Human Molecular Genetics Advance Access originally published online on August 5, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Human Molecular Genetics, 2003, Vol. 12, No. 19 2503-2510
DOI: 10.1093/hmg/ddg266
© 2003 Oxford University Press
Direct interaction of the Fanconi anaemia protein FANCG with BRCA2/FANCD1
1Division of Genetics and Development, Guy's, King's and St Thomas' School of Medicine, King's College London, 8th Floor, Guy's Tower, Guy's Hospital, London SE1 9RT, UK and 2Cancer Research UK Gene Function and Regulation Group, The Breakthrough Breast Cancer Research Centre, The Institute of Cancer Research, Fulham Road, London SW3 6JB, UK
Received May 9, 2003; Revised July 15, 2003; Accepted July 30, 2003
| ABSTRACT |
|---|
|
|
|---|
Fanconi anaemia (FA) is an autosomal recessive genetic disorder characterized by progressive bone marrow failure, multiple congenital abnormalities, and an increased risk of cancer. FA cells are characterized by chromosomal instability and hypersensitivity to DNA interstrand crosslinking agents. At least eight complementation groups exist (FA-A to G), and the genes for all of these except FA-B have been cloned. Functional linkage between the FA pathway and genes involved in susceptibility to breast cancer has been demonstrated by the interaction of the FANCA and FANCD2 proteins with BRCA1, and the discovery that the FANCD1 gene is identical to BRCA2. Here we have used the yeast two-hybrid system to test for direct interaction between BRCA2 or its effector RAD51 and the FANCA, FANCC and FANCG proteins. We found that FANCG was capable of binding to two separate sites in the BRCA2 protein, located either side of the BRC repeats. Furthermore, FANCG could be co-immunoprecipitated with BRCA2 from human cells, and FANCG co-localized in nuclear foci with both BRCA2 and RAD51 following DNA damage with mitomycin C. These results demonstrate that BRCA2 is directly connected to a pathway that is deficient in interstrand crosslink repair, and that at least one other FA protein is closely associated with the homologous recombination DNA repair machinery.
| INTRODUCTION |
|---|
|
|
|---|
Fanconi anaemia (FA) is an autosomal recessive genetic disorder characterized by progressive bone marrow failure, multiple congenital abnormalities and an increased risk of cancer, particularly acute myeloid leukaemia. The cellular phenotype is characterized by chromosomal instability and hypersensitivity to DNA interstrand crosslinking (ICL) agents such as mitomycin C (MMC), diepoxybutane and cisplatin. At least eight complementation groups are known to exist (FA-A, B, C, D1, D2, E, F and G) (1), and the genes for all of these groups except FA-B have been identified (29). The FANCA, FANCC, FANCE, FANCF and FANCG proteins are thought to form a nuclear complex (1015) which is required for the mono-ubiquitination of the FANCD2 protein (8,16). The modified form of this protein may then contribute to DNA repair by an unknown mechanism. Functional studies of FANCD2 have provided a link between the FA pathway and breast cancer susceptibility genes. Mono-ubiquitinated FANCD2 co-localizes with BRCA1 in nuclear foci at S-phase and following DNA damage, and BRCA1 is required for the damage-dependent mono-ubiquitination of FANCD2 (16). Further links between these pathways come from evidence for direct interaction of the FANCA protein with BRCA1 (17), and the recent finding of bi-allelic mutations in the BRCA2 gene in several cell lines from complementation group FA-D1 (9). Furthermore, the wild-type BRCA2 gene functionally complements FA-D1 cells, indicating that FANCD1 and BRCA2 are the same gene (9). However, since FA nuclear complex formation and mono-ubiquitination of FANCD2 appear to be normal in FA-D1 cell lines (12,14,18), it is unclear whether BRCA2 functions in concert with the other FA proteins or whether it is part of a distinct pathway.
BRCA2 is a large protein consisting of 3418 amino acids. It has been shown to interact directly with the key homologous recombination (HR) protein RAD51 via a series of eight BRC repeats in the central part of the protein and a region in the C-terminus (19), and is thought to play a major role in regulating RAD51 activity by controlling its ability to bind single-stranded DNA (ssDNA) and form the nucleoprotein filaments required for the HR process (20). Since the HR pathway in mammalian cells is thought to have an integral role in the repair of ICLs (21), it is quite possible that the BRCA2RAD51 complex is part of the FA ICL repair pathway. We have used the yeast two-hybrid system to test for direct interaction between the FANCA, FANCC and FANCG proteins and BRCA2 or RAD51, and further investigated positive interactions by co-immunoprecipitation and co-localization studies in human cells.
| RESULTS |
|---|
|
|
|---|
Yeast two-hybrid analysis
In this study we have used the yeast two-hybrid system to test for direct interaction of the FANCA, FANCC and FANCG proteins with BRCA2 or RAD51. In view of the large size of the BRCA2 protein and the presence of an N-terminal transactivation domain, it was tested for interaction using a series of overlapping fragments cloned into the GAL4 DNA binding domain vector (BD).These covered the entire coding region of the gene (see Fig. 1A). The fragment of BRCA2 encoding the N-terminal amino acid residues 1523 was cloned into the activation domain vector for testing against the FA proteins, since it is strongly auto-activated when fused to GAL4-BD (see Methods). Examples of filters showing reporter gene activation and negative controls are shown in Figure 1B. No interactions were detected between the full length FANCA or FANCC proteins and any of the BRCA2 fragments in at least three independent experiments (data not shown). However, several BRCA2 fragments interacted reproducibly with FANCG in both co-transfection and yeast mating experiments (Fig. 1A and B). These data indicate that FANCG is capable of binding to two separate sites in BRCA2, one in the N-terminal and one in the C-terminal region of the protein. The N-terminal BRCA2 interacting fragments spanned amino acids 499994 and 6731167, but the interaction with amino acids 499994 produced much stronger reporter gene activation than with amino acids 6731167, suggesting that residues 499672 are likely to be important for the interaction in this region. FANCG also interacted with five overlapping fragments in the C-terminal region of BRCA2 spanning amino acids 21182967 (Fig. 1A). Extrapolation of the mapping data (Fig. 1) indicates that this region of interaction with FANCG involves amino acids 23502967, with the region from 23502545 producing the strongest activation of the reporter genes. The locations of the two FANCG binding sites in BRCA2 are indicated in Figure 1C.
