Human Molecular Genetics Advance Access originally published online on September 2, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Human Molecular Genetics, 2003, Vol. 12, No. 21 2817-2825
DOI: 10.1093/hmg/ddg301
© 2003 Oxford University Press
A novel sequence-based approach to localize translocation breakpoints identifies the molecular basis of a t(4;22)
1Division of Human Genetics and Molecular Biology, The Children's Hospital of Philadelphia, Philadelphia, PA 19104, USA and 2Department of Pediatrics, University of Pennsylvania School of Medicine, Philadelphia, PA 19104, USA
Received July 2, 2003; Revised August 15, 2003; Accepted August 25, 2003
| ABSTRACT |
|---|
|
|
|---|
Low copy repeats (LCRs) located in 22q11.2, especially LCR-B, are susceptible to rearrangements associated with several relatively common constitutional disorders. These include DiGeorge syndrome, Velocardiofacial syndrome, Cat-eye syndrome and recurrent translocations of 22q11 including the constitutional t(11;22) and t(17;22). The presence of palindromic AT-rich repeats (PATRRs) within LCR-B of 22q11.2, as well as within the 11q23 and 17q11 regions, has suggested a palindrome-mediated, stem-loop mechanism for the generation of such recurring constitutional 22q11.2 translocations. The mechanism responsible for non-recurrent 22q11.2 rearrangements is presently unknown due to the extensive effort required for breakpoint cloning. Thus, we have developed a novel fluorescence in-situ hybridization and primed in-situ hybridization (PRINS) approach and rapidly localized the breakpoint of a non-recurrent 22q11.2 translocation, a t(4;22). Multiple primer pairs were designed from the sequence of a 200 kb, chromosome 4, breakpoint-spanning BAC to generate PRINS probes. Amplification of adjacent primer pairs, labeled in two colors, allowed us to narrow the 4q35.1 breakpoint to a 6.7 kb clonable region. Application of our improved PRINS protocol facilitated fine-mapping the translocation breakpoints within 4q35.1 and 22q11.2, and permitted rapid cloning and analysis of translocation junction fragments. To confirm the PRINS localization results, PCR mapping of t(4;22) somatic cell hybrid DNA was employed. Analysis of the breakpoints demonstrates the presence of a 554 bp palindromic sequence at the chromosome 4 breakpoint and a 22q11.2 location within the same PATRR as the recurrent t(11;22) and t(17;22). The sequence of this breakpoint further suggests that a stem-loop secondary structure mechanism is responsible for the formation of other, non-recurrent translocations involving LCR-B of 22q11.2.
| INTRODUCTION |
|---|
|
|
|---|
Chromosomal rearrangements, including translocations, occur in about one in 625 individuals in the population (1). Some translocations have facilitated positional cloning of disrupted disease-causing genes, for example in patients with Duchenne muscular dystrophy (2) neurofibromatosis type 1 (NF1) (35), Wilms tumor/aniridia (6) and Alagille syndrome (7). Others have permitted insight into mechanisms related to chromosomal rearrangement and genomic architecture (811). Although fluorescence in situ hybridization (FISH) has been used as the primary tool in studies to map translocation breakpoints (12), precise identification of junction fragments to facilitate the cloning of such rearrangements has required time-consuming protocols. Thus, a robust and high-throughput approach for isolation of translocation breakpoints is warranted with the purpose of candidate gene identification and dissection of molecular mechanisms related to chromosome dynamics. In the present study, we have adapted a novel sequence-based cytogenetic approach for translocation breakpoint identification, allowing characterization of the genomic structure of a previously undescribed t(4;22)(q35.1;q11.2).
The 22q11 region is one of the most extensively studied chromosomal regions in the human genome, in particular because deletions and other rearrangements at 22q11 occur at an extremely high frequency (greater than 1 : 30004000 live births) (13). It is susceptible to constitutional deletions associated with developmental disorders such as DiGeorge (DGS), velocardiofacial syndrome (VCFS) or conotruncal anomaly face syndrome (CAFS). It is also susceptible to creation of the supernumerary marker chromosome associated with Cat-Eye syndrome. An additional rearrangement associated with this region, the t(11;22)(q23;q11), can give rise to the Supernumerary der(22) t(11;22) syndrome resulting from 3:1 meiotic malsegregation (14). Other recurrent 22q11 translocations occur in multiple malignant disorders including the t(9;22) rearrangement seen in acute lymphocytic leukemia and chronic myeloid leukemia (CML), the t(8;22) associated with Burkitts lymphoma, and the t(11;22) of Ewings sarcoma and peripheral neuroepithelioma. In addition, a t(17;22) has been seen twice in association with NF1 (4,15).
