficiency Increases Vulnerability to Inflammation-Related Nigral Degeneration J. Neurosci., October 22, 2008; 28(43): 10825 - 10834. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Rodriguez-Navarro, A. Gomez, I. Rodal, J. Perucho, A. Martinez, V. Furio, I. Ampuero, M. J. Casarejos, R. M. Solano, J. G. de Yebenes, et al. Parkin deletion causes cerebral and systemic amyloidosis in human mutated tau over-expressing mice Hum. Mol. Genet., October 15, 2008; 17(20): 3128 - 3143. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Solano, M. J. Casarejos, J. Menendez-Cuervo, J. A. Rodriguez-Navarro, J. Garcia de Yebenes, and M. A. Mena Glial Dysfunction in Parkin Null Mice: Effects of Aging J. Neurosci., January 16, 2008; 28(3): 598 - 611. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Cookson, W. Dauer, T. Dawson, E. A. Fon, M. Guo, and J. Shen The Roles of Kinases in Familial Parkinson's Disease J. Neurosci., October 31, 2007; 27(44): 11865 - 11868. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. C. Stichel, X.-R. Zhu, V. Bader, B. Linnartz, S. Schmidt, and H. Lubbert Mono- and double-mutant mouse models of Parkinson's disease display severe mitochondrial damage Hum. Mol. Genet., October 15, 2007; 16(20): 2377 - 2393. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Joch, A. R. Ase, C. X.-Q. Chen, P. A. MacDonald, M. Kontogiannea, A. T. Corera, A. Brice, P. Seguela, and E. A. Fon Parkin-mediated Monoubiquitination of the PDZ Protein PICK1 Regulates the Activity of Acid-sensing Ion Channels Mol. Biol. Cell, August 1, 2007; 18(8): 3105 - 3118. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kitada, A. Pisani, D. R. Porter, H. Yamaguchi, A. Tscherter, G. Martella, P. Bonsi, C. Zhang, E. N. Pothos, and J. Shen From the Cover: Impaired dopamine release and synaptic plasticity in the striatum of PINK1-deficient mice PNAS, July 3, 2007; 104(27): 11441 - 11446. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Mandemakers, V. A. Morais, and B. De Strooper A cell biological perspective on mitochondrial dysfunction in Parkinson disease and other neurodegenerative diseases J. Cell Sci., May 15, 2007; 120(10): 1707 - 1716. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hatano, S.-i. Kubo, S. Imai, M. Maeda, K. Ishikawa, Y. Mizuno, and N. Hattori Leucine-rich repeat kinase 2 associates with lipid rafts Hum. Mol. Genet., March 15, 2007; 16(6): 678 - 690. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Yi and M. D. Ehlers Emerging Roles for Ubiquitin and Protein Degradation in Neuronal Function Pharmacol. Rev., March 1, 2007; 59(1): 14 - 39. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kitao, Y. Imai, K. Ozawa, A. Kataoka, T. Ikeda, M. Soda, K. Nakimawa, H. Kiyama, D. M. Stern, O. Hori, et al. Pael receptor induces death of dopaminergic neurons in the substantia nigra via endoplasmic reticulum stress and dopamine toxicity, which is enhanced under condition of parkin inactivation Hum. Mol. Genet., January 1, 2007; 16(1): 50 - 60. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Menendez, J.A. Rodriguez-Navarro, R.M. Solano, M.J. Casarejos, I. Rodal, R. Guerrero, M.P. Sanchez, J. Avila, M.A. Mena, and J.G. de Yebenes Suppression of Parkin enhances nigrostriatal and motor neuron lesion in mice over-expressing human-mutated tau protein Hum. Mol. Genet., July 1, 2006; 15(13): 2045 - 2058. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Escalier Knockout mouse models of sperm flagellum anomalies Hum. Reprod. Update, July 1, 2006; 12(4): 449 - 461. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Jenner and C. W. Olanow The pathogenesis of cell death in Parkinson's disease Neurology, May 23, 2006; 66(10_suppl_4): S24 - S36. [Abstract] [Full Text] |
||||
![]() |
V. Bryja, S. Bonilla, L. Cajanek, C. L. Parish, C. M. Schwartz, Y. Luo, M. S. Rao, and E. Arenas An Efficient Method for the Derivation of Mouse Embryonic Stem Cells Stem Cells, April 1, 2006; 24(4): 844 - 849. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Jiang, Q. Jiang, W. Liu, and J. Feng Parkin Suppresses the Expression of Monoamine Oxidases J. Biol. Chem., March 31, 2006; 281(13): 8591 - 8599. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A.F. Marteijn, L. van Emst, C. A.J. Erpelinck-Verschueren, G. Nikoloski, A. Menke, T. de Witte, B. Lowenberg, J. H. Jansen, and B. A. van der Reijden The E3 ubiquitin-protein ligase Triad1 inhibits clonogenic growth of primary myeloid progenitor cells Blood, December 15, 2005; 106(13): 4114 - 4123. