Skip Navigation


Human Molecular Genetics Advance Access originally published online on September 9, 2003
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow A corrigendum has been published
Right arrow All Versions of this Article:
12/21/2777    most recent
ddg313v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (27)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Aravamudan, B.
Right arrow Articles by Galbiati, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Aravamudan, B.
Right arrow Articles by Galbiati, F.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2003, Vol. 12, No. 21 2777-2788
DOI: 10.1093/hmg/ddg313
© 2003 Oxford University Press

Transgenic overexpression of caveolin-3 in the heart induces a cardiomyopathic phenotype

Bharathi Aravamudan1, Daniela Volonte1, Ravi Ramani2, Erdal Gursoy2, Michael P. Lisanti, Barry London2 and Ferruccio Galbiati1,*

1Department of Pharmacology and 2The Cardiovascular Institute, University of Pittsburgh School of Medicine,Pittsburgh, PA 15261, USA

Received June 14, 2003; Revised August 22, 2003; Accepted September 1, 2003


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Caveolins are structural protein components of caveolar membrane domains. Caveolin-3, a muscle-specific member of the caveolin family, is expressed in skeletal muscle tissue and in the heart. The multiple roles that caveolin-3 plays in cellular physiology are becoming more apparent. We have shown that lack of caveolin-3 expression in skeletal muscle resembles limb-girdle muscular dystrophy-1C. In contrast, we have demonstrated that overexpression of caveolin-3 in skeletal muscle tissue promotes defects similar to those seen in Duchenne muscular dystrophy (DMD). Thus, a tight regulation of caveolin-3 expression is fundamental for normal muscle functions. Since caveolin-3 is also endogenously expressed in cardiac myocytes, and cardiomyopathies are observed in DMD patients, we looked at the effects of overexpression of caveolin-3 on cardiac structure and function by characterizing caveolin-3 transgenic mice. Our results indicate that overexpression of caveolin-3 causes severe cardiac tissue degeneration, fibrosis and a reduction in cardiac functions. We also show that dystrophin and its associated glycoproteins are down-regulated in caveolin-3 transgenic heart. In addition, we demonstrate that the activity of nitric oxide synthase (NOS) is down-regulated by high levels of caveolin-3 in the heart. Taken together, these results indicate that overexpression of caveolin-3 is sufficient to induce severe cardiomyopathy. In addition, these findings suggest that caveolin-3 transgenic mice may represent a valid mouse model for studying the molecular mechanisms underlying cardiomyopathies associated with Duchenne muscular dystrophy.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Caveolins are structural components of caveolae, vesicular invaginations of the plasma membrane. Caveolins act as scaffolding proteins that concentrate lipids such as cholesterol and glycosphingolipids in the caveolar membranes, and as transducers of signals from Src-like kinases, H-Ras, NOS (nitric oxide synthase), MAPK pathway components, G-proteins, protein kinase A and protein kinase C (113). Caveolin binding seems to regulate the activation state of several of these molecules, thus making caveolins pivotal regulators of plasma membrane organization and function. The mammalian caveolin gene family is comprised of three members: caveolins 1, 2 and 3 (9,14,15). Caveolins 1 and 2 are expressed in a variety of cell types while caveolin-3 expression is confined to striated (skeletal and cardiac) muscles and smooth muscles (4,6,7,14,16,17). The only exception for this localization pattern is the astroglia in the brain, which have been reported to express caveolin-3 (18).

Caveolin-3, like caveolin-l, can homo-oligomerize to form building blocks that support the construction of caveolae membranes (19,20). In addition to binding to itself, caveolin-3 also interacts with several other signaling molecules. Co-fractionation assays in C2C12 cells have indicated that caveolin-3 may interact with molecules such as Gi2{alpha}, Gß{gamma} and c-Src (21). Caveolin-3 has also been shown to interact with nitric oxide synthase (NOS). Interestingly, interaction with caveolin-3 inhibits NOS activity in vitro (2225). Caveolin-3 is expressed during muscle differentiation and is localized to the sarcolemma (the muscle plasma membrane), where it complexes with dystrophin and dystrophin-associated glycoproteins (i.e. {alpha}-sarcoglycan and ß-dystroglycan) (16,17,21). Dystrophin assembly at muscle plasma membrane has been shown to be essential for normal muscle structure and function. Thus, this link between caveolin-3 and the dystrophin complex is a key aspect of caveolin-3 functions.

That a precise level of caveolin-3 is essential for muscle function is evident from the fact that both a drastic reduction and an excessive expression of caveolin-3 result in dystrophic conditions of the muscle. On one hand, mutations that reduce the levels of caveolin-3 to less than 5% of wild-type cause an autosomal dominant form of limb girdle muscular dystrophy in humans (LGMD-1C) (26). Importantly, we observed a similar dystrophic phenotype in caveolin-3 null mice, where lack of caveolin-3 induced exclusion of dystrophin and its associated glycoproteins from the lipid raft domains and promoted T-tubule abnormalities (17). On the other hand, we have shown that overexpression of wild-type caveolin-3 in mice as a transgene causes severe skeletal muscle damage, which is very similar to that observed in Duchenne muscular dystrophy (16). Interestingly, dystrophin, {alpha}-sarcoglycan and ß-dystroglycan expression is dramatically reduced in the skeletal muscle of caveolin-3 transgenic mice.

As caveolin-3 is endogenously expressed in cardiac myocytes (21), we attempted to understand in the present study the effects of caveolin-3 overexpression in the heart and elucidate the molecular mechanisms underlying these effects. By characterizing caveolin-3 transgenic mice, we investigated whether caveolin-3 overexpression in the heart may lead to structural and functional defects using a variety of electrophysiological, histological and molecular techniques. Our results indicate that caveolin-3 overexpression causes severe cardiac tissue degeneration, fibrosis and a reduction in cardiac functions. In addition, our data indicate that down-regulation of the dystrophin complex and inhibition of NOS activity, may mediate the cardiac myopathy phenotype in these mice. Taken together, these findings provide insight into the molecular mechanisms underlying cardiomyopathies in Duchenne muscular dystrophy.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Caveolin-3 transgenic mice overexpress caveolin-3but not caveolin-1 and -2, in the heart
In order to study the effects of caveolin-3 overexpression in the heart, we used mice that harbor a transgenic caveolin-3 construct in their genome (16). In skeletal muscle, this construct leads to a nearly 3-fold increase in caveolin-3 expression (16). In the present report, we began to investigate caveolin-3 expression in isolated heart tissues from control and caveolin-3 transgenic mice by immunoblotting analysis using a caveolin-3-specific monoclonal antibody probe. Figure 1A shows that caveolin-3 is overexpressed (~3-fold increase) in the heart of caveolin-3 transgenic mice, as compared with normal control mice. Caveolin-1, -2 and -3 are all expressed in the heart but in a tissue-specific manner. In fact, caveolin-3 is the only member expressed in cardiac myocytes. In contrast, caveolin-1 and -2 are mainly expressed in endothelial cells of heart vessels. Thus, in order to evaluate whether over-expression of caveolin-3 altered the expression levels of other caveolin family members, we analyzed the expression of caveolin-1 and caveolin-2 in the heart by western blotting analysis. As shown in Figure 1A, overexpression of caveolin-3 does not affect the expression of other caveolins, suggesting that only caveolin-3 expression is affected in the heart of caveolin-3 transgenic mice.