Recurrent translocations involving 22q11, such as the constitutional t(11;22) and the less frequent t(17;22) associated with NF-1, have been instrumental in studying the structure and mechanism of chromosomal rearrangements. Physical mapping studies involving these rearrangements have revealed the presence of low copy repeats (LCRs) at the 22q11.2 breakpoint region that range in size from
200 to 400 kb (16). The recurrent breakpoint of the t(11;22)(q23;q11) has been cloned and sequenced (10,17,18). The presence of palindromic AT-rich repeats (PATRRs) within one of the LCRs at 22q11.2, LCR-B, as well as the 11q23 region to which it is conjoined, has been well documented (16). The PATRR on 22q11.2 is located within an unclonable gap in the sequence of chromosome 22, whereas that at 11q23 has been shown to have a nearly perfect, although somewhat unstable, palindromic structure (8,10). Analysis of the only other recurrent translocation, the t(17;22), shows that it involves the identical PATRR of 22q11.2 as well as a PATRR at 17q11, invoking a palindrome-mediated mechanism for the generation of recurrent constitutional 22q11.2 translocations (11). Several other autosomes, as well as the X chromosome, are involved in rearrangements with the PATRR of LCR-B in 22q11.2 (1921). The location and structure of the partner chromosome breakpoints remain uncharacterized. Nevertheless, the involvement of the same molecular region within 22q11.2 has implicated the genomic organization at 22q11.2 as being responsible for these non-recurring rearrangements (11,21).
In the present study, the primed in situ labeling (PRINS) approach has been adapted to molecularly analyze the first variant 22q11.2 translocation, a t(4;22). Previously, PRINS has been used to detect highly repetitive and easily detectible centromeric and telomeric sequences in interphase and on metaphase chromosomes (22). Here, PRINS has been employed to replace some of the molecular steps traditionally involved in mapping translocation breakpoints. Because PRINS combines FISH and PCR, it provides a sensitive, rapid and cost effective approach that eliminates the need to purify large insert DNA clones or to generate pre-labeled probes. The selection of sequence-specific primer pairs for use in the synthesis of PRINS probes has now been facilitated by the availability of genomic sequence data such that sequence-specific probes can be used to rapidly map chromosomal rearrangements to the molecular level. In the present work, the PRINS approach has been used to localize the t(4;22) breakpoints within 4q35.1 and 22q11.2, and has permitted the cloning and analysis of junction fragments to further our understanding of the mechanisms involved in other, non-recurrent 22q11.2 rearrangements.
| RESULTS |
|---|
|
|
|---|
FISH mapping
The balanced t(4;22) (q35.1;q11.2) was originally identified by G-band karyotype analysis because the carrier had a child with an unbalanced karyotype clinically affected with VCFS. Immortalized lymphoblast cells obtained from the t(4;22) patient were analyzed by FISH using cosmid probes for loci D22S788 (N41) and ZNF74. These 22q11.2 probes correspond to regions just proximal and distal, respectively, to LCR-B which contains the common breakpoint found in the recurrent t(11;22) and t(17;22) constitutional translocations (11,23). Signals of c68a1 (ZNF74) were detected on the der(22), whereas those of c87f9 (D22S788) were detected on the der(4), positioning the breakpoint of the patient within LCR-B (data not shown).