|
The relative strengths of these interactions were assessed by semi-quantitative analysis based on the extent of reporter gene activation (13,22). Figure 2 shows that reporter gene activation for both the FANCG-BRCA2 amino acids 499994 and FANCG-BRCA2 amino acids 21182566 interactions was very similar to the strength of reporter gene activation for the FANCA-FANCG protein pair, which is a previously characterized and very strong interaction (11,13). In order to map the site of interaction in FANCG with the C-terminal region of BRCA2, we tested a series of FANCG fragments described previously (22) for their ability to interact with the BRCA2 amino acids 21182566 fragment. It was found that both the N-terminal (amino acids 1313) and C-terminal (amino acids 305622) segments of FANCG retained the ability to interact with BRCA2, but that reporter gene activation was greatly reduced in both instances (Fig. 2). This indicates that binding of FANCG to BRCA2 is not confined to a single defined region of FANCG. The patient-derived mutation FANCG-G546R (23,24) did not disrupt the interaction of FANCG with BRCA2 in the yeast two-hybrid analysis (data not shown), but this mutation also does not prevent the interaction of FANCG with either FANCA or FANCF (25).
|
In this study we also tested for direct interaction of FANCA, FANCC and FANCG with RAD51 in the yeast two-hybrid system. Although full-length RAD51 was found to interact readily with itself (Fig. 2), an interaction which has been well established (26), no interaction was found when it was tested against FANCA, FANCC or FANCG in three independent experiments (data not shown).
FANCG co-immunoprecipitates with BRCA2
In order to confirm the interaction of FANCG with BRCA2, we transiently transfected human embryonic kidney (HEK) 293T cells with plasmids encoding Myc-tagged FANCG and the C-terminal region of BRCA2 (amino acids 21263418) tagged with the Flag epitope. Immunoprecipitation was performed using Flag antibody, followed by western blotting with Myc antibody. These experiments confirmed that the C terminal fragment of BRCA2 was able to interact with FANCG (Fig. 3, lane 2). As a negative control, Flag-tagged CYLD (a gene with no known connections to the FA pathway) and Myc-tagged FANCG were co-transfected and subjected to immunoprecipitation with Flag antibody; no FANCG was pulled down (Fig. 3, lane 1).
|
FANCG co-localizes with RAD51 and BRCA2 following DNA damage
In view of the BRCA2FANCG interaction in the yeast two-hybrid system, and their co-immunoprecipitation from human cells, we next tested for the ability of FANCG to co-localize into nuclear foci containing RAD51 and BRCA2 following a relevant form of DNA damage. Initially we sought to optimize the conditions under which DNA repair foci formed following treatment with mitomycin C (MMC). HeLa cells were exposed to a range of concentrations of MMC for various periods of time, and cells were stained for endogenous RAD51 using an affinity-purified mouse monoclonal anti-RAD51 antibody. It was found that treating cells with 50 ng/ml MMC for 1 h followed by a 3 h incubation period caused an optimal and dramatic increase in the number of cells containing RAD51 foci and in the number of foci per cell (Fig. 4A). An MMC concentration of 40 ng/ml was previously shown to induce nuclear foci of FANCD2 in HeLa cells (27). In order to assess whether FANCG also co-localized to these foci, HeLa cells were transfected with EGFP-tagged FANCG, stained for endogenous RAD51, and examined by confocal immunofluorescence microscopy. Before MMC treatment, FANCG and RAD51 were found mostly in a diffuse nuclear pattern (Fig. 4B). RAD51 foci were present in some cells, but FANCG did not co-localize in the majority of these (Table 1). However, following MMC treatment, FANCG and RAD51 co-localized in about 90% of nuclear foci (Fig. 4B and Table 1). Since we had observed that FANCG and RAD51 did not bind each other directly in the yeast two-hybrid system, the interaction detected here is likely to be indirect, and may occur via BRCA2, given the FANCG-BRCA2 interaction that we detected in the yeast two-hybrid system.
|
|
Using the same experimental conditions as for RAD51, we next tested to see whether EGFP-FANCG was able to co-localize with BRCA2. In these experiments an affinity-purified rabbit polyclonal anti-BRCA2 antibody was used to stain for endogenous BRCA2. Although we were able to detect some BRCA2 nuclear dots in some cells before MMC treatment, FANCG co-localized to only a minority of these sites (Table 2). However, following MMC treatment the number of BRCA2 foci per cell increased substantially, and FANCG co-localized to more than 90% of these foci (Fig. 4C and Table 2). Taken together, these data indicate that FANCG and BRCA2 together with RAD51 co-operate in mounting the cellular response to damage with ICL agents.