View larger version (69K):
[in this window]
[in a new window]
 
Figure 1. Caveolin-3 transgenic mouse hearts overexpress caveolin-3. (A) Immunoblotting. Protein extracts from the hearts of 6- to 10-month-old control (CTL) and caveolin-3 transgenic (Cav-3 Tg) mice were run on a 12.5% PAGE and probed with antibodies against caveolins 1, 2 and 3. Note that the expression levels of caveolin-1 and -2 are comparable between control and caveolin-3 transgenic hearts while caveolin-3 expression is ~3-fold higher in the heart from transgenic mice, as compared with the heart from normal control mice. Immunoblotting with anti-ß-actin IgG served as a control for equal loading. (B) Immunofluorescence. Cross sections from 6- to 10-month-old control and caveolin-3 transgenic hearts were probed with antibodies against caveolin-3. Note that caveolin-3 is mainly expressed at the plasma membrane (see arrows) in both control and caveolin-3 transgenic hearts.

 
To investigate the localization of caveolin-3 in the heart, we performed immunofluorescence experiments on tissue sections from the hearts of control and caveolin-3 transgenic mice using caveolin-3-specific antibodies. In the control heart sections, caveolin-3 is mostly localized at the plasma membrane of cardiac myocytes (Fig. 1B, upper panel, arrows). In the transgenic hearts, even though caveolin-3 is overexpressed, the protein remains mainly localized at the plasma membrane (Fig. 1B, bottom panel, arrows). In support of this result, we have previously demonstrated that caveolin-3 stays at the plasma membrane in skeletal muscle fibers of caveolin-3 transgenic mice (16). In caveolin-3 transgenic hearts, we also observed regions that are negative for caveolin-3 expression (see asterisks in Fig. 1B). As caveolin-3 expression visually delineates cardiac myocyte edges, these data suggest that caveolin-3 overexpression may promote muscle degeneration in the heart.

Caveolin-3 overexpressing hearts show cardiacmyocyte degeneration
In order to further evaluate the possible tissue damage that we observed in Figure 1B, we next performed histological staining on heart sections using hematoxylin and eosin dyes (H&E). As shown in Figure 2A, only caveolin-3 transgenic hearts showed a series of histopathological features characteristic of cardiac myocyte degeneration. More specifically, caveolin-3 overexpression in the heart resulted in significant cardiac myocyte disorganization, and chronic inflammation marked by increased cellular infiltrates due to muscle degeneration (arrows). Similar results were obtained in both atrial and ventricular areas of the heart. We next performed trichrome staining of both atrial and ventricular areas of control and caveolin-3 transgenic mice (Fig. 2B). Note the increased interstitial fibrosis (arrows) in caveolin-3 transgenic hearts. It is important to point out that the phenotype described above for caveolin-3 transgenic hearts was only found in 6- to 10-month-old mice. In contrast, no abnormal histopathological features were evident in 1- to 4-month-old caveolin-3 transgenic hearts (unpublished data). Unless otherwise stated, the experiments described throughout the paper were performed on 6- to 10-month-old control and caveolin-3 transgenic mice.



View larger version (72K):
[in this window]
[in a new window]
 
Figure 2. Caveolin-3 overexpression leads to a severe cardiac tissue damage. (A) Hematoxylin-eosin (H&E) staining of the left ventricle (LV) and atria (A) was done on cross sections from 6- to 10-month-old control (CTL) and caveolin-3 transgenic (Cav-3 Tg) mice. Note the severe cardiac myocyte disorganization and degeneration in the caveolin-3 transgenic heart. Arrows in the caveolin-3 sections mark nuclear clusters indicative of cellular infiltration due to cardiac myocyte degeneration. (B) Trichrome staining of the left ventricle and atria was done on cross sections from 6- to 10-month-old control and caveolin-3 transgenic mice. Arrows indicate the extent fibrosis observed only in caveolin-3 transgenic hearts. It is important to point out that we observed identical histological phenotypes in the right ventricle of caveolin-3 transgenic hearts (unpublished data).

 
To further evaluate the muscle degeneration observed in the heart of caveolin-3 transgenic mice, we next evaluated the levels of cardiac creatine kinase. Upon lysis or necrosis of cardiac myocytes, the enzyme is released into the blood. As a consequence, cardiac myocyte degeneration leads to reduced levels of cardiac creatine kinase. Interestingly, caveolin-3 transgenic hearts showed a ~3-fold decrease in cardiac creatine kinase levels (Fig. 3), consistent with the cardiac muscle degeneration observed in tissue sections (Fig. 2A and B). These morphological and biochemical data clearly indicate that transgenic over-expression of caveolin-3 in the heart promotes severe tissue damage.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 3. Cardiac creatine kinase activity is reduced in caveolin-3 transgenic hearts, consistent with myo-necrosis. Cardiac creatine kinase activity was measured in the heart of 6- to 10-month-old control and caveolin-3 transgenic mice. Note that caveolin-3 transgenic hearts exhibit reduced creatine kinase activity (~3-fold), as compared with control hearts. Values represent the average of eight measurements (performed in duplicate) from eight different control mice and eight different caveolin-3 transgenic mice. n=8; *P<0.001.

 
Electrical activity of the heart of caveolin-3transgenic mice
We next decided to test if caveolin-3 overexpressing hearts also show functional abnormalities, in addition to the muscle degeneration described above. To this end, we first measured the electrical activity of control and caveolin-3 transgenic hearts by electrocardiogram (EKG). The results are summarized in Table 1. We found that the heart rate (HR) and the PR and QTc intervals were similar in control and caveolin-3 overexpressing hearts. However, QRS duration was significantly prolonged in caveolin-3 transgenic mice (24.2±1.2 versus 20.5±1.1, P<0.05). In the mouse, this could indicate either slowing of conduction across the ventricles or a delay in early repolarization.


View this table:
[in this window]
[in a new window]
 
Table 1. Electrocardiogram data from control and caveolin-3 transgenic mice
 
Caveolin-3 transgenic mice show impaired cardiacfunction but not cardiac hypertrophy
In order to assess cardiac function, we then assayed fractional shortening in the control and caveolin-3 transgenic hearts by echocardiography of the left ventricle. As depicted in Figure 4A, control hearts show a more vigorous contraction compared with transgenic hearts. These findings were quantified in Figure 4B, where we demonstrated that fractional shortening is significantly reduced from 66.3±1.5% in control hearts to 49.2±3.2% in caveolin-3 overexpressing hearts (P<0.05). These results are indicative of a severe functional deficit in the heart of caveolin-3 transgenic mice.



View larger version (52K):
[in this window]
[in a new window]
 
Figure 4. Cardiac function is severely impaired in caveolin-3 overexpressing mice. (A) A representative echocardiaographic image of the fractional shortening measurement (diastolic-systolic distance) in 6- to 10-month-old control (CTL) versus caveolin-3 transgenic (Cav-3 Tg) hearts. Short, thin arrow marks systole (contraction) and dashed, longer arrow marks diastole (relaxation). The change in the shape of the progressive diastole-systole cycle in caveolin-3 transgenic mice indicates systolic dysfunction. (B) Quantification of fractional shortening. Note that fractional shortening in caveolin-3 transgenic hearts (49.2±3.2) is severely reduced, as compared with normal control hearts (66.3±1.5), indicating cardiac function impairment. n=4; *P<0.05.