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Springer, T. Hoppe, E. Schmidt, and R. Baumeister A Caenorhabditis elegans Parkin mutant with altered solubility couples {alpha}-synuclein aggregation to proteotoxic stress Hum. Mol. Genet., November 15, 2005; 14(22): 3407 - 3423. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. P. O'Brien, G. S. Johnson, R. D. Schnabel, S. Khan, J. R. Coates, G. C. Johnson, and J. F. Taylor Genetic Mapping of Canine Multiple System Degeneration and Ectodermal Dysplasia Loci J. Hered., November 1, 2005; 96(7): 727 - 734. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Sriram, X. Li, H. S. Ko, K. K.K. Chung, E. Wong, K. L. Lim, V. L. Dawson, and T. M. Dawson Familial-associated mutations differentially disrupt the solubility, localization, binding and ubiquitination properties of parkin Hum. Mol. Genet., September 1, 2005; 14(17): 2571 - 2586. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. S. Ko, R. von Coelln, S. R. Sriram, S. W. Kim, K. K. K. Chung, O. Pletnikova, J. Troncoso, B. Johnson, R. Saffary, E. L. Goh, et al. Accumulation of the Authentic Parkin Substrate Aminoacyl-tRNA Synthetase Cofactor, p38/JTV-1, Leads to Catecholaminergic Cell Death J. Neurosci., August 31, 2005; 25(35): 7968 - 7978. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zhong, Y. Tan, A. Zhou, Q. Yu, and J. Zhou RING Finger Ubiquitin-Protein Isopeptide Ligase Nrdp1/FLRF Regulates Parkin Stability and Activity J. Biol. Chem., March 11, 2005; 280(10): 9425 - 9430. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. A. Perez and R. D. Palmiter Parkin-deficient mice are not a robust model of parkinsonism PNAS, February 8, 2005; 102(6): 2174 - 2179. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Jiang, Q. Jiang, and J. Feng Parkin Increases Dopamine Uptake by Enhancing the Cell Surface Expression of Dopamine Transporter J. Biol. Chem., December 24, 2004; 279(52): 54380 - 54386. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Jiang, Y. Ren, J. Zhao, and J. Feng Parkin protects human dopaminergic neuroblastoma cells against dopamine-induced apoptosis Hum. Mol. Genet., August 15, 2004; 13(16): 1745 - 1754. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. von Coelln, B. Thomas, J. M. Savitt, K. L. Lim, M. Sasaki, E. J. Hess, V. L. Dawson, and T. M. Dawson Loss of locus coeruleus neurons and reduced startle in parkin null mice PNAS, July 20, 2004; 101(29): 10744 - 10749. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Marazziti, E. Golini, S. Mandillo, A. Magrelli, W. Witke, R. Matteoni, and G. P. Tocchini-Valentini Altered dopamine signaling and MPTP resistance in mice lacking the Parkinson's disease-associated GPR37/parkin-associated endothelin-like receptor PNAS, July 6, 2004; 101(27): 10189 - 10194. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Lorenzetti, C. E. Bishop, and M. J. Justice Deletion of the Parkin coregulated gene causes male sterility in the quakingviable mouse mutant PNAS, June 1, 2004; 101(22): 8402 - 8407. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Marin, J. I. Lucas, A.-C. Gradilla, and A. Ferrus Parkin and relatives: the RBR family of ubiquitin ligases Physiol Genomics, May 19, 2004; 17(3): 253 - 263. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Pesah, T. Pham, H. Burgess, B. Middlebrooks, P. Verstreken, Y. Zhou, M. Harding, H. Bellen, and G. Mardon Drosophila parkin mutants have decreased mass and cell size and increased sensitivity to oxygen radical stress Development, May 1, 2004; 131(9): 2183 - 2194. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Palacino, D. Sagi, M. S. Goldberg, S. Krauss, C. Motz, M. Wacker, J. Klose, and J. Shen Mitochondrial Dysfunction and Oxidative Damage in parkin-deficient Mice J. Biol. Chem., April 30, 2004; 279(18): 18614 - 18622. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. F. Mata, P. J. Lockhart, and M. J. Farrer Parkin genetics: one model for Parkinson's disease Hum. Mol. Genet., April 1, 2004; 13(90001): R127 - 133. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Baptista, M. R. Cookson, and D. W. Miller Parkin and {alpha}-Synuclein: Opponent Actions in The Pathogenesis of Parkinson'S Disease Neuroscientist, February 1, 2004; 10(1): 63 - 72. [Abstract] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||







Deceased. 