To localize the chromosome 4 breakpoint junction, FISH analysis was performed using 11 fully sequenced BAC clones that were each separated by
1 Mb of genomic sequence as probes (Fig. 1, upper panel). In each experiment, two probes were separately labeled with either spectrum red or spectrum green and cohybridized to metaphase chromosomes (Fig. 1, upper line). This paired probe approach rapidly led to the identification of a 200 kb BAC that hybridized to the normal chromosome 4, der(4) and der(22) (Fig. 2), indicating that this clone, RP11-701p16, contains sequences found on all three chromosomes and thus spans the 4q35.1 breakpoint.
|
|
Narrowing translocation breakpoint regions by PRINS
To further refine the FISH-based localization of the 22q11.2 breakpoint, PRINS was performed with six PCR-based probes used concurrently in a single experiment. Three primer pairs (designated 95, 96, 97) amplify fragments just proximal to LCR-B of 22q11.2 and were labeled with rhodamine. The other three primer pairs (106, 107, 108) amplify fragments distal to LCR-B and were labeled with fluorescein (Table 1). PRINS results on interphase nuclei of lymphoblasts derived from the t(4;22) patient exhibited one fused (yellow) signal corresponding to the normal chromosome 22, and separate red and green signals from the der(22) and der(4) chromosomes, respectively (Fig. 3A). These results indicate that the 22q11.2 breakpoint separates the proximal from the distal primer pairs, confirming the FISH results that suggested that this rearrangement occurs within LCR-B of chromosome 22.
|
|
To more precisely localize the breakpoint on chromosome 4, the sequence of the breakpoint spanning RP11-701p16 clone was utilized to design multiple primer pairs as PRINS probes. A 65 kb region was selected in the center of the BAC sequence and ten primer pairs were designed to amplify 10 unique 500600 bp fragments. Each of these primer pairs (110) was separated by 59 kb (Fig. 1 and Table 1). Dual-color PRINS was performed using two primer pairs amplified sequentially to incorporate two different labeled nucleotides. A minimum of 50 interphase nuclei and metaphases were analyzed for each dual-color PRINS study. In experiments involving primer pairs 16, the majority of PRINS reactions revealed fused signals on interphase nuclei from the t(4;22) patient's cells (data not shown), indicating that these amplified PRINS probes remain close to one another on chromosome 4, are not translocated as a result of the rearrangement and map proximal to the breakpoint. The combination of primer pairs 7 and 8, labeled separately with fluorescein and rhodamine, respectively, showed three signals (Fig. 3B). The observed yellow, or fused, signals reflect the fact that these sequences are normally adjacent to one another on chromosome 4. Distinct green (primer pair 7) and red (primer pair 8) signals were seen in most interphase nuclei. They are presumed to be located on the der(4) and der(22) chromosomes, respectively. These results indicate that the t(4;22) breakpoint is localized to a 6.7 kb region separating PRINS probes 7 and 8 (Figs 1 and 3B).
To increase signal intensity and achieve visualization on metaphase chromosomes, two adjacent primer pairs were used with a single labeled nucleotide and combined with two additional adjacent primer pairs labeled with a second nucleotide. Thus, the PRINS probes generated by primer pairs 6 and 7 were labeled with fluorescein, and those from primer pairs 8 and 9, were subsequently labeled with rhodamine. As anticipated, based on the interphase PRINS results, one fused signal representing the normal chromosome 4 and one green and one red representing the der(4) and the der(22), respectively, were seen on both metaphase chromosomes (Fig. 3C) and in interphase (Fig. 3D) nuclei. These results confirm that the breakpoint lies in the interval between primer pairs 7 and 8 (Fig. 1).
PCR confirmation of PRINS mapping using somatic hybrid cell DNA
To validate the PRINS localization results, the same primers used in PRINS mapping experiments were utilized for PCR amplification of DNA isolated from the t(4;22) patient-derived lymphoblast cell line and from somatic cell hybrid cell lines containing the der(4) and der(22) chromosomes. Control PCR reactions with primer pairs 110 amplified products from the RP11-701p16 BAC as well as DNA isolated from the t(4;22) lymphoblast cell line (Fig. 4 and data not shown). These primer pairs were applied to DNA from somatic cell hybrids containing the der(4), or der(22) as the only relevant chromosomes. Primer pairs 17 consistently amplified products from der(4)-containing hybrid DNA, but not from the der(22) hybrid (Fig. 4, lane 7), indicating that the chromosome 4 breakpoint is distal to primer pair 7. Primer pairs 810 amplified products only from the der(22)-containing hybrid (Fig. 4, lanes 810) indicating that this portion of 4q35.1 is translocated to the der(22) chromosome. Taken together with the PRINS results, these studies confirm that the 4q35.1 breakpoint lies within the 6.7 kb region delineated by primer pairs 7 and 8.