 
We then proceeded to verify whether caveolin-3 overexpressing hearts display heart hypertrophy by evaluating parameters such as end diastolic volume (EDV), posterior wall thickness (PWT), and heart weight. As shown in Figure 5A, the mean EDV in the caveolin-3 transgenic hearts is only ~10% higher than that seen in the control hearts [3.0±0.1 mm (Cav-3 Tg) versus 2.7±0.1 mm (control), P<0.05]. In addition, we did not detect significant differences either in posterior wall thickness or in heart weight/tibia length ratio, which is used to determine heart hypertrophy (2729), between control and caveolin-3 transgenic mice (Figure 5B and C and Table 2). Taken together, these data suggest that caveolin-3 overexpression does not result in significant heart hypertrophy.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 5. Caveolin-3 overexpression does not result in cardiac hypertrophy. (A) End diastolic diameter (EDD) of 6- to 10-month-old control (CTL) versus caveolin-3 transgenic (Cav-3 Tg) mouse hearts was measured by echocardiography and quantified. Note that EDD in caveolin-3 transgenic mice is only ~10% higher than that in control mice; n=4; *P<0.05. (B) Posterior wall thickness was measured in 6- to 10-month-old hearts by echocardiography and quantified. Note that posterior wall thickness is comparable between control and caveolin-3 transgenic hearts; n=4. (C) Heart weight/tibia length ratio was measured in 6- to 10-month-old mice. Note the comparable ratio between control and caveolin-3 transgenic mice; n=4. (D) Semiquantitative RT–PCR was performed on 6- to 10-month-old control and caveolin-3 transgenic ventricles to assess the expression levels of the known hypertrophy marker atrial natriuretic factor (ANF). Amplification of the ribosomal protein L32 was used as an internal control. Amplification of ANF from TNF-{alpha} overexpressing mice, which are known to express ANF, was used as a positive control. Note that ANF is not expressed in both control and caveolin-3 transgenic ventricles, but only in TNF-{alpha} overexpressing mice. PCR was performed in the exponential linear zone of amplification for each gene studied.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Heart weight and tibia length from CTL and Cav-3 Tg mice
 
We confirmed this data by checking the expression of the known hypertrophy marker atrial natriuretic factor (ANF) (30,31) in the ventricle of transgenic hearts. Semiquantitative RT–PCR analysis indicated that neither the control nor the transgenic ventricles expressed detectable levels of ANF message (Fig. 5D). RNA from hearts overexpressing TNF-{alpha}, known to express ANF (32), was used as a positive control. Ribosomal protein L-32 (33) was amplified as an internal control. We also tested the expression levels of ß-myosin heavy chain, another hypertrophy marker (34,35), but failed to observe increased expression in transgenic hearts (unpublished data). These results indicate that caveolin-3 overexpressing hearts manifest myopathy, but are not necessarily hypertrophic.

Dystrophin and dystrophin-associated glycoproteins are down-regulated in caveolin-3 overexpressing hearts
We then attempted to understand the molecular mechanisms underlying the impairment of cardiac function in caveolin-3 overexpressing animals. The dystrophin glycoprotein complex acts as a link between the extracellular matrix and the intracellular cytoskeleton and is fundamental for muscle integrity. We have recently demonstrated that overexpression of caveolin-3 in skeletal muscle tissue down-regulates dystrophin and its associated glycoproteins (16). Thus, we wanted to test if this is the case in the cardiac tissue as well. In addition, given the fact that only old (6- to 10-month-old), but not young (1- to 4-month-old), caveolin-3 transgenic mice displayed histopathological and functional abnormalities, we investigated whether the dystrophin glycoprotein complex shows an age-dependent down-regulation in caveolin-3 transgenic hearts. Toward this end, we compared, by western blotting analysis, the expression levels of dystrophin, {alpha}-sarcoglycan and ß-dystroglycan between the hearts of young (1 month of age) and old (6–10 months of age) control and caveolin-3 transgenic animals. As shown in Figure 6A, the levels of all these three dystrophin complex component proteins are only partially reduced (~30–50% reduction) in the heart of young caveolin-3 transgenic mice, as compared with young control mice. However, the expression of dystrophin, {alpha}-sarcoglycan and ß-dystroglycan is greatly reduced (~90% reduction) in old caveolin-3 overexpressing mice. This result was further confirmed by immunofluorescence where heart sections from old control and caveolin-3 transgenic mice were stained with antibodies against the same dystrophin complex proteins. Figure 6B shows that we detected a significant lack of labeling of dystrophin, {alpha}-sarcoglycan and ß-dystroglycan in the heart of old caveolin-3 transgenic animals. Thus, a dramatic down-regulation of the dystrophin complex occurs only in old caveolin-3 transgenic hearts, which show cardiac myocyte degeneration and functional defects.



View larger version (73K):
[in this window]
[in a new window]
 
Figure 6. Caveolin-3 overexpression down-regulates the dystrophin glycoprotein complex. (A) Immunoblotting. Whole tissue homogenates from young (1 month of age) and old (6–10 months of age) control (CTL) and caveolin-3 transgenic (Cav-3 Tg) mouse hearts were run on an 8% (for dystrophin) or a 12.5% PAGE (for {alpha}-sarcoglycan, ß-dystroglycan and ß-actin), and western blot analysis was performed using antibodies against dystrophin, {alpha}-sarcoglycan and ß-dystroglycan. Note that the expression of these proteins is only partially reduced (~30–50% reduction) in young caveolin-3 transgenic hearts, as compared with young control hearts. In contrast, expression of dystrophin, {alpha}-sarcoglycan and ß-dystroglycan is dramatically reduced (~90% reduction) in the hearts of old caveolin-3 transgenic mice, as compared with old control mice. Immunoblotting with anti-ß-actin IgG served as a control for equal loading. (B) Immunofluorescence. Heart cross sections from the left ventricle of 6- to 10-month-old normal control and caveolin-3 transgenic mice were stained with antibody probes specific for dystrophin, {alpha}-sarcoglycan and ß-dystroglycan. Note that dystrophin and its associated glycoproteins are down-regulated in caveolin-3 heart sections, confirming the immunoblotting data shown in (A). Caveolin-3 staining was performed as an internal control. Similar results were obtained with sections from both atrial and ventricular areas of the heart (unpublished data). (C) Semiquantitative RT–PCR. Semiquantitative RT–PCR was performed on young (1 month of age) and old (6–10 months of age) control and caveolin-3 transgenic hearts to assess the expression levels of dystrophin, {alpha}-sarcoglycan and ß-dystroglycan. Amplification of the ribosomal protein L32 was used as an internal control. Note that the mRNA levels of these genes are unchanged in caveolin-3 transgenic hearts, as compared with control hearts. PCR was performed in the exponential linear zone of amplification for each gene studied.

 
In order to examine whether the down-regulation of the dystrophin complex proteins in the caveolin-3 transgenic hearts is the result of a reduced gene transcription, we next evaluated their mRNA levels by semiquantitative RT–PCR. Figure 6C illustrates that mRNA levels of dystrophin, {alpha}-sarcoglycan and ß-dystroglycan are unchanged in both young and old caveolin-3 transgenic hearts, as compared with control hearts. Taken together, these data suggest that down-regulation of the dystrophin complex occurs at the protein level and that it may contribute to the cardiac defects that we observed in these mice.

Nitric oxide synthase (NOS) activity is reduced incaveolin-3 overexpressing hearts
Nitric oxide synthase is an enzyme that is involved in the synthesis of nitric oxide (NO). Nitric oxide produced by cardiac myocytes is known to modulate cardiac functions (36). Both endothelial NOS (eNOS) and neuronal NOS (nNOS) participate in NO production in the heart. As we observed severe cardiac dysfunctions in caveolin-3 transgenic hearts, we asked whether caveolin-3 overexpression affects the expression of eNOS and nNOS within cardiac myocytes.

Heart extracts from normal control and caveolin-3 transgenic mice were subjected to immunoblotting analysis with antibody probes specific for eNOS and nNOS (Fig. 7A). Our results indicated that both eNOS and nNOS were equally expressed in control and caveolin-3 transgenic hearts. These data indicate that down-regulation of the dystrophin glycoprotein complex in caveolin-3 overexpressing cardiac myocytes does not result in down-regulation of eNOS and nNOS. Because nNOS expression is reduced in dystrophin-deficient skeletal muscle tissue, these findings suggest that nNOS functions may be differentially regulated in cardiac muscle.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 7. Nitric oxide synthase activity is reduced in caveolin-3 overexpressing hearts. (A) Immunoblotting. Heart extracts from 6- to 10-month-old control (CTL) and caveolin-3 transgenic (Cav-3 Tg) hearts were run on a 12.5% PAGE and probed with antibodies against eNOS and nNOS. Note that the levels of expression of eNOS and nNOS seem to be unaltered in caveolin-3 transgenic hearts, as compared to control hearts. Immunoblotting with anti-ß-actin IgG served as a control for equal loading. (B) NOS activity. Protein extracts from 6- to 10-month-old control and caveolin-3 transgenic hearts were subjected to a colorimetric NOS activity assay. Enzymatic activity obtained from eight independent experiments was plotted and quantified. Note that NOS activity in caveolin-3 transgenic hearts is reduced by 69%, as compared with control hearts; n=8; *P<0.001.