|
| DISCUSSION |
|---|
|
|
|---|
In this study we describe the first reported interaction of BRCA2 with another component of the FA pathway, the FANCG protein. The interaction was detected initially by yeast two-hybrid analysis, and confirmed in multiple co-transfection and yeast mating experiments. The FANCA and FANCC proteins did not bind to any BRCA2 fragments in these assays. Further support for the biological significance of the BRCA2-FANCG interaction was obtained by co-immunoprecipitation of these proteins after transient transfection into human cells, and by demonstration of their co-localization in HeLa cells. This interaction is likely to be dependent in vivo on the prior induction of DNA damage, since the degree of co-localization increased dramatically after incubation of HeLa cells with MMC. Immunoprecipitation of the endogenous FANCG protein does not routinely pull down BRCA2 (A.L. Medhurst and E. Witt, unpublished data). This suggests that the BRCA2-FANCG interaction is not part of the constitutive FA protein core complex of FANCA, FANCC, FANCE, FANCF and FANCG, and may therefore have a different and more transient role in the crosslink repair pathway (see below).
The FANCG protein was capable of binding to two distinct sites in the BRCA2 protein, which map either side of the BRC repeat region. The N-terminal binding site is not highly conserved (28), and does not contain known functional motifs. However, the C-terminal binding site overlaps with the BLAT domain, a region which we have previously shown to be highly conserved between diverse species (28). In addition, many disease-associated missense mutations map to this region (29). These observations suggest an important function for this segment of BRCA2. We have previously reported that the DSS1 protein, encoded by a gene that is deleted in human hereditary split handsplit foot syndrome, binds to the BRCA2 region amino acids 24722947 (30). This segment of BRCA2 interacted weakly with FANCG in our yeast two-hybrid analysis. However, DSS1 does not interact with BRCA2 amino acids 21182566, which is the segment which produces the strongest activation of the reporter gene with FANCG, thus it is likely that this 70 amino acid peptide and FANCG have independent binding sites in this C-terminal region of BRCA2. The tertiary structure of this C-terminal region of BRCA2 has recently been solved (31). It was found that amino acids 24702670 consisted of a series of 10 alpha helices, whilst amino acids 26703200 formed three adjacent oligonucleotide binding (OB) folds, with the first OB fold (OB1) being comprised of amino acid residues 26702810. Our yeast two-hybrid mapping data (Fig. 1A) indicate that FANCG binds to the alpha helical domain of BRCA2, with the OB1 fold also participating in the interaction. It has recently been suggested, on the basis of database searches, that FANCG contains a proteinprotein interaction motif known as a tetratricopeptide repeat (TPR) motif (32). Interestingly, the crystal structure of this motif has also been solved, and has been shown to be capable of forming structures ideally suited to accept alpha helices from a target protein (33).
How do our results fit into current models of the FA pathway? FANCD1/BRCA2 is thought to be a downstream target in the pathway, whereby the FA complex consisting of FANCA, C, E, F and G is involved in the mono-ubiquitination of the FANCD2 protein, which then interacts with the BRCA2-RAD51 complex (34). However, given the FANCG-BRCA2 interaction described in this study, the situation is likely to be more complex. Since FA nuclear complex formation and FANCD2 mono-ubiquitination are normal in FA-D1 cells (12,14,18), it seems unlikely that BRCA2 functions in the FA core complex. However, it is not known whether the FA complex exists as a constitutive multi-subunit complex or whether smaller subunits can have discrete functions in the cell (35). Therefore, although FANCG is part of the FANCD2 ubiquitinating FA complex, it may also have some additional role in the repair process via an independent interaction with BRCA2 that occurs in response to the relevant form of DNA damage (Fig. 5). This is in some respects not unlike the situation with BRCA1, which has been shown to be required for damage dependent FANCD2 mono-ubiquitination (16), and is also thought to be more intimately associated with the HRR machinery (36,37). Indeed, if the FA pathway is a major player in the repair of ICLs, it is perhaps likely that some of the FA proteins have more intimate roles in the repair process than the previously proposed model would suggest.
|
What might the precise function of the FANCGBRCA2 interaction be? Our results showed that FANCG was capable of binding BRCA2 either side of the RAD51-binding BRC repeats. Structural analysis of the BRC repeat 4RAD51 complex has shown that a single BRC repeat is capable of binding to the core region of a single RAD51 molecule (38). However, weakening RAD51 affinity by a mutation in just one BRC repeat was enough to increase breast cancer susceptibility, and thus the remaining seven repeats are not able to compensate for function. The authors propose that the eight repeats cooperate as an RAD51-binding module, and that by simultaneous interaction via successive repeats BRCA2 may help to order the spatial distribution of RAD51 molecules when they are loaded onto ssDNA during nucleoprotein filament formation. The structural symmetry of FANCG binding to BRCA2 in relation to the BRC repeats may therefore be relevant, and it is possible that FANCG helps BRCA2 to achieve the unloading of groups of RAD51 molecules in a particularly ordered fashion. Damage-dependent RAD51 foci formation is also impaired in FA complementation groups, including in FA-G cells (39,40). FANCG may therefore have some general role in regulating the coordinated release of RAD51 onto ssDNA. The initiation of RAD51 nucleoprotein filament formation has also been attributed to the function of the RAD51 paralogues, whose chicken DT40 mutant cell lines have been shown to have very similar phenotypes to FA cells (41). It has recently been demonstrated that normal replication-associated S-phase RAD51 foci and damage-dependent RAD51 foci assemble by distinct pathways, being BRCA2-independent and BRCA2-dependent respectively (42). A related observation was made in this study where FANCG does not seem to associate significantly with normal S-phase RAD51 foci but does so only after DNA-damage. FANCG and BRCA2 may therefore only be involved in assisting RAD51-mediated recombination specifically in response to DNA damage. FANCD2, however, is capable of co-localizing with S-phase RAD51 foci in untreated cells (43).