|
PCR amplification of t(4;22) breakpoint sequences
The exact location and sequence of the breakpoints within the 6.7 kb region of 4q35.1 and the LCR-B region of 22q11.2 were determined by nested primer PCR. Chromosome 22q11 primers were designed against sequences flanking the PATRR of the common breakpoint found in the recurrent t(11;22) and t(17;22) (15,17) (Fig. 5A). In order to amplify junction fragments across the chromosome 4 breakpoint, primers corresponding to sequences located in the 6.7 kb region delineated by PRINS probes 7 and 8 were designed in both forward (telomeric) and reverse (centromeric) directions (Fig. 5A). Two successive rounds of PCR were used to amplify der(4) and der(22) junction fragments from both somatic cell hybrid and lymphoblast patient DNA templates. The der(4) breakpoint, amplified with forward 4q35.1 and reverse 22q11.2 primers, contained 1007 bp of chromosome 4 sequence proximal to 105 bp of translocated AT-rich chromosome 22 sequence (Fig. 5B). The der(22) junction fragment was amplified with the oppositely oriented primers and contained 198 bp of AT-rich chromosome 22 sequence joined to 612 bp of chromosome 4 sequence distal to the breakpoint (Fig. 5C). Comparison of the der(4), der(22) and 4q35.1 chromosome sequences at the translocation breakpoint demonstrates the continuation of the chromosome 4 sequence from the der(4) onto the der(22) chromosome at the breakpoint junction with the loss of just one base pair. At this breakpoint, chromosome 22 sequence was seen to replace that from chromosome 4. Owing to a large gap (
90 kb) in the known sequence for the LCR-B region of 22q11.2, the amount of chromosome 22 sequence lost to the t(4;22) translocation cannot be determined. However, based on the largest amount of sequence previously deduced at the t(11;22)(q23;q11.2) breakpoint junction (9), the amount of 22q11.2 sequence lost during the t(4;22) translocation is estimated to be at least 168 bp. These results confirm that the t(4;22) breakpoint on chromosome 4 occurs between PRINS probes 7 and 8, and illustrate the utility of PRINS for rapidly mapping translocation breakpoints to the nucleotide level.
|
The sequence surrounding the 4q35.1 breakpoint was analyzed further to understand the DNA secondary structure that may have contributed to the formation of the t(4;22). Unlike the t(11;22) and t(17;22) rearrangements, the 2500 bp of sequence flanking the 4q35.1 breakpoint contains no simple AT-rich repeats, as found by the RepeatMasker sequence analysis tool (see Materials and Methods). M-Fold analysis (http://bioweb.pasteur.fr/seqanal/interfaces/mfold-simple.html), however, revealed a 554 bp palindromic sequence, the inverted repeats of which are separated by an intervening 547 nucleotides. Complimentary sequence contained in this palindrome arises from two oppositely oriented Alu elements that are 266 and 296 nucleotides long. The secondary structure formed by this stretch of chromosome 4 sequence is predicted to form a 277 bp stem capped by a 547 nucleotide loop. Interestingly, the 4q35.1 breakpoint falls near the tip of this structure.
| DISCUSSION |
|---|
|
|
|---|
Several well-documented approaches have been used to localize the breakpoint junctions of chromosomal rearrangements in order to identify disrupted genes and to investigate the genomic structure and/or the mechanisms involved in rearrangement formation. Currently, FISH serves as a major tool to both identify chromosomal rearrangements and to position breakpoints. This technique, however, requires cloned probes that are limited in their positional resolution and are cumbersome to prepare. Traditionally, FISH probes corresponding to particular chromosomal sequences have been either isolated from genomic libraries, or selected and obtained from a commercial source. In either case, one is limited to pre-existing clones fortuitously positioned along the chromosome. These probes are then used in FISH experiments to walk along the chromosome to localize the site of a rearrangement. When a 150200 kb BAC or PAC probe is found to span a breakpoint junction, smaller fragments of the clone must then be isolated and subcloned in order to further localize the breakpoint by FISH.
