Human Molecular Genetics Advance Access originally published online on August 19, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Human Molecular Genetics, 2003, Vol. 12, No. 20 2645-2656
DOI: 10.1093/hmg/ddg277
© 2003 Oxford University Press
Phenotypic effects of heterozygosity for a BRCA2 mutation

1Cancer Research UK Gene Function and Regulation Group, The Breakthrough Toby Robins Breast Cancer Research Centre, The Institute of Cancer Research, London, UK and 2Department of Biological Sciences, Brunel University, Uxbridge, UK
Received June 13, 2003; Revised July 17, 2003; Accepted August 8, 2003
| ABSTRACT |
|---|
|
|
|---|
Heterozygous carriers of mutations in the BRCA2 gene have a high risk of developing breast and other cancers. In these individuals, BRCA2 appears to act as a tumour suppressor gene, in that loss of the wild type allele is frequently observed within tumours, leading to loss of BRCA2 function. Because BRCA2 functions in DNA repair via homologous recombination, this leads to genomic instability. However, it is unclear whether loss of the wild type allele is stochastic or if heterozygosity for BRCA2 mutation carries a phenotype that contributes to tumorigenic progression. Here we demonstrate that, in a specific vertebrate cell type, the chicken B cell line DT40, heterozygosity for a BRCA2 mutation has a distinct phenotype. This is characterized by a reduced growth rate, increased cell death, heightened sensitivity to specific DNA damaging agents and reduced RAD51 focus formation after irradiation. Thus in certain cell types, genome instability might be driven directly by heterozygosity for BRCA2 mutation.
| INTRODUCTION |
|---|
|
|
|---|
In total, 510% of breast cancers are thought to result from an inherited predisposition to the disease (1) and two highly penetrant breast cancer associated genes, BRCA1 and BRCA2, have been isolated (2,3). Inheritance of one defective BRCA2 allele is associated with a lifetime risk of 3784% for breast cancer and up to 27% for ovarian cancer, plus an increased risk of male breast cancer, prostate cancer and pancreatic cancer (4). In these individuals, loss or mutation of the wild type allele is frequently seen within tumours, suggesting that BRCA2 acts as a tumour suppressor gene.
The human BRCA2 gene encodes a nuclear protein of 3418 amino acids, most highly expressed in the S phase of the cell cycle (57). Although showing no significant sequence similarity to other known proteins, there is now substantial evidence linking BRCA2 to a role in the repair of DNA double strand breaks (57). DNA double strand breaks are induced in cells by a variety of external agents as well as during normal cellular processes such as DNA replication (810). There are two major mechanisms of double strand break repair, homologous recombination and non-homologous end-joining. Homologous recombination is potentially an error-free process, requiring an intact DNA template for repair and therefore occurs predominantly in the late S/G2 phase of the cell cycle. Non-homologous end-joining does not require a sister template, and occurs predominantly in G1 (8,10). It has been shown that BRCA2 is involved specifically in DNA DSB repair via homologous recombination (11,12). Loss of both functional copies of the BRCA2 gene results in a switch from the use of the conservative sister chromatid gene conversion pathway to error-prone single strand annealing (12). Part of the function of BRCA2 in DNA repair appears to be to regulate both the intracellular location and DNA binding ability of RAD51, a protein that plays a pivotal role in the initiation of homologous recombination via single strand DNA binding and strand invasion (13). However, the precise function of the BRCA2/RAD51 interaction and the other conserved domains in the large BRCA2 protein is unclear (57,14).
Unexpected confirmation of the role of BRCA2 in the repair of DNA interstrand crosslinks in humans has come from studies on the genetics of Fanconi anaemia (15,16). Fanconi anaemia (FA) is an autosomal recessive disorder characterized by anaemia, bone marrow failure, birth defects and progression to myelodysplasia and acute myeloid leukaemia (17). Lymphoid cells from FA carriers show a characteristic hypersensitivity to the DNA cross-linking agents mitomycin C (MMC) and diepoxybutane, which forms the basis for clinical screening of affected individuals (17). FA is a genetically heterogeneous disorder and is caused by homozygosity for mutations in at least eight different genes, FA-A to FA-G (17). It has been proposed recently that the FANCD1 gene is in fact BRCA2 due to the presence of biallelic BRCA2 mutations in individuals from the FANCD1 complementation group (15,16). Furthermore, cells from the FANCD1 complementation group, like cells with loss of BRCA2 function, are defective in the formation of nuclear RAD51 foci after X-irradiation or MMC treatment (18).
Heterozygotes for mutations in BRCA2 are at high risk of developing cancer, a process that is thought to require loss of the wild type allele of the gene. However, it is unclear whether heterozygosity itself carries a phenotype leading to increased loss of the wild type allele or that this loss occurs stochastically. Here we have shown that disruption of one allele of the BRCA2 gene in the p53-null chicken B cell line DT40 results in specific phenotypes including a reduced growth rate and sensitivity to specific genotoxic agents producing DNA double strand cross links. This is the first strong evidence for a phenotype associated with heterozygosity for a mutation in BRCA2 in vertebrate cells. These results may have implications for understanding the mechanism of tumorigenesis in BRCA2 mutation carriers.