 
We decided next to investigate whether NOS activity is altered in caveolin-3 transgenic hearts. Extracts from the hearts of control and caveolin-3 transgenic mice were used to measure NOS activity by employing a well-characterized colorimetric assay. As shown in Figure 7B, NOS activity is reduced by 69% in caveolin-3 overexpressing hearts, indicating that the reduction in NOS activity may be, at least in part, responsible for the functional defects observed in these mice.

Why is NOS activity reduced in caveolin-3 transgenic heart? As caveolin-3 has been shown to directly interact with either eNOS or nNOS and inhibit their activity (2224), one possibility is that a higher percentage of eNOS and nNOS interacts with caveolin-3 in caveolin-3 transgenic cardiac myocytes. As a consequence, increased caveolin-3-eNOS/nNOS interaction would result in reduced NOS activity. To test this hypothesis, heart lysates from control and caveolin-3 transgenic hearts were immunoprecipitated with eNOS or nNOS antibodies, and subjected to immunoblotting analysis with anti-caveolin-3 antibodies. Figure 8A and B reveals that the interaction of eNOS with caveolin-3 is significantly increased in transgenic hearts, as compared with control hearts. Virtually identical results were obtained with nNOS (Fig. 8C and D). Thus, it seems likely that by increasing its interaction with both eNOS and nNOS, caveolin-3 inhibits NOS activity.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 8. The interaction of caveolin-3 with eNOS and nNOS is increased in caveolin-3 transgenic mice. Lysates from 6- to 10-month-old control and caveolin-3 transgenic hearts were immunoprecipitated with anti-eNOS IgG (A) and anti-nNOS IgG (C), separated by SDS–PAGE, and subjected to immunoblot analysis with anti-caveolin-3 IgG. Note that the interaction between caveolin-3 and eNOS (A), as well as caveolin-3 and nNOS (C), is increased in caveolin-3 transgenic hearts, as compared with control hearts. Lysates from control and caveolin-3 transgenic hearts contained equivalent amounts of eNOS (B) and nNOS (D), while caveolin-3 expression was significantly higher in caveolin-3 transgenic hearts (B and D), as determined by western blotting analysis before immunoprecipitation. Immunoblotting with anti-ß-actin IgG served as a control for equal loading (B and D).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Caveolin-3 is a major structutal protein of caveolae membrane domains in skeletal and cardiac muscles. In the present study, we were interested to find what the consequence in the heart would be if caveolin-3 levels were increased. In order to answer this question, we assessed cardiac structural integrity and function in mice harboring a transgenic caveolin-3 construct. Our results show that caveolin-3 transgenic mice exhibit severe myocyte degeneration and reduced left ventricular function. Interestingly, we did not observe cardiac hypertrophy in these mice, as demonstrated by comparable posterior wall thickness, and heart weight/tibia length ratio between control and caveolin-3 transgenic animals. Although we found that end diastolic volume (EDV) is ~10% higher in caveolin-3 transgenic hearts, we believe that such a small increase does not reflect a significant hypertrophy. In fact, we did not observe increased levels of atrial natriuretic factor and ß-myosin heavy chain, two markers of cardiac hypertrophy, in the ventricle of caveolin-3 transgenic mice. Thus, these data suggest that overexpression of caveolin-3 affects cardiac function but does not result in cardiac hypertrophy. In support of this hypothesis, caveolin-3 has been recently shown to behave as a negative regulator of hypertrophic responses in cardiac myocytes (37).

Importantly, these results are consistent with data showing that caveolin-3 expression in the heart is reduced in several distinct in vivo animal models of induced cardiac hypertrophy (3840). The idea that down-regulation, but not overexpression, of caveolin-3 may be associated with cardiac hypertrophy is supported by recent data by Lisanti and colleagues (41). They demonstrated that caveolin-3 null mice show cardiac myocyte hypertrophy and mild-to-moderate cardiomyopathy. Thus, it appears that both lack and overexpression of caveolin-3 may promote cardiomyopathy. However, cardiac hypertrophy occurs only in caveolin-3 null mice, suggesting that different mechanisms may underlie the phenotype observed in these two mouse models. In addition, the observation that either lack or overexpression of caveolin-3 gives rise to cardiomyophatic phenotypes was not totally unexpected, in fact both lack and overexpression of caveolin-3 induce muscular dystrophy phenotypes in mice and humans (16,17,26).

In order to decipher the possible mechanisms leading to the observed phenotype in caveolin-3 transgenic animals, we assayed the expression levels of the dystrophin glycoprotein complex components by both western blotting and immunofluorescence analysis. All three proteins assayed (dystrophin, {alpha}-sarcoglycan and ß-dystroglycan) were drastically reduced in 6- to 10-month old caveolin-3 transgenic hearts. Although we cannot exclude that down-regulation of dystrophin and dystrophin-associated glycoproteins may be the result of tissue/cellular damage, overexpression of caveolin-3 itself may directly lead to down-regulation of these proteins. One possibility is that overexpression of wild-type caveolin-3 disrupts the normal processing or stoichiometry of the dystrophin complex, leading to the degradation of its components. Consistent with this hypothesis, a novel WW-like domain within caveolin-3 has been shown to directly recognize the extreme C terminus of ß-dystroglycan that contains a PPXY motif (42). As the WW domain of dystrophin recognizes the same site within ß-dystroglycan, caveolin-3 can effectively block the interaction of dystrophin with ß-dystroglycan in vitro (42), suggesting competitive regulation of the recruitment of dystrophin to the sarcolemma in vivo.

The dystrophin glycoprotein complex mediates membrane integrity in muscle. In DMD, lack of dystrophin in skeletal muscle tissue promotes membrane instability and myotube degeneration. It is possible to speculate that a similar mechanism may be responsible for the cardiac myocyte degeneration observed in caveolin-3 overexpressing hearts, where dystrophin and its associated glycoproteins are down-regulated. In support of this hypothesis, cardiac myocyte degeneration was only observed in 6- to 10-month-old caveolin-3 transgenic mice, which show ~90% reduction of the dystrophin complex, but not in younger (1- to 4-month-old) mice, where dystrophin and its associated glycoproteins are only partially down-regulated.

Endothelial NOS (eNOS) and neuronal NOS (nNOS) are both expressed in the heart and represent the principle sources of cardiac nitric oxide. We have shown in this study that high levels of caveolin-3 increase the interaction of both eNOS and nNOS with caveolin-3 and inhibit NOS activity in the heart. In fact, NOS activity is reduced by 69% in caveolin-3 transgenic hearts, as compared with normal control hearts. This result is consistent with previous data showing that eNOS is localized into caveolae membranes and co-precipitates with caveolin-3 in cardiac myocytes. In addition, caveolin-3 expression, and peptides corresponding to the scaffolding domain of caveolin-3, inhibit eNOS and nNOS activities in cardiac myocytes in vitro (2224).

Endothelial nitric oxide is important for cardiac functions (43). Interestingly, increased rate of heart failure and cardiac dysfunction, such as reduced cardiac shortening, have been observed in eNOS null mice (44). Thus, it is tempting to propose that cardiac function impairments and the tissue damage observed in caveolin-3 transgenic mice may be due, at least in part, to the reduction of NO level caused by the caveolin-3-dependent inhibition of NOS activity.