In conclusion, the interaction that has been detected between FANCG and BRCA2 demonstrates a direct link between the Fanconi anaemia pathway and a protein with an important role in homologous recombination repair. A priority for further study will be to establish the molecular nature of the connection between the mono-ubiquitination of FANCD2 and the recruitment of BRCA2 to the repair of DNA interstrand crosslinks.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmid constructs
Yeast two-hybrid FANCA, FANCC and FANCG fragment plasmid constructs (22) and BRCA2 fragment constructs (30) were generated as described previously to generate in-frame fusions with either the GAL4 DNA binding domain (BD) or activation domain (AD). The Gly546Arg mutant of FANCG was made by site-directed mutagenesis as described (44). Reverse transcription (RT) from total RNA was done to obtain the full length RAD51 cDNA using the Omniscript RT kit (Qiagen) according to the manufacturer's instructions. The primer used for the RT was 5'TTTCCCGGAAGCTTTATCCTGG3'. Subsequent PCR was done using the platinum pfx high fidelity DNA polymerase system (Life Technologies) for the introduction of restriction sites and the amplification of RAD51 cDNA. The primer sequences used were forward primer 5'TCGGAGCCCGGGGCCTGCTG3' and reverse primer 5'TCTCATTAGGCTGCAGCACTTAAGG3'. The product was digested and ligated using the SmaI and PstI sites of the pGBKT7 and pGADT7 vectors to give in-frame fusions with the GAL4 DNABD and GAL4 DNAAD respectively. Direct sequencing was used to verify the presence of the wild-type sequence.
In order to generate the pEGFPFANCG construct, the full-length FANCG cDNA was initially subcloned into the pDNR vector (Clontech) from the pGADT7FANCG construct (22). The FANCG insert was then shuttled from the pDNRFANCG vector into the plpEGFP vector (Clontech) using the Creator cre-loxP cre-recombinase system (Clontech) to give an in-frame fusion of the FANCG insert with the EGFP sequence. pFANCGmyc was made by subcloning the insert from pEGFP.FANCG into pcDNA3.1myc [pcDNA3.1(+) with 6xmyc tags inserted]. pBRCA2.C flag was made by subcloning nt 660310251 into a construct derived from pMTSM which had been modified to contain an N-terminal flag-tag and was named pMTSMIVS.
Yeast two-hybrid assays
The MATCHMAKER Two Hybrid System 3 (Clontech) was used for yeast two-hybrid analysis according to the manufacturer's instructions and as described previously (13). Briefly, bait and prey constructs were either sequentially transformed into yeast cells and subjected to selection on (-trp-leu-his-ade) medium, or transformed separately into two different yeast strains and mating cultures plated onto selection medium. Colonies were then transferred onto filters and tested for ß-galactosidase expression with X-gal. Each experiment was performed at least three times, and constructs were tested for self-activation and against a series of control plasmids. 3-Aminotriazole, 5 mM, was added to growth media to suppress autoactivation of some constructs. The BRCA2 gene was divided into fragments for yeast two-hybrid testing since the transactivation domain at its N-terminus causes autoactivation of reporters and prevents testing of the full-length BRCA2 protein. A semi-quantitative test of interaction strength based on the extent of reporter gene activation was carried out in mating assays as previously described (13,22), where reporter gene activation=[nxC/txln T ], where n=number of blue colonies, C=intensity of blue colour, t=time of colony growth prior to LacZ expression testing and T=time taken for colour development.
Co-immunoprecipitation
Human embryonic kidney (HEK) 293T cells were grown at 37°C at 10% CO2 in Dulbecco's modified essential media+10% fetal calf serum (FCS; Life Technologies). Constructs were transiently transfected into the cells using Effectene (Qiagen) and lysates were harvested at 48 h using 0.25 ml NP40 lysis buffer per 10 cm plate. Immunoprecipitation was performed by incubating protein G beads, lysate and antibody rotating at 4°C overnight. Antibodies used were M2 flag antibody (Sigma) and c-myc A14 rabbit antibody (Santa Cruz). The beads were then suspended in sodium dodecyl sulphate (SDS) sample buffer, boiled and separated by electrophoresis on 8 or 10% polyacrylamide gels. Western blots were performed using the same antibodies.
Immunofluorescence and microscopy
HeLa cells used for all immunofluorescence experiments were cultured at 37°C at 5% CO2 in DMEM supplemented with 10% FCS. Exponentially growing cells on four well chamber slides (Becton Dickinson) were transfected with pEGFPFANCG plasmid using Superfect Transfection Reagent (Qiagen) as per the manufacturer's instructions. After 14 h, the growth media for cells to be treated was replaced with fresh media containing 50 ng/ml MMC (Sigma) and incubated for 1 h. After washing cells extensively in serum free media, fresh growth media was added and the cells were returned to incubation for 3 h. Cells were then fixed with 4% paraformaldehyde in phosphate buffered saline (PBS) for 20 min and permeabilized with 2% Triton X-100 in PBS for 10 min. Blocking buffer (5% FCS, 0.2% fish skin gelatine, 0.2% Tween-20 in PBS) was then added to the cells for 30 min. Cells were then incubated with an affinity purified mouse monoclonal anti-RAD51 antibody (Abcam ab213) at 1/100 dilution or affinity purified rabbit polyclonal anti-BRCA2 antibody (Abcam ab9143) at 1/300 dilution in blocking buffer for 2 h at room temperature. After washing five times with PBS+0.2% Tween-20, cells were then incubated in blocking buffer with either TRITC-conjugated anti-mouse antibody or TRITC-conjugated anti-rabbit antibody (Jackson Immunoresearch) at 1/300 dilution for 1 h at room temperature. After five more washes in PBS+0.2% Tween-20, chamber walls were removed and slides were mounted in vectashield (Vector Laboratories). All imaging was performed using a confocal laser scanning microscope (Zeiss LSM 510). Counts of the number of FANCG foci co-localising with RAD51 or BRCA2 were obtained from three independent transfections, with approximately 100 FANCG-expressing cells counted per transfection.