| RESULTS |
|---|
|
|
|---|
Targeted disruption of the BRCA2 gene in DT40 cells
We produced a targeted mutation in the chicken BRCA2 gene by homologous recombination in the DT40 cell line. We have previously described the identification and characterization of the chicken BRCA2 gene (14). While the gene is only poorly conserved during evolution, the chromosomal location and intron/exon structure of the gene strongly suggested that we had identified the orthologue of human BRCA2. FISH analysis using a BAC clone containing the chicken BRCA2 gene revealed that the chicken DT40 cell line was diploid for this gene (14). To inactivate the gene in DT40 cells, two replacement type BRCA2 targeting vectors were designed to insert a PGK-neoR or PGK-puroR cassette into the chicken BRCA2 gene within the large central exon 11 at nucleotide position 2412 (GenBank accession no. AY083934). This results in a truncated open reading frame of 804 amino acids leading to loss of all BRC repeats. Both constructs also contained a negative selection gene (diphtheria toxin, DT) and two flanking regions of homology constructed from exons 10 and 11 of chicken BRCA2 (Fig. 1A). The targeting constructs were electroporated individually into exponentially growing wild type DT40 cells and stable transfectants selected by growing in medium containing either G418 or puromycin. G418 and puromycin resistant clones were isolated. Screening by Southern blotting demonstrated that we had achieved targeted disruption of the BRCA2 gene with both vectors (Fig. 1B and C). Targeting efficiencies for this initial round of targeting were 1075%, depending on the drug resistance cassette used. Expression of the mutant BRCA2 mRNA was analysed by reverse transcriptasePCR (Fig. 1D). This indicated that both wild type and mutant mRNAs are expressed in the targeted cells.
|
BRCA2 appears to be essential for the viability ofDT40 cells
We attempted to generate cell clones homozygous for a mutation in the chicken BRCA2 gene in DT40 cells. The PGK-neoR and PGK-puroR targeting constructs described above were electroporated into puromycin and G418 resistant BRCA2+/- clones, respectively. Cells were then doubly selected in both G418 and puromycin. Southern blot analysis was performed on 84 amplified drug resistant clones and seven of these had two correctly targeted chicken BRCA2 alleles. However all seven also appeared to have retained a wild type allele (Fig. 2A and B). PCR of genomic DNA from these aberrant clones using allele-specific primers confirmed the presence of all three alleles (data not shown). To investigate the origin of the three alleles in these clones we performed single colour FISH, using a probe for BRCA2 (14) (Fig. 2C). This revealed, in all cells, the presence of a third BRCA2 signal on a de novo chromosome. Analysis using chromosome paints reviewed that this was the entire long arm of chicken chromosome 1q (data not shown) where the BRCA2 gene is located (14). These results suggest that doubly targeted clones had survived via reduplication of the BRCA2 gene and the chromosome on which it resides, and further that BRCA2 is essential for the viability of DT40 cells.
|
We wished to determine whether the generation of a partial trisomy for chromosome 1 was as a result of attempting to target both alleles of BRCA2 or was an inherent property of BRCA2+/- cells. Therefore we serially passaged wild type and BRCA2+/- clones at low density. DNA from successive passages was taken for Southern blot analysis and cells were also fixed and metaphase spreads analysed by dual colour FISH, using fluorescently labelled probes for BRCA2 and chicken chromosome 1 (14). Phosphoimager analysis of Southern blots of BRCA2+/- clones indicated that the ratio of the intensity of the wild type band compared to the targeted band in each clone increased with successive passage, whereas the ratio remained the same in wild type cells (data not shown). This suggested duplication of the wild type BRCA2 in an increasing number of cells with increasing passage. Dual colour FISH of intermediate clones confirmed this hypothesis all clones at early passage were diploid for BRCA2 but on successive passage an increased percentage of cells showed an additional copy until, in later passages, all cells examined had three copies of the gene (Fig. 2D). In all the abnormal metaphases, the entire long arm of chicken chromosome 1q on which the BRCA2 gene resides was duplicated (data not shown). However, in no metaphase was there evidence of abnormality of any of the other macrochromosomes, and in no metaphase was there evidence of a reduplicated BRCA2 gene on any chromosome other than a reduplicated 1q. This data suggested that there was a selective growth advantage for cells with two wild type copies of BRCA2 compared to those with one.
BRCA2+/- DT40 cells show reduced cell proliferation
We investigated whether BRCA2+/- DT40 cells exhibited any abnormalities in their growth properties and cell cycle characteristics compared to wild type controls. We used cell clones independently derived using both the PGK-neoR (BRCA2-N4 clone) and PGK-puroR (BRCA2-P10 clone) targeting vectors. The proliferative properties of the BRCA2-N4 and BRCA2-P10 clones were monitored using assays for proliferative capacity (3T3 assay) and growth rate (standard growth curves). The 3T3 assay is a measure of proliferative potential on successive passage, and loss of BRCA2 function in mouse cells results in reduced proliferative capacity in this assay (19). Although the PGK-neoR (BRCA2-N4 clone) and PGK-puroR (BRCA2-P10 clone) retained the ability to proliferate robustly with successive passage, there was a marked difference in apparent growth rates between wild type cells and heterozygous cell clones (Fig. 3A). This was independent of the inclusion of selective antibiotics (data not shown). In addition, BRCA2+/- clones showed a reduction in growth rates compared to wild type cells in standard growth curves (Fig. 3B).
|
The reduction in apparent growth rates between wild type cells and heterozygous cell clones could be due to either a slower growth rate secondary to altered cell cycle characteristics or because of an altered rate of cell death. Cell cycle analysis was performed by BrdU pulse chase experiments and by BrdU labelling of asynchronous cells. This revealed no significant difference between wild type and heterozygous cells in cell cycle duration (data not shown). However, this masked a significant increase in cells present in the G2/M compartment in heterozygous compared to wild type cells (Fig. 3C). The latter was associated with a reduction in the BrdU labelling index, suggesting that there was a lower fraction of cycling cells in the heterozygous clones.