Cardiomyopathies have been reported in DMD patients (45,46). It remains unclear whether cardiomyopathy in DMD patients is a primary defect or develops as a secondary consequence of skeletal muscle dysfunction. McNally and colleagues have recently demonstrated that sarcoglycan-mediated cardiomyopathy may be independent of skeletal muscle disease in muscular dystrophy (47). Interestingly, caveolin-3 expression is up-regulated in Duchenne patients and in the mdx mouse (by ~2- to 3-fold), a mouse model of DMD with a dystrophin deficiency (48,49). Although we cannot exclude skeletal muscle defects exacerbating the cardyomyopathic phenotype, it is possible to speculate that the caveolin-3-dependent down-regulation of the dystrophin complex and inhibition of NOS activity in cardiac myocytes may indeed directly contribute to the heart defects that occur in DMD and in caveolin-3 transgenic mice.

Interestingly, caveolin-3 transgenic mice have a reduced lifespan, 10–12 months versus 24–30 months for normal control mice (unpublished data). As our data suggest that overexpression of caveolin-3 promotes a progressive cardiomyopathic phenotype, we speculate that heart failure may be partially responsible for the early death observed in caveolin-3 transgenic mice. Taken together, these results indicate that caveolin-3 transgenic mice may represent a valid mouse model for studying the molecular mechanisms underlying cardiomyopathies associated with DMD.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Materials
Antibodies and their sources were as follows: anti-caveolin-3 IgG (mouse mAb 26), anti-eNOS IgG (mouse mAb), anti-nNOS IgG (rabbit pAb), and horseradish peroxidase-conjugated goat anti-rabbit antibodies were from BD Transduction laboratories (Lexington, KY, USA); anti-ß-actin IgG (mAb AC-15; Sigma); horseradish peroxidase-conjugated goat anti-mouse and anti-rabbit secondary antibodies were from Pierce (Rockford, IL, USA); antibodies against dystrophin, {alpha}-sarcoglycan and ß-dystroglycan were from Novocastra Labs (Newcastle upon Tyne, UK). All other biochemicals used were of the highest purity available and were obtained from regular commercial sources.

Animal studies
Mice were housed in a barrier facility at the University of Pittsburgh School of Medicine. The generation of caveolin-3 transgenic mice was as previously described (16). Eight different control mice and eight different caveolin-3 transgenic mice were used in all histological, immunoblotting, immunofluorescence, co-immunoprecipitation, NOS activity, CK activity and RT–PCR experiments. Four different control mice and four different caveolin-3 transgenic mice were used for echocardiography and electrocardiography.

Immunoblotting analysis
Heart tissue was harvested from control and caveolin-3 transgenic mice. Tissue was first minced with a pair of mini scissors and then homogenized using a lysis buffer (10 mM Tris pH 8.0, 150 mM NaCl, 1% Triton X-100 and 60 mM n-octyl glycoside) containing a complete protease inhibitor cocktail. Homogenized tissue was mixed at 4°C for 30 min, and then centrifuged at 13 000 rpm for 10 min in a microcentrifuge. The supernatant was collected and total protein content was assayed using the BCA protein assay kit (Pierce, Rockford, IL, USA). Equal quantities of protein from the lysates of control and caveolin-3 transgenic hearts were loaded onto a 12.5% SDS-PAGE (8% SDS–PAGE for probing with dystrophin antibodies). Then, proteins were transferred to BA83 nitrocellulose membranes (Schleicher and Schuell). Blots were incubated for 2 h in TBST (10 mM Tris–HCl, pH 8.0, 150 mM NaCl, 0.2% Tween 20) containing 2% powdered skim milk and 1% bovine serum albumin (BSA). After three washes with TBST, membranes were incubated for 2 h with the primary antibody (diluted in TBST) and for 1 h with horseradish peroxidase-conjugated goat anti-rabbit/mouse IgG (~5000-fold diluted). Bound antibodies were detected using an ECL detection kit (Amersham, Pharmacia Biotech). All the immunoblots presented are representative of eight independent experiments performed with lysates from eight different control and caveolin-3 transgenic mice.

Immunoprecipitation
Approximately 45 mg each of control and caveolin-3 transgenic heart tissue was washed twice in PBS and homogenized in the IP lysis buffer (10 mM Tris pH 8.0, 150 mM NaCl, 1% Triton X-100 and 60 mM n-octyl glycoside) containing a complete protease inhibitor cocktail. Lysates were incubated at 4°C with rotation for 45 min and centrifuged at maximum speed for 10 min at 4°C. The supernatant was pre-incubated with proteinA-sepharose for 1 h at 4°C. After centrifugation at 10 000 rpm for 1 min, the supernatant was collected and incubated overnight at 4°C with anti-eNOS or nNOS antibodies and proteinA-sepharose. The immunoprecipitate was washed three times with the lysis buffer and finally re-suspended in loading buffer containing 20 mM DTT. Following vigorous vortexing and boiling, the samples were loaded onto a 12.5% SDS–PAGE and transferred to a nitrocellulose membrane. Subsequent western blot analysis was performed as described above.

Immunofluorescence
Heart tissue was dissected out from control and caveolin-3 transgenic mice and immediately frozen in 2-methyl butane placed in liquid nitrogen. Frozen tissues were stored at -80°C. Sections of ~5 µm thickness were obtained using a Microm HM 505 cryostat. Tissue sections were fixed with 4% paraformaldehyde and permeabilized with PBT (1xPBS containing 100 nM CaCl2, 1 µM MgCl2, 0.2% BSA and 0.1% Triton X-100). Primary antibodies used were: caveolin-3 (1 : 500), dystrophin (1 : 20), {alpha}-sarcoglycan (1 : 50), ß-dystroglycan (1 : 50). After a 30 min incubation with secondary antibodies, the sections were mounted using Antifade solution. Images were obtained using an Olympus Provis fluorescence microscope.

NOS activity assay
Heart tissues from either control or caveolin-3 transgenic mice were homogenized in 1x PBS pH 7.4, and centrifuged at 10 000g for 20 min. Supernatants were ultracentrifuged at 100 000g for 15 min and filtered through a 0.45 µm filter. The filtrates were concentrated using a 30 kDa molecular weight cut-off filter (YM-30; Millipore). Nitric oxide synthase activity was assayed using the colorimetric kit from Calbiochem, following the protocol outlined by the manufacturer. Color development due to nitrate production was read at 540 nm on a plate reader. A standard curve obtained from known nitrate standards was used to calculate nitrate to nitrite ratios and to determine NOS activity in the heart samples.

Cardiac creatine kinase activity measurements
Frozen heart samples were weighed and homogenized in ice-cold lysis buffer (50 mg/ml) containing 0.1% Triton X-100, 5 mM Hepes pH 8.7, 5 mM MgCl2, 1 mM EGTA and 1 mM DTT. Samples were incubated for 60 min at 0°C to ensure complete enzyme extraction. Creatine kinase activity was measured using the creatine kinase (CK) reagent set from Pointe Scientific Inc., according to the manufacturer's instructions. Values were normalized for total protein contents.