| ACKNOWLEDGEMENTS |
|---|
S.H. and A.M. were supported by studentships from the Medical Research Council (UK) and donations from Fanconi Anaemia Breakthrough UK. P.H. was supported by the Leukaemia Research Fund UK. E.W. and A.A. are supported by Cancer Research UK and Breakthrough Breast Cancer.
| FOOTNOTES |
|---|
* To whom correspondence should be addressed. Tel: +44 2079554653; Fax: +44 2079554644; Email: christopher.mathew{at}kcl.ac.uk
| REFERENCES |
|---|
|
|
|---|
- Joenje, H., Oostra, A.B., Wijker, M., di Summa, F.M., van Berkel, C.G., Rooimans, M.A., Ebell, W., van Weel, M., Pronk, J.C., Buchwald, M. et al. (1997) Evidence for at least eight Fanconi anemia genes. Am. J. Hum. Genet., 61, 940944.[Web of Science][Medline]
- Strathdee, C.A., Gavish, H., Shannon, W.R. and Buchwald, M. (1992) Cloning of cDNAs for Fanconi anemia by functional complementation. Nature, 359, 763767.
- Lo Ten Foe, J.R., Rooimans, M.A., Bosnoyan-Collins, L., Alon, N., Wijker, M., Parker, L., Lightfoot, J., Carreau, M., Callen, D.F., Savoia, A. et al. (1996) Expression cloning of a cDNA for the major Fanconi anemia gene, FAA. Nature Genet., 14, 320323.[CrossRef][Web of Science][Medline]
- Fanconi Anemia/Breast Cancer Consortium (1996) Positional cloning of the Fanconi anemia group A gene. Nat. Genet., 14, 324328.[CrossRef][Web of Science][Medline]
- de Winter, J.P., Waisfisz, Q., Rooimans, M.A., van Berkel, C.G., Bosnoyan-Collins, L., Alon, N., Carreau, M., Bender, O., Demuth, I., Schindler, D. et al. (1998) The Fanconi anemia group G gene FANCG is identical with XRCC9. Nat. Genet., 20, 281283.[CrossRef][Web of Science][Medline]
- de Winter, J.P., Leveille, F., van Berkel, C.G., Rooimans, M.A., van der Weel, L., Steltenpool, J., Demuth, I., Morgan, N.V., Alon, N., Bosnoyan-Collins, L. et al. (2000) Isolation of a cDNA representing the Fanconi anemia complementation group E gene. Am. J. Hum. Genet., 67, 13061308.[Web of Science][Medline]
- de Winter, J.P., Rooimans, M.A., van der Weel, L., van Berkel, C.G., Alon, N., Bosnoyan-Collins, L., de Groot, J., Zhi, Y., Waisfisz, Q., Pronk, J.C. et al. (2000) The Fanconi anemia gene FANCF encodes a novel protein with homology with ROM. Nat. Genet., 24, 1516.[CrossRef][Web of Science][Medline]
- Timmers, C., Taniguchi, T., Hejna, J., Reifsteck, C., Lucas, L., Bruun, D., Thayer, M., Cox, B., Olson, S., D'Andrea, A.D. et al. (2001) Positional cloning of a novel Fanconi anemia gene, FANCD2. Mol. Cell, 7, 241248.[CrossRef][Web of Science][Medline]
-
Howlett, N.G., Taniguchi, T., Olson, S., Cox, B., Waisfisz, Q., De Die-Smulders, C., Persky, N., Grompe, M., Joenje, H., Pals, G. et al. (2002) Biallelic inactivation of BRCA2 in Fanconi anemia. Science, 297, 606609.
[Abstract/Free Full Text] -
Garcia-Higuera, I., Kuang, Y., Naf, D., Wasik, J. and D'Andrea, A.D. (1999) Fanconi anemia proteins FANCA, FANCC, and FANCG/XRCC9 interact in a functional nuclear complex. Mol. Cell. Biol., 19, 48664873.
[Abstract/Free Full Text] -
Waisfisz, Q., de Winter, J.P., Kruyt, F.A., de Groot, J., van der Weel, L., Dijkmans, L.M., Zhi, Y., Arwert, F., Scheper, R.J., Youssoufian, H. et al. (1999) A physical complex of the Fanconi anemia proteins FANCG/XRCC9 and FANCA. Proc. Natl Acad. Sci. USA, 96, 1032010325.
[Abstract/Free Full Text] -
de Winter, J.P., van der Weel, L., de Groot, J., Stone, S., Waisfisz, Q., Arwert, F., Scheper, R.J., Kruyt, F.A., Hoatlin, M.E. and Joenje, H. (2000) The Fanconi anemia protein FANCF forms a nuclear complex with FANCA, FANCC and FANCG. Hum. Mol. Genet., 9, 26652674.