Increased cell death is associated with increasedapoptosis in BRCA2+/- cells
A possible explanation of this apparent G2/M arrest is an increase in apoptotic cell death in the heterozygous cell clones. Trypan blue exclusion assays demonstrated that the heterozygous targeted clones did indeed have a much increased rate of cell death (data not shown). This was analysed further by annexin V and propidium iodide staining followed by flow cytometry (Fig. 4A). Live cells were stained with annexin V conjugated to fluorescein isothiocyanate (FITC), counterstained with PI and analysed by flow cytometry for red (PI) and green (annexin V) fluorescence (20,21). In both heterozygous BRCA2+/- clones, there are more apoptotic (lower right quadrant) and dead cells (upper right quadrant) than in wild type DT40 cultures (Fig. 4A). The percentages of cells in each quadrant was calculated from flow cytometry data on four separate occasions, and plotted as a bar chart (Fig. 4B), which highlights the difference between both heterozygous BRCA2+/- clones and wild type DT40 cells. This confirmed the increase in cell death and showed that this was in part via apoptosis. These results could explain the impaired growth characteristics but continued proliferative capacity of the BRCA2+/- clones.
|
DT40 cells heterozygous for a BRCA2 mutation show increased sensitivity to DNA cross-linking agents
Mouse cells carrying mutations in both alleles of Brca2 have a defect in DNA repair (57). To investigate whether BRCA2+/- DT40 cells exhibit a DNA repair defect we used a clonogenic survival assay to examine the ability of these cells to survive exposure to DNA damaging agents. We used a variety of DNA damaging agents including MMC, cis-diaminedichloroplatinum-II (cisplatin), methylmethanesulphonate (MMS), ultraviolet light (UV) and X-irradiation.
Both BRCA2+/- clones N4 and P10 were much more sensitive to the DNA crosslinking agents MMC and cisplatin than wild type cells (Fig. 5). We used a D50 index (dose at which 50% of cells were killed) as a measure of this sensitivity. The estimated D50 for cisplatin is 0.16 µM for BRCA2+/- clone -N4 (95% CI=0.110.30 µM) and 0.28 µM for BRCA2+/- clone -P10 (95% CI=0.170.75 µM), whereas the D50 for wild type DT40 cells is 1.21 µM (95%CI=0.88
) (P=< 0.0001, two-tailed t-test). For MMC, the estimated D50 is 16.7 ng/ml for the BRCA2+/--N4 clone (95% CI=15.518.0 ng/ml), and 54.7 ng/ml for the BRCA2+/--P10 clone (95% CI=52.457.0 ng/ml), whereas the D50 for wild type DT40 cells is 325 ng/ml (95% CI=323327 ng/ml) (P=<0.0001, two-tailed t-test).
|
In contrast, no significant difference was seen in sensitivity to MMS or UV- or X-irradiation between heterozygous clones and wild type DT40 cells (Fig. 5). BrdU pulse-chase labelling experiments suggested that the effect of cisplatin or MMC is not associated with a significant change in the overall cell cycle time in comparison to wild type DT40 cells (data not shown).
Reduced RAD51 focus formation after irradiation in cells heterozygous for BRCA2 mutation
RAD51 focus formation is impaired in cells homozygous for mutations in BRCA2 (57). To determine whether this process was impaired in our cells carrying a single mutation in BRCA2 we used immunofluorescence to determine the extent of focus formation after irradiation of cells with 6Gy of X-rays (Fig. 6A). Confocal microscropy was used to quantitate the number of foci in wild type DT40 cells, the BRCA2+/- clone -N4 and the BRCA2+/- clone -P10. This indicated that RAD51 focus formation was significantly impaired in the mutant cells. Wild type cells had an average of 27 (±4.2) foci per cell whereas the mutant cells had an average of only 10 (±4.5 for BRCA2+/- clone -N4, p=5.9x10-24; ±4.7 BRCA2+/- clone -P10, p=1.7x10-19) (Fig. 6B).
|
| DISCUSSION |
|---|
|
|
|---|
Carriers of mutations in BRCA2 are at very high risk of cancers of the breast and at other sites. BRCA2 has been implicated in the repair of DNA damage and it is clear that loss of both the alleles of the BRCA2 gene leads to genome instability (57). However, it is as yet unclear whether any intrinsic phenotype is associated with heterozygosity for BRCA2 mutations or whether stochastic loss of the wild type BRCA2 allele leads to a homozygous BRCA2 mutant phenotype with consequent effects on the fidelity of DNA repair.
We have used gene targeting to study the function of the breast cancer susceptibility gene BRCA2 in a vertebrate B cell linethe chicken DT40 cell. The chicken DT40 cell line is a valuable system for gene targeting and the investigation of homologous recombination (22). This line is a pre-B cell lymphoma cell line produced by avian leukosis virus infection of genetically susceptible chicken strains (23). Immortalization occurs as a result of provirus integration adjacent to the c-myc locus resulting in c-myc amplification (24). In addition, these cells are trisomic for chicken chromosome 2 and functionally null for p53 (2527). The cell line is useful for gene targeting since it shows a high rate of targeted to random integration after transfection of DNA constructs (28), due to ongoing immunoglobin gene conversion that occurs via the process of homologous recombination (23). Many of the key proteins involved in homologous recombination have been mutated in the DT40 cell line, and for the most part show similar phenotypes to the equivalent knockouts in mice (25,2933). We have previously described the isolation and preliminary characterization of the chicken BRCA2 gene (14). Several lines of evidence strongly suggested that we had isolated the chicken orthologue of the mammalian BRCA2 gene including conservation of linkage in the chicken genome, conservation of intron/exon boundaries and phylogenetic considerations (14). Thus we believe that analysis of the chicken BRCA2 gene should shed light on the function of mammalian BRCA2.
Our original aim in these studies was to produce cell clones homozygous for mutations in the BRCA2 gene to study the effects on homologous recombination and DNA repair. We started by targeting a single allele of BRCA2 and were able to isolate heterozygous BRCA2+/- cell clones. When we attempted to target the second BRCA2 allele we were able to isolate clones having two mutant BRCA2 alleles but these always carried an additional wild type allele. This suggested to us that the BRCA2 gene is essential for viability in DT40 cells and that we had selected for cells that had reduplicated the wild type allele. To investigate whether this was an inherent property of BRCA2+/- cells or a consequence of targeting both BRCA2 alleles, we analysed heterozygous BRCA2+/- cells during extended passage. This revealed that, as cell passage number increased, the cell population contained an increasing proportion of cells that carried three alleles one mutant and two wild type. The novel BRCA2 wild type allele is carried on a de novo chromosome 1q. It seems likely that the selective growth advantage (see below) of BRCA2+/+ cells over BRCA2+/- cells leads to this phenomenon. We do not know whether heterozygosity for BRCA2 mutation itself leads to a propensity to duplicate part of chromosome 1 or whether this is a random event that is subsequently selected for. Intriguingly, a similar phenomenon has recently been demonstrated in a cell line established from a leukaemia patient who had Fanconi anaemia due to biallelic BRCA2 mutations (34). This cell line was found to have lost the characteristic Fanconi anaemia phenotype. Molecular analysis revealed a reversion to wild type of one of the BRCA2 mutant alleles. This indicates that the deleterious effects of loss of BRCA2 function can lead to considerable selective pressure, which can force restoration of BRCA2 function.