RNA isolation and RT–PCR
Total RNA was isolated from control and caveolin-3 transgenic hearts, using Perfect RNA mini kit (Eppendorf, Brinkman Instruments, NY, USA). Equal amounts of RNA were treated with RNase-free DNase, and subjected to reverse transcription using the Omniscript kit (Qiagen, Orange, CA, USA). RNA from mice overexpressing TNF-{alpha} (a gift from Dr Charles McTiernan, University of Pittsburgh) was used in reverse transcription and PCR as a positive control for atrial natriuretic factor (ANF). Jumpstart DNA polymerase (Sigma, St Louis, MO, USA) was used in the PCR reactions. The primers used are the following: ANF: 5' CAACACAGATCTGATGGATTTCAAGGT 3' (forward) and 5' CTGCAGCTGTTGTCATTGTCTTGAAAC 3' (reverse); {alpha}-sarcoglycan: 5' GGACTGAGGGACACCAAGGCC 3' (forward) and 5' AGCGGTTGGCAGGTGTGGTGG 3' (reverse); ß-dystroglycan: 5' CCTCTCCTGGAAGCTCAGCTG 3' (forward) and 5' GGGAGGTGCGTTAGGATCCTC 3' (reverse); dystrophin: 5' CCACTTGTCTGTTGTGTGGAC 3' (forward) and 5' CTCAAGTAAGAGTCCAGTACC 3' (reverse). A sequence corresponding to ribosomal protein L-32 was also amplified as an internal control using primers 5' TTCTGTTATGCAGCATCATGGCTGC 3' (forward) and 5' TTTCTTCGC TGTGTAGCCTGGTGTT 3' (reverse). PCR was performed in the exponential linear zone of amplification for each gene studied.

Electrocardiography
Four lead EKGs (leads I, II, III and AP) were performed on mice anesthetized with avertin (0.5 mg/kg) using subcutaneous electrodes, a differential amplifier (Warner DP301), and an analog-to-digital converter (MacLab, ADInstruments). Signals were digitized at 1 kHz and stored on computer. QT interval (ms) was determined as the time corrected for heart rate using the formula QTc=QT/({surd}RR/100).

Echocardiography
Murine trans-thoracic echocardiography was conducted under anesthesia with 2.5% Avertin, using an Acuson Sequoia machine and a 13.5 MHz probe. Briefly, the heart was imaged in the two-dimensional parasternal short-axis view, and an M-mode echocardiogram of the midventricle was recorded at the level of papillary muscles. Posterior wall thickness, and end-diastolic and end-systolic internal dimensions of the left ventricle were measured from the M-mode image. Left ventricular (LV) fractional shortening was defined as the end-diastolic dimension minus the end-systolic dimension divided by the end-diastolic dimension and was used as an index of cardiac contractile function. Images were recorded on videotape, and analyzed using an offline quantification system (ImageVue, Nova Microsoniscs, Kodak)

Histological procedures
Sectioning, processing and staining (H&E and trichrome) of heart tissues from control and caveolin-3 transgenic mice were performed by the Research Histology Services, University of Pittsburgh. Stained sections were visualized under a Nikon Eclipse E800 microscope.


    ACKNOWLEDGEMENTS
 
This work was supported by grants from the American Heart Association (AHA), the American Cancer Society (IRG-60-002-40; to F.G.), and the National Heart, Lung and Blood Institute (R01 HL58030; to B.L.). We thank Drs Frank Fusca and Simon Watkins for help with sectioning and fluorescent microscopy.


    FOOTNOTES
 
* To whom correspondence should be addressed. Tel: +1 4126482047; Fax: +1 4126481945; E-mail: feg5{at}pitt.edu Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Garcia-Cardena, G., Oh, P., Liu, J., Schnitzer, J.E. and Sessa, W.C. (1996) Targeting of nitric oxide synthase to endothelilal cell caveolae via palmitoylation: implications for caveolae localization. Proc. Natl Acad. Sci. USA, 93, 6448–6453.[Abstract/Free Full Text]

  2. Li, S., Okamoto, T., Chun, M., Sargiacomo, M., Casanova, J.E., Hansen, S.H., Nishimoto, I. and Lisanti, M.P. (1995) Evidence for a regulated interaction of hetero-trimeric G proteins with caveolin. J. Biol. Chem., 270, 15693–15701.[Abstract/Free Full Text]

  3. Li, S., Song, K.S. and Lisanti, M.P. (1996) Expression and characterization of recombinant caveolin: Purification by poly-histidine tagging and cholesterol-dependent incorporation into defined lipid membranes. J. Biol. Chem., 271, 568–573.[Abstract/Free Full Text]

  4. Moldovan, N., Heltianu, C., Simionescu, N. and Simionescu, M. (1995) Ultrastructural evidence of differential solubility in Triton X-100 of endothelial vesicles and plasma membrane. Exp. Cell Res., 219, 309–313.[CrossRef][Web of Science][Medline]

  5. Scherer, P.E., Lisanti, M.P., Baldini, G., Sargiacomo, M., Corley-Mastick, C. and Lodish, H.F. (1994) Induction of caveolin during adipogenesis and association of GLUT4 with caveolin-rich vesicles. J. Cell Biol., 127, 1233–1243.[Abstract/Free Full Text]

  6. Scherer, P.E., Tang, Z.-L., Chun, M.C., Sargiacomo, M., Lodish, H.F. and Lisanti, M.P. (1995) Caveolin isoforms differ in their N-terminal protein sequence and subcellular distribution: identification and epitope mapping of an isoform-specific monoclonal antibody probe. J. Biol. Chem., 270, 16395–16401.[Abstract/Free Full Text]

  7. Smart, E., Ying, Y.-S., Conrad, P. and Anderson, R.G.W. (1994) Caveolin moves from caveolae to the Golgi apparatus in response to cholesterol oxidation. J. Cell Biol., 127, 1185–1197.[Abstract/Free Full Text]

  8. Couet, J., Li, S., Okamoto, T., Ikezu, T. and Lisanti, M.P. (1997) Identification of peptide and protein ligands for the caveolin-scaffolding domain. Implications for the interaction of caveolin with caveolae-associated proteins. J. Biol. Chem., 272, 6525–6533.[Abstract/Free Full Text]

  9. Okamoto, T., Schlegel, A., Scherer, P.E. and Lisanti, M.P. (1998) Caveolins, a family of scaffolding proteins for organizing ‘preassembled signaling complexes’ at the plasma membrane. J. Biol. Chem., 273, 5419–5422.[Free Full Text]

  10. Song, K.S., Li, S., Okamoto, T., Quilliam, L.A., Sargiacomo, M. and Lisanti, M.P. (1996) Co-purification and direct interaction of Ras with caveolin, an integral membrane protein of caveolae microdomains. Detergent-free purification of caveolae microdomains. J. Biol. Chem., 271, 9690–9697.[Abstract/Free Full Text]

  11. Sargiacomo, M., Scherer, P.E., Tang, Z.L., Casanova, J.E. and Lisanti, M.P. (1994) In vitro phosphorylation of caveolin-rich membrane domains: identification of an associated serine kinase activity as a casein kinase II-like enzyme. Oncogene, 9, 2589–2595.[Web of Science][Medline]

  12. Galbiati, F., Volonte, D., Meani, D., Milligan, G., Lublin, D.M., Lisanti, M.P. and Parenti, M. (1999) The dually acylated NH2-terminal domain of gilalpha is sufficient to target a green fluorescent protein reporter to caveolin-enriched plasma membrane domains. Palmitoylation of caveolin-1 is required for the recognition of dually acylated g-protein alpha subunits in vivo. J. Biol. Chem., 274, 5843–5850.[Abstract/Free Full Text]

  13. Razani, B., Rubin, C.S. and Lisanti, M.P. (1999) Regulation of cAMP-mediated signal transduction via interaction of caveolins with the catalytic subunit of protein kinase A. J. Biol. Chem., 274, 26353–26360.[Abstract/Free Full Text]

  14. Scherer, P.E., Okamoto, T., Chun, M., Nishimoto, I., Lodish, H.F. and Lisanti, M.P. (1996) Identification, sequence and expression of caveolin-2 defines a caveolin gene family. Proc. Natl Acad. Sci. USA, 93, 131–135.[Abstract/Free Full Text]