[Abstract/Free Full Text] -
Medhurst, A.L., Huber, P.A., Waisfisz, Q., de Winter, J.P. and Mathew, C.G. (2001) Direct interactions of the five known Fanconi anemia proteins suggests a common functional pathway. Hum. Mol. Genet., 10, 423429.
[Abstract/Free Full Text] -
Yamashita, T., Kupfer, G.M., Naf, D., Suliman, A., Joenje, H., Asano, S. and D'Andrea, A.D. (1998) The Fanconi anemia pathway requires phosphorylation and FAA/FAC nuclear accumulation. Proc. Natl Acad. Sci. USA, 95, 1308513090.
[Abstract/Free Full Text] - Pace, P., Johnson, M., Tan, W.M., Mosedale, G., Sng, C., Hoatlin, M., de Winter, J., Joenje, H., Gergley, F. and Patel, K.J. (2002) FANCE: the link between Fanconi anemia complex assembly and activity. EMBO J., 21, 34143423.[CrossRef][Web of Science][Medline]
- Garcia-Higuera, I., Taniguchi, T., Ganesan, S., Meyn, M.S., Timmers, C., Hejna, J., Grompe, M. and D'Andrea, A.D. (2001) Interaction of the Fanconi anemia protein and BRCA1 in a common pathway. Mol. Cell, 7, 249262.[CrossRef][Web of Science][Medline]
-
Folias, A., Matkovic, M., Bruun, D., Reid, S., Hejna, J., Grompe, M., D'Andrea, A.D. and Moses, R. (2002) BRCA1 interacts directly with the Fanconi anemia protein FANCA. Hum. Mol. Genet., 11, 25912597.
[Abstract/Free Full Text] - Siddique, M.A., Nakanishi, K., Taniguchi, T., Grompe, M. and D'Andrea, A.D. (2001) Function of the Fanconi anemia pathway in Fanconi anemia complementation group F and D1 cells. Exp. Hematol., 29, 14481455.[CrossRef][Web of Science][Medline]
-
Wong, A.K., Pero, R., Ormonde, P.A., Tavtigian, S.V. and Bartel, P.L. (1997) RAD51 interacts with the evolutionarily conserved BRC motifs in the human breast cancer susceptibility gene BRCA2. J. Biol. Chem., 272, 3194131944.
[Abstract/Free Full Text] - Davies, A.A., Masson, J.Y., Mcllwraith, M.J., Stasiak, A.Z., Stasiak, A., Venkitaraman, A.R. and West, S.C. (2001) Role of BRCA2 in control of the RAD51 recombination and DNA repair protein. Mol. Cell, 7, 273282.[CrossRef][Web of Science][Medline]
- McHugh, P.J., Spanswick, V.J. and Hartley, J.A. (2001) Repair of DNA interstrand crosslinks: molecular mechanisms and clinical relevance. Lancet Oncol., 2, 483490.[CrossRef][Medline]
- Huber, P.A., Medhurst, A.L., Youssoufian, H. and Mathew, C.G. (2000) Investigation of Fanconi anemia protein interactions by yeast-two-hybrid analysis. Biochem. Biophys. Res. Commun., 268, 7377.[CrossRef][Web of Science][Medline]
- Demuth, I., Wlodarski, M., Tipping, A.J., Morgan, N.V., de Winter, J.P., Thiel, M., Grasl, S., Schindler, D., D'Andrea, A.D., Altay, C. et al. (2000) Spectrum of mutations in the Fanconi anaemia group G gene, FANCG/XRCC9. Eur. J. Hum. Genet., 8, 861868.[CrossRef][Web of Science][Medline]
- Nakanishi, K., Moran, A., Hays, T., Kuang, Y., Fox, E., Garneau, D., de Oca, R.M., Grompe, M. and D'Andrea, A.D. (2001) Functional analysis of patient-derived mutations in the Fanconi anemia gene, FANCG/XRCC9. Exp. Hematol., 29, 842849.[CrossRef][Web of Science][Medline]
-
Gordon, S.M. and Buchwald, M. (2003) Fanconi anemia protein complex: mapping protein interactions in the yeast 2- and 3-hybrid systems. Blood, 102, 136141.
[Abstract/Free Full Text] - Kowalczykowski, S.C. (2002) Molecular mimicry connects BRCA2 to Rad51 and recombinational DNA repair. Nat. Struct. Biol., 9, 897899.[CrossRef][Web of Science][Medline]
-
Taniguchi, T. and D'Andrea, A.D. (2002) The Fanconi anemia protein, FANCE, promotes the nuclear accumulation of FANCC. Blood, 100, 24572462.
[Abstract/Free Full Text] -
Warren, M., Smith, A., Partridge, N., Masabanda, J., Griffin, D. and Ashworth, A. (2002) Structural analysis of the chicken BRCA2 gene facilitates the identification of functional domains and disease causing mutations. Hum. Mol. Genet., 11, 841851.
[Abstract/Free Full Text] - Szabo, C., Masiello, A., Ryan, J.F. and Brody, L.C. (2000) The breast cancer information core: database design, structure, and scope. Hum. Mutat., 16, 123131.[CrossRef][Web of Science][Medline]
-
Marston, N.J., Richards, W.J., Hughes, D., Bertwistle, D., Marshall, C.J. and Ashworth, A. (1999) Interaction between the product of the breast cancer susceptibility gene BRCA2 and DSS1, a protein functionally conserved from yeast to mammals. Mol. Cell. Biol., 19, 46334642.