Our inability to isolate cell clones homozygous for mutation in BRCA2 frustrated our attempts to study the effects of elimination of BRCA2 function. However, surprisingly, we found that cells heterozygous for a BRCA2 mutation had a distinct phenotype compared to wild type cells. Although these cell clones were able to proliferate continuously in culture, they showed overall slower growth rates, probably due to an increased rate of cell death, at least in part via apoptosis. As well as this growth impairment, BRCA2+/- clones showed a much elevated sensitivity to some DNA damaging agents such as mitomycin C and cisplatin but not to MMS or UV- or X-irradiation. This sensitivity to agents that cause cross links in DNA is similar to that observed in mammalian cells homozygous for BRCA2 mutations and is associated with chromosomal instability (57). These phenotypes are associated with a defect in RAD51 function as measured by reduced RAD51 focus formation after irradiation.
We believe that the phenotypes observed here are a consequence of mutation of one allele of the BRCA2 gene since we compared otherwise isogenic cell lines. This suggests that in certain vertebrate cell types the effects of mutation of one allele of the BRCA2 gene may be similar to complete loss of BRCA2 function in other cell types. Interestingly, phenotypes similar to those we have noted are also seen in chicken cells in which the RAD51 paralogues have been disrupted (35). Targeting of RAD51 itself in chicken DT40 cells results in cell death (25). This, taken together with the proposed role for BRCA2 in regulating the activity of RAD51 (13), indicates that the reduction in the cellular level of BRCA2 caused by haploinsufficiency could lead to a partial but not complete loss of function of RAD51. This is likely to be the cause, direct or indirect, of the cellular phenotypes that we observe. An alternative possibility is that the truncated versions of BRCA2 produced by the mutant allele may have a dominant negative effect. This possibility is difficult to exclude as the mutant BRCA2 mRNA is still expressed in our targeted cells (Fig. 1D). Notwithstanding the actual mechanism of the generation of the phenotypes that we observe, it is clear that they are as a consequence of heterozygosity for a BRCA2 mutation.
The work described here represents the first strong molecular evidence for a phenotype of heterozygosity for a BRCA2 mutation. Two previous studies utilizing human dermal fibroblasts and lymphocytes from BRCA2 mutation carriers suggested defects in DNA repair pathways, but these were not conclusive as they involved small numbers of samples and were subject to interindividual variation (36,37). In one study, Buchholz et al. (36) compared fibroblast and lymphoid cells from three BRCA2 mutation carriers, and suggested that they exhibited reduced colony-forming capacity and increased chromatid breaks in response to gamma irradiation compared to cells from healthy controls. Foray et al. (37) demonstrated that EBV immortalized lymphoblasts from a small number of BRCA2 mutation carriers also exhibited lower clonogenic survival, increased micronucleus formation and a DNA repair defect following treatment with gamma irradiation. However, both these studies were limited by the small numbers of samples and the fact that the cells compared are not isogenic. Additionally, in a study of mice heterozygous for a Brca2 mutation (38), distinct mammary phenotypes were observed in response to treatment with the estrogenic compound diethylstilbestrol (DES). Mice with a heterozygous Brca2 genetic alteration on a 129/SvEv genetic background when treated with DES displayed abnormalities of mammary gland branching as a result of growth inhibition (38). Although this effect was not investigated at the molecular level it is of interest that DES has been shown to stimulate sister chromatid exchange, which is partially defective in mouse cells carrying two mutant Brca2 alleles (12).
Why do we observe a phenotype in BRCA2+/- DT40 cells when previous studies of heterozygous Brca2+/- mice have not documented any cellular phenotypes (3942)? It seems possible that this is due to a genetic background effect. DT40 cells are null for p53 (26) and it is possible that this is partly responsible for the exposure of a synthetic phenotype otherwise not observable. It has been shown previously that mutation of p53 is permissive for survival of BRCA2 null cells (19,43), and breast cancer arising in BRCA2 mutation carriers is associated with a high percentage of p53 mutations. Jonkers et al. (44) used conditional Cre-inactivatable Brca2 and p53 alleles to show that such mutations could cooperate in tumorigenesis in the mammary gland. Interestingly, a significant proportion of tumours on a p53 null background retained a wild type Brca2 allele. Although it is possible that the second allele in these tumours is inactivated by methylation or point mutation, an alternative explanation based on the work described here is that heterozygosity for Brca2 in the absence of functional p53 could lead initiate tumorigenesis. Indeed, we have previously suggested that p53 mutation might precede loss of the wild type BRCA2 allele during tumorigenic progression (42). Of course, DT40 cells will almost certainly have acquired other mutations during their derivation and these may also cooperate with BRCA2 heterozygosity to generate a synthetic phenotype. An interesting possibility is that the c-myc overexpression in DT40 cells (24) contributes to this. An alternative explanation for our observation of heterozygous effects is that it could be influenced by the position of the mutation in BRCA2. The mutation that we have created results in elimination of all the BRC repeats that are critical for RAD51 binding and it may be that mutations that result in retention of the BRC repeats do not have a heterozygous phenotype.