  15. Tang, Z.-L., Scherer, P.E., Okamoto, T., Song, K., Chu, C., Kohtz, D.S., Nishimoto, I., Lodish, H.F. and Lisanti, M.P. (1996) Molecular cloning of caveolin-3, a novel member of the caveolin gene family expressed predominantly in muscle. J. Biol. Chem., 271, 2255–2261.[Abstract/Free Full Text]

  16. Galbiati, F., Volonte, D., Chu, J.B., Li, M., Fine, S.W., Fu, M., Bermudez, J., Pedemonte, M., Weidenheim, K.M., Pestell, R.G. et al. (2000) Transgenic overexpression of caveolin-3 in skeletal muscle fibers induces a Duchenne-like muscular dystrophy phenotype. Proc. Natl Acad. Sci. USA, 97, 9689–9694.[Abstract/Free Full Text]

  17. Galbiati, F., Engelman, J.A., Volonte, D., Zhang, X.L., Minetti, C., Li, M., Hou, H., Jr, Kneitz, B., Edelmann, W. and Lisanti, M.P. (2001) Caveolin-3 null mice show a loss of caveolae, changes in the microdomain distribution of the dystrophin–glycoprotein complex, and t-tubule abnormalities. J. Biol. Chem., 276, 21425–21433.[Abstract/Free Full Text]

  18. Ikezu, T., Ueda, H., Trapp, B.D., Nishiyama, K., Sha, J.F., Volonte, D., Galbiati, F., Byrd, A.L., Bassell, G., Serizawa, H. et al. (1998) Affinity-purification and characterization of caveolins from the brain: differential expression of caveolin-1, -2, and -3 in brain endothelial and astroglial cell types. Brain Res., 804, 177–192.[CrossRef][Web of Science][Medline]

  19. Monier, S., Parton, R.G., Vogel, F., Behlke, J., Henske, A. and Kurzchalia, T.V. (1995) VIP21-caveolin, a membrane protein constituent of the caveolar coat, oligomerizes in vivo and in vitro. Mol. Biol. Cell, 6, 911–927.[Abstract]

  20. Sargiacomo, M., Scherer, P.E., Tang, Z., Kubler, E., Song, K.S., Sanders, M.C. and Lisanti, M.P. (1995) Oligomeric structure of caveolin: implications for caveolae membrane organization. Proc. Natl Acad. Sci. USA, 92, 9407–9411.[Abstract/Free Full Text]

  21. Song, K.S., Scherer, P.E., Tang, Z., Okamoto, T., Li, S., Chafel, M., Chu, C., Kohtz, D.S. and Lisanti, M.P. (1996) Expression of caveolin-3 in skeletal, cardiac, and smooth muscle cells. Caveolin-3 is a component of the sarcolemma and co-fractionates with dystrophin and dystrophin-associated glycoproteins. J. Biol. Chem., 271, 15160–15165.[Abstract/Free Full Text]

  22. Feron, O., Belhassen, L., Kobzik, L., Smith, T.W., Kelly, R.A. and Michel, T. (1996) Endothelial nitric oxide synthase targeting to caveolae. Specific interactions with caveolin isoforms in cardiac myocytes and endothelial cells. J. Biol. Chem., 271, 22810–22814.[Abstract/Free Full Text]

  23. Feron, O., Dessy, C., Opel, D.J., Arstall, M.A., Kelly, R.A. and Michel, T. (1998) Modulation of the endothelial nitric-oxide synthase–caveolin interaction in cardiac myocytes. Implications for the autonomic regulation of heart rate. J. Biol. Chem., 273, 30249–30254.[Abstract/Free Full Text]

  24. Garcia-Cardena, G., Martasek, P., Masters, B.S., Skidd, P.M., Couet, J., Li, S., Lisanti, M.P. and Sessa, W.C. (1997) Dissecting the interaction between nitric oxide synthase (NOS) and caveolin. Functional significance of the nos caveolin binding domain in vivo. J. Biol. Chem., 272, 25437–25440.[Abstract/Free Full Text]

  25. Venema, V.J., Ju, H., Zou, R. and Venema, R.C. (1997) Interaction of neuronal nitric-oxide synthase with caveolin-3 in skeletal muscle. Identification of a novel caveolin scaffolding/inhibitory domain. J. Biol. Chem., 272, 28187–28190.[Abstract/Free Full Text]

  26. Minetti, C., Sotogia, F., Bruno, C., Scartezzini, P., Broda, P., Bado, M., Masetti, E., Mazzocco, P., Egeo, A., Donati, M.A. et al. (1998) Mutations in the caveolin-3 gene cause autosomal dominant limb-girdle muscular dystrophy. Nat. Genet., 18, 365–368.[CrossRef][Web of Science][Medline]

  27. Vincent, M., Boussairi, E.H., Cartier, R., Lo, M., Sassolas, A., Cerutti, C., Barres, C., Gustin, M.P., Cuisinaud, G., Samani, N.J. et al. (1993) High blood pressure and metabolic disorders are associated in the Lyon hypertensive rat. J. Hypertens., 11, 1179–1185.[Web of Science][Medline]

  28. Date, M.O., Morita, T., Yamashita, N., Nishida, K., Yamaguchi, O., Higuchi, Y., Hirotani, S., Matsumura, Y., Hori, M., Tada, M. et al. (2002) The antioxidant N-2-mercaptopropionyl glycine attenuates left ventricular hypertrophy in in vivo murine pressure-overload model. J. Am. Coll. Cardiol., 39, 907–912.[Abstract/Free Full Text]

  29. van Veen, T.A., van Rijen, H.V., Wiegerinck, R.F., Opthof, T., Colbert, M.C., Clement, S., de Bakker, J.M. and Jongsma, H.J. (2002) Remodeling of gap junctions in mouse hearts hypertrophied by forced retinoic acid signaling. J. Mol. Cell Cardiol., 34, 1411–1423.[CrossRef][Web of Science][Medline]

  30. Rosenkranz, S., Flesch, M., Amann, K., Haeuseler, C., Kilter, H., Seeland, U., Schluter, K.D. and Bohm, M. (2002) Alterations of beta-adrenergic signaling and cardiac hypertrophy in transgenic mice overexpressing TGF-beta(1). Am. J. Physiol. Heart Circul. Physiol., 283, H1253–1262.[Abstract/Free Full Text]

  31. Woodcock, E.A., Wang, B.H., Arthur, J.F., Lennard, A., Matkovich, S.J., Du, X.J., Brown, J.H. and Hannan, R.D. (2002) Inositol polyphosphate 1-phosphatase is a novel antihypertrophic factor. J. Biol. Chem., 277, 22734–22742.[Abstract/Free Full Text]

  32. Janczewski, A.M., Kadokami, T., Lemster, B., Frye, C.S., McTiernan, C.F. and Feldman, A.M. (2003) Morphological and functional changes in cardiac myocytes isolated from mice overexpressing TNF-{alpha}. Am. J. Physiol. Heart Circul. Physiol., 284, H960–969.[Abstract/Free Full Text]

  33. Jacks, C.M., Biltz, R.E. and Hackett, P.B. (1988) Analysis of potential expression of highly related members of the ribosomal protein L32 gene family. Nucl. Acids Res., 16, 10751–10764.[Abstract/Free Full Text]

  34. Reiser, P.J., Portman, M.A., Ning, X.H. and Schomisch Moravec, C. (2001) Human cardiac myosin heavy chain isoforms in fetal and failing adult atria and ventricles. Am. J. Physiol. Heart Circul. Physiol., 280, H1814–1820.[Abstract/Free Full Text]

  35. Henning, R.J., Silva, J., Reddy, V., Kamat, S., Morgan, M.B., Li, Y.X. and Chiou, S. (2000) Cocaine increases beta-myosin heavy-chain protein expression in cardiac myocytes. J. Cardiovasc. Pharmac. Ther., 5, 313–322.