[Abstract/Free Full Text] -
Yang, H., Jeffrey, P.D., Miller, J., Kinnucan, E., Sun, Y., Thoma, N.H., Zheng, N., Chen, L.P., Lee, W.H. and Pavletich, N.P. (2002) BRCA2 function in DNA binding and recombination from a BRCA2-DSS1-ssDNA structure. Science, 297, 18371848.
[Abstract/Free Full Text] - Blom, E., van de Vrugt, H.J., de Winter, J.P., Arwert, F. and Joenje, H. (2002) Evolutionary clues to the molecular function of the Fanconi anemia genes. Acta Haematol., 108, 231236.[CrossRef][Web of Science][Medline]
- Das, A.K., Cohen, P.W. and Barford, D. (1998) The structure of the tetratricopeptide repeats of protein phosphatase 5: implications for TPR-mediated proteinprotein interactions. EMBO J., 17, 11921199.[CrossRef][Web of Science][Medline]
- D'Andrea, A.D. and Grompe, M. (2003) The Fanconi anemia/BRCA pathway. Nat. Rev. Cancer, 3, 2334.[CrossRef][Web of Science][Medline]
- Gregory, R.C., Taniguchi, T. and D'Andrea, A.D. (2003) Regulation of the Fanconi anemia pathway by monoubiquitination. Semin. Cancer Biol., 13, 7782.[CrossRef][Web of Science][Medline]
- Scully, R., Chen, J., Plug, A., Xiao, Y., Weaver, D., Feunteun, J., Ashley, T. and Livingston, D.M. (1997) Association of BRCA1 with RAD51 in mitotic and meiotic cells. Cell, 88, 265275.[CrossRef][Web of Science][Medline]
- Moynahan, M.E., Chiu, J.W., Koller, B.H., Jasin, M. et al. (1999) Brca1 controls homology directed DNA repair. Mol. Cell, 4, 511518.[CrossRef][Web of Science][Medline]
- Pellegrini, L., Yu, D.S., Lo, T., Anand, S., Lee, M., Blundell, T.L. and Venkitaraman, A.R. (2002) Insights into DNA recombination from the structure of a RAD51BRCA2 complex. Nature, 420, 287293.[CrossRef][Medline]
-
Digweed, M., Rothe, S., Demuth, I., Scholz, R., Schindler, D., Stumm, M., Grompe, M., Jordan, A. and Sperling, K. (2002) Attenuation of the formation of DNA repair foci containing RAD51 in Fanconi anemia. Carcinogenesis, 23, 11211126.
[Abstract/Free Full Text] -
Pichierri, P., Averbeck, D. and Rosselli, F. (2002) DNA cross-link-dependent RAD50/MRE11/NBS1 subnuclear assembly requires the Fanconi anemia C protein. Hum. Mol. Genet., 11, 25312546.
[Abstract/Free Full Text] -
Takata, M., Sasaki, M.S., Tachiiri, S., Fukushima, T., Sonoda, E., Schild, D., Thompson, L.H. and Takeda, S. (2001) Chromosomal instability and defective recombinational repair in knockout mutants of the five Rad51 paralogs. Mol. Cell. Biol., 21, 28582866.
[Abstract/Free Full Text] - Tarsounas, M., Davies, D. and West, S.C. (2003) BRCA2-dependent and independent formation of RAD51 nuclear foci. Oncogene, 22, 11151123.[CrossRef][Web of Science][Medline]
-
Taniguchi, T., Garcia-Higuera, I., Andreassen, P.R., Gregory, R.C., Grompe, M. and D'Andrea, A.D. (2002) S-phase-specific interaction of the Fanconi anemia protein, FANCD2, with BRCA1 and RAD51. Blood, 100, 24142420.
[Abstract/Free Full Text] -
Strachan, T. and Read, A.P. (1999) Human Molecular Genetics, 2nd edn. BIOS Scientific, Oxford, p. 144.