There has been considerable discussion in the literature as to why mutations in a gene such as BRCA2, which is ubiquitously expressed and involved in a generic pathway of DNA repair, should show such a restricted pattern of cancer predisposition (57,45). Redundant pathways that rescue loss of BRCA2 in unaffected tissues and the high proliferative index of susceptible tissues such as breast and ovary have been invoked to explain this tropism. Recently, Elledge and Amos (45) have proposed a new hypothesis for tumour development by BRCA1, which shows a similar restricted pattern of cancer predisposition to BRCA2. This involves the supposition that complete loss of function of BRCA1 or BRCA2 is lethal to most cell types but can be rescued by specific survival factors in certain tissues or environments such as the breast. Our demonstration of an intrinsic phenotype of heterozygosity in a vertebrate B cell line suggests a further possibility. This is that certain cell types, particularly those susceptible to tumorigenesis in human BRCA2 mutation carriers, might be particularly sensitive to BRCA2 dosage leading to impaired fidelity of DNA repair. Perhaps in combination with other genetic or environmental factors this leads to further mutation, including loss of the wild type BRCA2 allele, which triggers further genome instability and tumorigenic progression in certain tissues.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmid constructs
Targeting constructs were generated from cloned chicken BRCA2 genomic DNA (14) using standard methodologies. The neoRBRCA2 targeting vector was built in the pBluescript vector (Stratagene). A diphtheria toxin cassette [RsrII fragment of pKO Select DT V840 vector (Lexicon Genetics Inc.)] was subcloned into the EcoRV site of pBluescript KS. This product was then digested with HindIII and XhoI to allow the insertion of the 1.6 kb HindIII/XhoI fragment containing the neoR cassette from pPGK-neobpA. The long arm homology, derived as a 3.5 kb SpeI fragment from chicken BRCA2 genomic clone spanning exons 1112 was inserted distal to the neoR cassette. The short arm homology was derived from a 1.75 kb Ecl 136/EcoR1 fragment spanning exons 1011. This fragment was inserted between the diphtheria toxin cassette and PGK-neo bpA cassette. The vector contains a unique NotI site for linearization of the complete vector. The puroRBRCA2 targeting vector was built similarly via a series of plasmid intermediates in the pBluescript vector. However, the positive resistance cassette for this vector was derived form the AscI fragment containing the 1.2 kb puromycin resistance cassette of pKO Select Puro V810 vector (Lexicon Genetics Inc.). The long arm homology consisted of a 4.7 kb EcoRI fragment spanning exons 1112. The structure of all recombinant plasmids was confirmed by DNA sequencing.
Cell culture and DNA transfection
DT40 cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 1 mM L-glutamine, 60 mg/ml benzylpenicillin/100 mg/ml streptomycin solution (Sigma), NaH2CO3 3.7 g/dl, 10% newborn calf serum (GIBCO), 4% chicken serum, 5% tryptose phosphate broth, 0.01 M HEPES pH 7 (Sigma), at 37°C, 10% CO2, in a humidified incubator. For gene targeting, 2x107 cells were suspended in 0.5 ml serum free DMEM containing 40 µg of linearized targeting vector and the DNA introduced by electroporation with a GenePulser (Biorad) according to the manufacturer's protocols. Following electroporation, cells were cultured overnight then plated into 96-well plates containing G418 (2 mg/ml) or puromycin (0.5 µg/ml). After 1014 days, drug resistant clones were selected and amplified. Genomic DNA was extracted (QIAGEN blood and tissue DNA extraction kit) according to manufacturer's protocols. Clones were screened by PCR and Southern blotting. RTPCR analysis was performed as previously described (14). Primers specific for the wild type BRCA2 mRNA were located in exon 2 (CGCATTGTAGCGATTCAGAC) and exon 11 (GACAACTGATCTGAAGCACG) distal to the insertion site of the antibiotic resistance cassette. The 2.5 kb product can only be produced from the wild type mRNA. The mutant BRCA2 mRNA was detected with a primer in exon 10 (CTAATGACCAAGGATGATGC) and a primer only present in the mutant mRNA (TCGAGAATTCAGAGGTCTTCCTCGGAAATCAGCTTCTGCTCCATTC). The 1.3 kb product is not produced from the wild type mRNA.
Fluorescence in situ hybridization
FISH was performed as described previously (38). In brief, metaphases were prepared from exponentially growing cultures. For single colour FISH, a BRCA2-containing BAC clone was labelled with biotin by nick translation. The signal was detected using FITC-conjugated streptavidin and slides were counterstained with DAPI. For dual colour FISH, a BRCA2 containing BAC clone labelled with digoxigenin and a biotin labelled chicken chromosome 1 probe [prepared by DOP-PCR from flow sorted chicken chromosomes (14)] were hybridized to metaphase spreads. Detection was via FITC-conjugated anti digoxigenin antibodies and Cy3-conjugated streptavidin. Slides were counterstained with 5 µg/ml DAPI (50 µl per slide for 15 min at room temperature), and coverslips were mounted in Moviol (Calbiochem). Slides were viewed using a Zeiss Axioskop epifluorescence microscope fitted with a camera, and images analysed using the SmartTMCapture software system (Vysis).
Cell growth and death assays
For analysis of cell proliferation, passage 2 cells of heterozygous clones and wild type DT40 cells were plated in triplicate at a cell density of 1x104/ml and counted every 24 hours using a haemocytometer. For the 3T3 assay, passage 2 cells were plated at a density of 1x104/ml, and counted at 3 days, following which the same cells were replated at 1x104/ml again. The procedure was repeated every 3 days. Cell viability data was analysed using Prism 3 software (GraphPadTM). For cell cycle analysis, 1x106 cells were labelled for 30 mins with 20 µM BrdU (Amersham), harvested, washed once in PBS and fixed in 70% ethanol overnight. Samples were then treated with 2N HCl, 0.5% Triton X-100 followed by incubation in mouse monoclonal anti-BrdU antibody (Roche). After washing in PBS, cells were incubated in FITC-conjugated goat anti-mouse IgG (Jackson Laboratories) diluted 1 : 2000 for 30 min at room temperature, then resuspended in PBS containing 5 µg/ml propidium iodide. Samples were analysed on a FACScalibur (Becton Dickinson) using the Cell Quest software package (Becton Dickinson).