  36. Paulus, W.J. and Shah, A.M. (1999) NO and cardiac diastolic function. Cardiovasc. Res., 43, 595–606.[Free Full Text]

  37. Koga, A., Oka, N., Kikuchi, T., Miyazaki, H., Kato, S. and Imaizumi, T. (2003) Adenovirus-mediated overexpression of caveolin-3 inhibits rat cardiomyocyte hypertrophy. Hypertension, 42, 213–219.[Abstract/Free Full Text]

  38. Piech, A., Massart, P.E., Dessy, C., Feron, O., Havaux, X., Morel, N., Vanoverschelde, J.L., Donckier, J. and Balligand, J.L. (2002) Decreased expression of myocardial eNOS and caveolin in dogs with hypertrophic cardiomyopathy. Am. J. Physiol. Heart Circul. Physiol., 282, H219–231.[Abstract/Free Full Text]

  39. Lasley, R.D., Narayan, P., Uittenbogaard, A. and Smart, E.J. (2000) Activated cardiac adenosine A(1) receptors translocate out of caveolae. J. Biol. Chem., 275, 4417–4421.[Abstract/Free Full Text]

  40. Fujita, T., Toya, Y., Iwatsubo, K., Onda, T., Kimura, K., Umemura, S. and Ishikawa, Y. (2001) Accumulation of molecules involved in alpha1-adrenergic signal within caveolae: caveolin expression and the development of cardiac hypertrophy. Cardiovasc. Res., 51, 709–716.[Abstract/Free Full Text]

  41. Woodman, S.E., Park, D.S., Cohen, A.W., Cheung, M.W., Chandra, M., Shirani, J., Tang, B., Jelicks, L.A., Kitsis, R.N., Christ, G.J. et al. (2002) Caveolin-3 knock-out mice develop a progressive cardiomyopathy and show hyperactivation of the p42/44 MAPK cascade. J. Biol. Chem., 277, 38988–38997.[Abstract/Free Full Text]

  42. Sotgia, F., Lee, J.K., Das, K., Bedford, M., Petrucci, T.C., Macioce, P., Sargiacomo, M., Bricarelli, F.D., Minetti, C., Sudol, M. et al. (2000) Caveolin-3 directly interacts with the C-terminal tail of beta-dystroglycan. Identification of a central WW-like domain within caveolin family members. J. Biol. Chem., 275, 38048–38058.[Abstract/Free Full Text]

  43. Huang, P.L. (2000) Mouse models of nitric oxide synthase deficiency. J. Am. Soc. Nephrol., 11 (Suppl. 16), S120–123.[Abstract/Free Full Text]

  44. Feng, Q., Song, W., Lu, X., Hamilton, J.A., Lei, M., Peng, T. and Yee, S.P. (2002) Development of heart failure and congenital septal defects in mice lacking endothelial nitric oxide synthase. Circulation, 106, 873–879.[Abstract/Free Full Text]

  45. Mori, K., Manabe, T., Nii, M., Hayabuchi, Y., Kuroda, Y. and Tatara, K. (2002) Plasma levels of natriuretic peptide and echocardiographic parameters in patients with Duchenne's progressive muscular dystrophy. Pediatr. Cardiol., 23, 160–166.[CrossRef][Web of Science][Medline]

  46. Ramaciotti, C., Scott, W.A., Lemler, M.S., Haverland, C. and Iannaccone, S.T. (2002) Assessment of cardiac function in adolescents with Duchenne muscular dystrophy: importance of neurohormones. J. Child Neurol., 17, 191–194.[Abstract/Free Full Text]

  47. Zhu, X., Wheeler, M.T., Hadhazy, M., Lam, M.Y. and McNally, E.M. (2002) Cardiomyopathy is independent of skeletal muscle disease in muscular dystrophy. FASEB J., 16, 1096–1098.[Abstract/Free Full Text]

  48. Vaghy, P.L., Fang, J., Wu, W. and Vaghy, L.P. (1998) Increased caveolin-3 levels in mdx mouse muscles. FEBS Lett., 431, 125–127.[CrossRef][Web of Science][Medline]

  49. Repetto, S., Bado, M., Broda, P., Lucania, G., Masetti, E., Sotgia, F., Carbone, I., Pavan, A., Bonilla, E., Cordone, G. et al. (1999) Increased number of caveolae and caveolin-3 overexpression in Duchenne muscular dystrophy. Biochem. Biophys. Res. Commun., 261, 547–550.[CrossRef][Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
DMMHome page
D. Merrick, L. K. J. Stadler, D. Larner, and J. Smith
Muscular dystrophy begins early in embryonic development deriving from stem cell loss and disrupted skeletal muscle formation
Dis. Model. Mech., July 1, 2009; 2(7-8): 374 - 388.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
Y. M. Tsutsumi, Y. T. Horikawa, M. M. Jennings, M. W. Kidd, I. R. Niesman, U. Yokoyama, B. P. Head, Y. Hagiwara, Y. Ishikawa, A. Miyanohara, et al.
Cardiac-Specific Overexpression of Caveolin-3 Induces Endogenous Cardiac Protection by Mimicking Ischemic Preconditioning
Circulation, November 4, 2008; 118(19): 1979 - 1988.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
M. F. Dias-Peixoto, R. A.S. Santos, E. R.M. Gomes, M. N.M. Alves, P. W.M. Almeida, L. Greco, M. Rosa, B. Fauler, M. Bader, N. Alenina, et al.
Molecular Mechanisms Involved in the Angiotensin-(1-7)/Mas Signaling Pathway in Cardiomyocytes
Hypertension, September 1, 2008; 52(3): 542 - 548.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
D. Volonte, C. F. McTiernan, M. Drab, M. Kasper, and F. Galbiati
Caveolin-1 and caveolin-3 form heterooligomeric complexes in atrial cardiac myocytes that are required for doxorubicin-induced apoptosis
Am J Physiol Heart Circ Physiol, January 1, 2008; 294(1): H392 - H401.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
H. Abriel
Roles and regulation of the cardiac sodium channel Nav1.5: Recent insights from experimental studies
Cardiovasc Res, December 1, 2007; 76(3): 381 - 389.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
O. Feron and J.-L. Balligand
Caveolins and the regulation of endothelial nitric oxide synthase in the heart
Cardiovasc Res, March 1, 2006; 69(4): 788 - 797.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
A. Maguy, T. E. Hebert, and S. Nattel
Involvement of lipid rafts and caveolae in cardiac ion channel function
Cardiovasc Res, March 1, 2006; 69(4): 798 - 807.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
J. M. Nerbonne and R. S. Kass
Molecular Physiology of Cardiac Repolarization
Physiol Rev, October 1, 2005; 85(4): 1205 - 1253.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
S. J. Nixon, J. Wegner, C. Ferguson, P.-F. Mery, J. F. Hancock, P. D. Currie, B. Key, M. Westerfield, and R. G. Parton
Zebrafish as a model for caveolin-associated muscle disease; caveolin-3 is required for myofibril organization and muscle cell patterning
Hum. Mol. Genet., July 1, 2005; 14(13): 1727 - 1743.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. E Hardt and J. Sadoshima
Negative regulators of cardiac hypertrophy
Cardiovasc Res, August 15, 2004; 63(3): 500 - 509.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
J.-P. Gratton, P. Bernatchez, and W. C. Sessa
Caveolae and Caveolins in the Cardiovascular System
Circ. Res., June 11, 2004; 94(11): 1408 - 1417.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow A corrigendum has been published
Right arrow All Versions of this Article:
12/21/2777    most recent
ddg313v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (27)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Aravamudan, B.
Right arrow Articles by Galbiati, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Aravamudan, B.
Right arrow Articles by Galbiati, F.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?