This article has been cited by other articles:
![]() |
R. K. Nookala, S. Hussain, and L. Pellegrini Insights into Fanconi Anaemia from the structure of human FANCE Nucleic Acids Res., March 12, 2007; 35(5): 1638 - 1648. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Medhurst, E. H. Laghmani, J. Steltenpool, M. Ferrer, C. Fontaine, J. de Groot, M. A. Rooimans, R. J. Scheper, A. R. Meetei, W. Wang, et al. Evidence for subcomplexes in the Fanconi anemia pathway Blood, September 15, 2006; 108(6): 2072 - 2080. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Tremblay, P. Pintor dos Reis, G. Bradley, N. N. Galloni, B. Perez-Ordonez, J. Freeman, D. Brown, R. Gilbert, P. Gullane, J. Irish, et al. Young Patients With Oral Squamous Cell Carcinoma: Study of the Involvement of GSTP1 and Deregulation of the Fanconi Anemia Genes. Arch Otolaryngol Head Neck Surg, September 1, 2006; 132(9): 958 - 966. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Barroso, R.L. Milne, L.P. Fernandez, P. Zamora, J.I. Arias, J. Benitez, and G. Ribas FANCD2 associated with sporadic breast cancer risk Carcinogenesis, September 1, 2006; 27(9): 1930 - 1937. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. K. Thirumaran, J. L. Bermejo, P. Rudnai, E. Gurzau, K. Koppova, W. Goessler, M. Vahter, G. S. Leonardi, F. Clemens, T. Fletcher, et al. Single nucleotide polymorphisms in DNA repair genes and basal cell carcinoma of skin Carcinogenesis, August 1, 2006; 27(8): 1676 - 1681. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kitao, K. Yamamoto, N. Matsushita, M. Ohzeki, M. Ishiai, and M. Takata Functional Interplay between BRCA2/FancD1 and FancC in DNA Repair J. Biol. Chem., July 28, 2006; 281(30): 21312 - 21320. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A Smirnova, P. J Romanienko, P. P Khil, and R D. Camerini-Otero Gene expression profiles of Spo11-/- mouse testes with spermatocytes arrested in meiotic prophase I Reproduction, July 1, 2006; 132(1): 67 - 77. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. E. Cohen, S. E. Pollack, and J. W. Pollard Genetic Analysis of Chromosome Pairing, Recombination, and Cell Cycle Control during First Meiotic Prophase in Mammals Endocr. Rev., June 1, 2006; 27(4): 398 - 426. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Taniguchi and A. D. D'Andrea Molecular pathogenesis of Fanconi anemia: recent progress Blood, June 1, 2006; 107(11): 4223 - 4233. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-G. Yang, Z. Herceg, K. Nakanishi, I. Demuth, C. Piccoli, J. Michelon, G. Hildebrand, M. Jasin, M. Digweed, and Z.-Q. Wang The Fanconi anemia group A protein modulates homologous repair of DNA double-strand breaks in mammalian cells Carcinogenesis, October 1, 2005; 26(10): 1731 - 1740. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Lowenthal, A. I. Mehta, K. Frogale, R. W. Bandle, R. P. Araujo, B. L. Hood, T. D. Veenstra, T. P. Conrads, P. Goldsmith, D. Fishman, et al. Analysis of Albumin-Associated Peptides and Proteins from Ovarian Cancer Patients Clin. Chem., October 1, 2005; 51(10): 1933 - 1945. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Habi, M.-C. Delisle, N. Messier, and M. Carreau Lack of Self-Renewal Capacity in Fancc-/- Stem Cells After Ex Vivo Expansion Stem Cells, September 1, 2005; 23(8): 1135 - 1141. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-x. Tian, D. Rai, J. Li, C. Zou, Y. Bai, D. Wazer, V. Band, and Q. Gao BRCA2 Suppresses Cell Proliferation via Stabilizing MAGE-D1 Cancer Res., June 1, 2005; 65(11): 4747 - 4753. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ohashi, M. Z. Zdzienicka, J. Chen, and F. J. Couch Fanconi Anemia Complementation Group D2 (FANCD2) Functions Independently of BRCA2- and RAD51-associated Homologous Recombination in Response to DNA Damage J. Biol. Chem., April 15, 2005; 280(15): 14877 - 14883. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Mi and G. M. Kupfer The Fanconi anemia core complex associates with chromatin during S phase Blood, January 15, 2005; 105(2): 759 - 766. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Yamamoto, S. Hirano, M. Ishiai, K. Morishima, H. Kitao, K. Namikoshi, M. Kimura, N. Matsushita, H. Arakawa, J.-M. Buerstedde, et al. Fanconi Anemia Protein FANCD2 Promotes Immunoglobulin Gene Conversion and DNA Repair through a Mechanism Related to Homologous Recombination Mol. Cell. Biol., January 1, 2005; 25(1): 34 - 43. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Franco, H. J. van de Vrugt, P. Fernandez, M. Aracil, F. Arwert, and M. A. Blasco Telomere dynamics in Fancg-deficient mouse and human cells Blood, December 15, 2004; 104(13): 3927 - 3935. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Taron, R. Rosell, E. Felip, P. Mendez, J. Souglakos, M. S. Ronco, C. Queralt, J. Majo, J. M. Sanchez, J. J. Sanchez, et al. BRCA1 mRNA expression levels as an indicator of chemoresistance in lung cancer Hum. Mol. Genet., October 1, 2004; 13(20): 2443 - 2449. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-J. Park, S. L. M. Ciccone, B. D. Beck, B. Hwang, B. Freie, D. W. Clapp, and S.-H. Lee Oxidative Stress/Damage Induces Multimerization and Interaction of Fanconi Anemia Proteins J. Biol. Chem., July 16, 2004; 279(29): 30053 - 30059. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Wang, P. R. Andreassen, and A. D. D'Andrea Functional Interaction of Monoubiquitinated FANCD2 and BRCA2/FANCD1 in Chromatin Mol. Cell. Biol., July 1, 2004; 24(13): 5850 - 5862. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hussain, J. B. Wilson, A. L. Medhurst, J. Hejna, E. Witt, S. Ananth, A. Davies, J.-Y. Masson, R. Moses, S. C. West, et al. Direct interaction of FANCD2 with BRCA2 in DNA damage response pathways Hum. Mol. Genet., June 15, 2004; 13(12): 1241 - 1248. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Lamerdin, N. A. Yamada, J. W. George, B. Souza, A. T. Christian, N. J. Jones, and L. H. Thompson Characterization of the hamster FancG/Xrcc9 gene and mutations in CHO UV40 and NM3 Mutagenesis, May 1, 2004; 19(3): 237 - 244. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Hirsch, A. Shimamura, L. Moreau, S. Baldinger, M. Hag-alshiekh, B. Bostrom, S. Sencer, and A. D. D'Andrea Association of biallelic BRCA2/FANCD1 mutations with spontaneous chromosomal instability and solid tumors of childhood Blood, April 1, 2004; 103(7): 2554 - 2559. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

