For the analysis of kinetics of cell cycle progression by BrdU pulse chase, cells were labelled for 30 min with 20 µM BrdU (Amersham) at 37°C 10% CO2 at time 0. Following this, at defined time intervals up to 24 hours, aliquots of cells were harvested for BrdU staining as above. Samples were analysed on a FACScalibur (Becton Dickinson) using the Cell Quest software package (Becton Dickinson). The progression of cells through one cell cycle can be followed by analysing the percentage of cells passing through a mid-S phase gate at various time points.
Assessment of cell death by trypan blue dye exclusion was performed by staining an aliquot of cells with trypan blue every 24 hours and counting with a haemocytometer. For analysis of apoptotic cell death, exponentially growing cells were stained every 24 hours using the Annexin V assay (ApoAlert Annexin V kit, Clontech) according to manufacturer's instructions followed by FACS analysis.
Clonogenic survival assays
Serially diluted cells were plated in triplicate onto 6-well plates to a final volume of 3 ml of medium plus 0.3% soft agar. To determine sensitivity to cisplatin and MMS, cells were plated in soft agar plates containing varying concentrations of the drug. To determine sensitivity to MMC, cells were incubated in the compound at various concentrations for 1 hour at 37°C, followed by washing in warmed medium, then plating at serial dilution in soft agar plates. To measure sensitivity to UV, cells were plated in soft agar plates then exposed to varying doses of UV irradiation in Stratalinker (Stratagene) according to manufacturers' instructions. For X-irradiation, cells were plated in soft agar then X-irradiated using a 240 kV power X-ray source operated at 10 mA (Pantak). Colonies were stained at 1014 days with 0.005% crystal violet in 20% ethanol and those containing more than 50 cells scored as positive. Plating efficiencies of BRCA2+/- clones in soft agar plates were
40% for heterozygous BRCA2+/- clones and 100% for wild type DT40 cells.
Analysis of RAD51 foci formation
DT40 cells were X-irradiated with 8 Gy. After 6 hours, 1x106 cells were dried on a polylysine-coated slide. Cells were fixed using 4% (v/v) paraformaldehyde/PBS and permeabilized using 0.1% (v/v) NP-40/PBS. After blocking, cells were stained with the anti-human Rad51 monoclonal antibody, RAD51-14B4 (GeneTex, USA) used at a concentration of 50 µg/ml. After washing, cells were stained with Alexa Fluor-555 goat anti-mouse IgG secondary antibody (1 : 1000) and then TO-PRO-3 iodide (1 : 10 000, Molecular Probes) in order to visualize nuclei. Foci were visualized and quantified using a Leica TCS-SP2 confocal microscope.
| ACKNOWLEDGEMENTS |
|---|
M.W. was the recipient of a Cancer Research UK Research McElwain Fellowship for a Clinician. We are grateful to Cancer Research UK and Breakthrough Breast Cancer for financial support and thank Christine Farr for helpful advice.
| FOOTNOTES |
|---|
* To whom correspondence should be addressed at: Cancer Research UK Gene Function and Regulation Group, The Breakthrough Toby Robins Breast Cancer Research Centre, The Institute of Cancer Research, Fulham Road, London SW3 6JB, UK. Tel: +44 2079706058; Fax: +44 2078783858; Email: alana{at}icr.ac.uk
Present address: Department of Pathology, University of Cambridge, Addenbrooke's Hospital, Hills Road, Cambridge CB2 2QQ, and The Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SA, UK. ![]()
| REFERENCES |
|---|
|
|
|---|
- Rahman, N. and Stratton, M.R. (1998) The genetics of breast cancer susceptibility. Annu. Rev. Genet., 32, 95121.[CrossRef][Web of Science][Medline]
-
Miki, Y., Swensen, J., Shattuck-Eidens, D., Futreal, P.A., Harshman, K., Tavtigian, S., Liu, Q., Cochran, C., Bennett, L.M., Ding, W. et al. (1994) A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science, 266, 6671.
[Abstract/Free Full Text] - Wooster, R., Bignell, G., Lancaster, J., Swift, S., Seal, S., Mangion, J., Collins, N., Gregory, S., Gumbs, C., Micklem, G. et al. (1995) Identification of the breast cancer susceptibility gene BRCA2. Nature, 378, 789792.[CrossRef][Medline]
- Thompson, D. and Easton, D. (2001) Variation in cancer risks, by mutation position, in BRCA2 mutation carriers. Am. J. Hum. Genet., 68, 410419.[CrossRef][Web of Science][Medline]
- Venkitaraman, A.R. (2002) Cancer susceptibility and the functions of BRCA1 and BRCA2. Cell, 108, 171182.[CrossRef][Web of Science][Medline]
- Tutt, A. and Ashworth, A. (2002) The relationship between the roles of BRCA genes in DNA repair and cancer predisposition. Trends Mol. Med., 8, 571576.[CrossRef][Web of Science][Medline]
- Jasin, M. (2002) Homologous repair of DNA damage and tumorigenesis: the BRCA connection. Oncogene, 21, 89818993.[CrossRef][Web of Science][Medline]
- Hoeijmakers, J.H. (2001) Genome maintenance mechanisms for preventing cancer. Nature, 411, 366374.[CrossRef][Medline]
- Takata, M., Sasaki, M.S., Sonoda, E., Morrison, C., Hashimoto, M., Utsumi, H., Yamaguchi-Iwai, Y., Shinohara, A. and Takeda, S. (1998) Homologous recombination and non-homologous end-joining pathways of DNA double-strand break repair have overlapping roles in the maintenance of chromosomal integrity in vertebrate cells. EMBO J., 17, 54975508.[CrossRef][Web of Science][Medline]
- van Gent, D.C., Hoeijmakers, J.H. and Kanaar, R. (2001) Chromosomal stability and the DNA double-stranded break connection. Nat. Rev. Genet., 2, 196206.[CrossRef][Web of Science][Medline]
- Moynahan, M.E., Pierce, A.J. and Jasin, M. (2001) BRCA2 is required for homology-directed repair of chromosomal breaks. Mol. Cell., 7, 263272.[CrossRef][Web of Science][Medline]
- Tutt, A., Bertwistle, D., Valentine, J., Gabriel, A., Swift, S., Ross, G., Griffin, C., Thacker, J. and Ashworth, A. (2001) Mutation in Brca2 stimulates error-prone homology-directed repair of DNA double-strand breaks occurring between repeated sequences. EMBO J., 20, 47044716.[CrossRef][Web of Science][Medline]
- Davies, A.A., Masson, J.Y., McIlwraith, M.J., Stasiak, A.Z., Stasiak, A., Venkitaraman, A.R. and West, S.C. (2001) Role of BRCA2 in control of the RAD51 recombination and DNA repair protein. Mol. Cell, 7, 273282.[CrossRef][Web of Science][Medline]
-
Warren, M., Smith, A., Partridge, N., Masabanda, J., Griffin, D. and Ashworth, A. (2002) Structural analysis of the chicken BRCA2 gene facilitates identification of functional domains and disease causing mutations. Hum. Mol. Genet., 11, 841851.
[Abstract/Free Full Text] -
Howlett, N.G., Taniguchi, T., Olson, S., Cox, B., Waisfisz, Q., De Die-Smulders, C., Persky, N., Grompe, M., Joenje, H., Pals, G. et al. (2002) Biallelic inactivation of BRCA2 in Fanconi anemia. Science, 297, 606609.
[Abstract/Free Full Text] -
Witt, E. and Ashworth, A. (2002) Biomedicine. D-Day for BRCA2. Science, 297, 534.
[Free Full Text] - Joenje, H. and Patel, K.J. (2001) The emerging genetic and molecular basis of Fanconi anaemia. Nat. Rev. Genet., 2, 446457.[CrossRef][Web of Science][Medline]
- Godthelp, B.C., Artwert, F., Joenje, H. and Zdzienicka, M.Z. (2002) Impaired DNA damage-induced nuclear Rad51 foci formation uniquely characterizes Fanconi anemia group D1. Oncogene, 21, 50025005.[CrossRef][Web of Science][Medline]
- Tutt, A., Connor, F., Bertwistle, D., Kerr, P., Peacock, J., Ross, G. and Ashworth, A. (2003) Cell cycle and genetic background dependence of the effect of loss of BRCA2 on ionizing radiation sensitivity. Oncogene, 22, 29262931.[CrossRef][Web of Science][Medline]
-
Martin, S.J., Reutelingsperger, C.P., McGahon, A.J., Rader, J.A., van Schie, R.C., LaFace, D.M. and Green, D.R. (1995) Early redistribution of plasma membrane phosphatidylserine is a general feature of apoptosis regardless of the initiating stimulus: inhibition by overexpression of Bcl-2 and Abl. J. Exp. Med., 182, 15451556.
[Abstract/Free Full Text] - Uckun, F.M., Waddick, K.G., Mahajan, S., Jun, X., Takata, M., Bolen, J. and Kurosaki, T. (1996) BTK as a mediator of radiation-induced apoptosis in DT-40 lymphoma B cells. Science, 273, 10961100.[Abstract]
- Sonoda, E., Morrison, C., Yamashita, Y.M., Takata, M. and Takeda, S. (2001) Reverse genetic studies of homologous DNA recombination using the chicken B-lymphocyte line, DT40. Philos. Trans. Roy. Soc. London B. Biol. Sci., 356, 111117.
- Buerstedde, J.M., Reynaud, C.A., Humphries, E.H., Olson, W., Ewert, D.L. and Weill, J.C. (1990) Light chain gene conversion continues at high rate in an ALV-induced cell line. EMBO J., 9, 921927.[Web of Science][Medline]
- Neel, B.G., Hayward, W.S., Robinson, H.L., Fang, J. and Astrin, S.M. (1981) Avian leukosis virus-induced tumors have common proviral integration sites and synthesize discrete new RNAs: oncogenesis by promoter insertion. Cell, 23, 323234.[CrossRef][Web of Science][Medline]
- Sonoda, E., Sasaki, M.S., Buerstedde, J.M., Bezzubova, O., Shinohara, A., Ogawa, H., Takata, M., Yamaguchi-Iwai, Y. and Takeda, S. (1998) Rad51-deficient vertebrate cells accumulate chromosomal breaks prior to cell death. EMBO J., 17, 54975508.[CrossRef][Web of Science][Medline]
- Takao, N., Kato, H., Mori, R., Morrison, C., Sonada, E., Sun, X., Shimizu, H., Yoshioka, K., Takeda, S. and Yamamoto, K. (1999) Disruption of ATM in p53-null cells causes multiple functional abnormalities in cellular response to ionizing radiation. Oncogene, 18, 70027009.[CrossRef][Web of Science][Medline]
-
Ulrich, E., Boehmelt, G., Bird, A. and Beug, H. (1992) Immortalization of conditionally transformed chicken cells: loss of normal p53 expression is an early step that is independent of cell transformation. Genes Dev., 6, 876887.
[Abstract/Free Full Text] - Buerstedde, J.M. and Takeda, S. (1991) Increased ratio of targeted to random integration after transfection of chicken B cell lines. Cell, 67, 179188.[CrossRef][Web of Science][Medline]
- Bezzubova, O., Silbergleit, A., Yamaguchi-Iwai, Y., Takeda, S. and Buerstedde, J.M. (1997) Reduced X-ray resistance and homologous recombination frequencies in a RAD54-/- mutant of the chicken DT40 cell line. Cell, 89, 185193.[CrossRef][Web of Science][Medline]
- Morrison, C., Sonoda, E., Takao, N., Shinohara, A., Yamamoto, K. and Takeda, S. (2000) The controlling role of ATM in homologous recombinational repair of DNA damage. EMBO J., 19, 463471.[CrossRef][Web of Science][Medline]
-
Takata, M., Sasaki, M.S., Sonoda, E., Fukushima, T., Morrison, C., Albala, J.S., Swagemakers, S.M., Kanaar, R., Thompson, L.H. and Takeda, S. (2000) The Rad51 paralog Rad51B promotes homologous recombinational repair. Mol. Cell. Biol., 20, 64766482.
[Abstract/Free Full Text] -
Yamaguchi-Iwai, Y., Sonoda, E., Buerstedde, J.M., Bezzubova, O., Morrison, C., Takata, M., Shinohara, A. and Takeda, S. (1998) Homologous recombination, but not DNA repair, is reduced in vertebrate cells deficient in RAD52. Mol. Cell. Biol., 18, 64306435.
[Abstract/Free Full Text] - Yamaguchi-Iwai, Y., Sonoda, E., Sasaki, M.S., Morrison, C., Haraguchi, T., Hiraoka, Y., Yamashita, Y.M., Yagi, T., Takata, M., Price, C. et al. (1999) Mre11 is essential for the maintenance of chromosomal DNA in vertebrate cells. EMBO J., 18, 66196629.[CrossRef][Web of Science][Medline]
-
Ikeda, H., Matsushita, M., Waisfisz, Q., Kinoshita, A., Oostra, A.B., Nieuwint, A.W.M., de Winter, J.P., Hoatlin, M.E., Kawai, Y., Sasaki, M.S. et al. (2003) Genetic reversion in an acute leukemia cell line from a Fanconi anemia patient with biallelic mutations in BRCA2. Cancer Res., 63, 2688.
[Abstract/Free Full Text] -
Takata, M., Sasaki, M.S., Tachiiri, S., Fukushima, T., Sonoda, E., Schild, D., Thompson, L.H. and Takeda, S. (2001) Chromosome instability and defective recombinational repair in knockout mutants of the five Rad51 paralogs. Mol. Cell. Biol., 21, 28582866.
[Abstract/Free Full Text] - Buchholz, T.A., Wu, X., Hussain, A., Tucker, S.L., Mills, G.B., Haffty, B., Bergh, S., Story, M., Geara, F.B. and Brock, W.A. (2002) Evidence of haplotype insufficiency in human cells containing a germline mutation in BRCA1 or BRCA2. Int. J. Cancer, 97, 557561.[CrossRef][Web of Science][Medline]
- Foray, N., Randrianarison, V., Marot, D., Perricaudet, M., Lenoir, G. and Feunteun, J. (1999) Gamma-rays-induced death of human cells carrying mutations of BRCA1 or BRCA2. Oncogene, 18, 73347342.[CrossRef][Web of Science][Medline]
-
Bennett, L.M., McAllister, K.A., Malphurs, J., Ward, T., Collins, N.K., Seely, J.C., Gowen, L.C., Koller, B.H., Davis, B.J. and Wiseman, R.W. (2000) Mice heterozygous for a Brca1 or Brca2 mutation display distinct mammary gland and ovarian phenotypes in response to diethylstilbestrol. Cancer Res., 60, 34613469.
[Abstract/Free Full Text] - Sharan, S.K., Morimatsu, M., Albrecht, U., Lim, D.S., Regel, E., Dinh, C., Sands, A., Eichele, G., Hasty, P. and Bradley, A. (1997) Embryonic lethality and radiation hypersensitivity mediated by Rad51 in mice lacking Brca2. Nature, 386, 804810.[CrossRef][Medline]
-
Ludwig, T., Chapman, D.L., Papaioannou, V.E. and Efstratiadis, A. (1997) Targeted mutations of breast cancer susceptibility gene homologs in mice: lethal phenotypes of Brca1, Brca2, Brca1/Brca2, Brca1/p53, and Brca2/p53 nullizygous embryos. Genes Dev., 11, 12261241.
[Abstract/Free Full Text] -
Suzuki, A., de la Pompa, J.L., Hakem, R., Elia, A., Yoshida, R., Mo, R., Nishina, H., Chuang, T., Wakeham, A., Itie, A. et al. (1997) Brca2 is required for embryonic cellular proliferation in the mouse. Genes Dev., 11, 12421252.
[Abstract/Free Full Text] - Connor, F., Bertwistle, D., Mee, P.J., Ross, G.M., Swift, S., Grigorieva, E., Tybulewicz, V.L. and Ashworth, A. (1997) Tumorigenesis and a DNA repair defect in mice with a truncating Brca2 mutation. Nat. Genet., 17, 423430.[CrossRef][Web of Science][Medline]
-
Yu, V.P., Koehler, M., Steinlein, C., Schmid, M., Hanakahi, L.A., van Gool, A.J., West, S.C. and Venkitaraman, A.R. (2000) Gross chromosomal rearrangements and genetic exchange between nonhomologous chromosomes following BRCA2 inactivation. Genes Dev., 14, 14001406.
[Abstract/Free Full Text] - Jonkers, J., Meuwissen, R., van der Gulden, H., Peterse, H., van der Valk, M. and Berns, A. (2001) Synergistic tumor suppressor activity of BRCA2 and p53 in a conditional mouse model for breast cancer. Nat. Genet., 29, 418425.[CrossRef][Web of Science][Medline]
-
Elledge, S.J. and Amon, A. (2002) The BRCA1 suppressor hypothesis: an explanation for the tissue-specific tumor development in BRCA1 patients. Cancer Cell, 1, 129132.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:
![]() |
E. Gallmeier and S. E. Kern Targeting Fanconi Anemia/BRCA2 Pathway Defects in Cancer: The Significance of Preclinical Pharmacogenomic Models Clin. Cancer Res., January 1, 2007; 13(1): 4 - 10. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Lu, X. Guo, X. Meng, J. Liu, C. Allen, J. Wray, J. A. Nickoloff, and Z. Shen The BRCA2-Interacting Protein BCCIP Functions in RAD51 and BRCA2 Focus Formation and Homologous Recombinational Repair Mol. Cell. Biol., March 1, 2005; 25(5): 1949 - 1957. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||