PRINS can be used as a robust and high-throughput alternative method to rapidly and specifically identify chromosomal rearrangements. This approach, involving features of both FISH and PCR, utilizes oligonucleotide primers to amplify 300500 bp probes visualized by fluorescence microscopy. Thus, the primers are annealed to interphase and metaphase chromosomes and extended with Taq polymerase in the presence of labeled nucleotides to generate a detectable fluorescent signal. Successive melting, annealing and extension cycles, similar to those done for PCR, are done to amplify the labeled probe. The utility of PRINS lies in the ability to use the publicly available genomic sequence data to design primers to amplify specific chromosomal sequences. Previous studies have used this approach to tailor probes targeted to the known deleted regions in congenital disorders but none have used the technology for breakpoint mapping or identification. For example, PRINS has been used to detect microdeletions in the Azoospermia factor (AZF) region associated with azoospermia (24), the SNRPN and GABRB3 loci associated with PraderWilli/Angelman syndrome (PWS/AS), DGCR2/TUPLE1 loci affected in DiGeorge/velocardiofacial syndrome (DGS/VCFS) (25), and intragenic deletions in the Dystrophin gene (26).
The primary limitations of PRINS, namely lack of probe sensitivity and specificity, have been rectified in a variety of current protocols. The low signal strength typically obtained from a single 300500 bp PRINS probe was initially circumvented by examining high copy number sequences such as those found at the centromeres and telomeres (2730). Other investigators have used confocal laser microscopy to detect a single copy locus as in the case of the factor IX gene (31) and to identify intragenic polymorphisms associated with the Dystrophin gene (26). Still others have detected single-copy sequences using a combination of multiple primers and the tyramide peroxidase signal amplification system (24,25,32). Here, we have taken several steps to enhance the signals obtained from unique sequences by using (1) multiple primers, (2) multiple cycling reactions and (3) the tyramide peroxidase system. In the present study, primers were also designed to amplify chromosomal regions having limited repetitive sequence. This has effectively increased specificity and signal-to-noise ratio.
The present study is novel in that it uses PRINS to map the breakpoint of a previously unreported chromosomal rearrangement, the t(4;22) (q35.1;q11.2). The breakpoint-spanning BAC was identified initially by FISH and the breakpoint region was narrowed using primer pairs designed from the sequence of this clone by PRINS. Future studies may use PRINS probes designed from genomic sequence in the publicly available databases. Primer pairs flanking the LCR-B region of 22q11.2 also provide a valuable resource for future PRINS experiments designed to localize both deletion and translocation breakpoints in this highly unstable region of chromosome 22.
The LCR-B region of 22q11.2 is a translocation hot-spot involved in the recurrent t(11;22) and t(17;22) rearrangements. Breakpoints within this region fall in the center of PATRR sequences that are part of a low copy repeat module with similarity to the NF1 gene. Interestingly, the breakpoints on both 11q23 and 17q11 involved in recurrent translocations with 22q11.2 are also located between similar AT-rich palindromes [in the case of the t(17;22), the NF1 gene is disrupted] (9,11,15). These findings have invoked a mechanism in which palindromic AT-rich regions breathe or separate from one another, followed by the annealing of the palindromic sequences and formation of a stem-loop secondary structure (9). During meiosis, the loop at the end of this structure is presumed to interact with a similar structure on an adjacent chromosome, which is followed by double-strand breakage, repair and ligation to the adjacent chromosome. Analysis of t(11;22) and t(17;22) breakpoints have supported this mechanism since junctions with 11q23 or 17q11 sequences occur at the center of the palindromic sequence, or near the tip of the loop in the predicted stemloop structure. On 22q11.2, translocations with LCR-B are associated with the loss of variable, yet symmetrical, amounts of PATRR sequence, indicating that double strand breaks appear to cleave both strands of the stem at specific locations (9,11) (current sequence analysis). Because of sequence similarity within AT-rich regions of opposing chromosomes, it is possible that proteins associated with the recombination pathway also participate, since these constitutional rearrangements occur during meiosis when chromosomes normally align and undergo recombination (15,33).
In a recent publication describing multiple translocations within 22q11.2 (21) the authors state that the molecular basis for non-recurrent, reciprocal 22q11.2 translocations is not known. This paper would represent a first step toward unraveling the mechanism. Although the authors propose the possibility that a mechanism similar to the t(11;22) and t(17;22) is involved, our analysis of the t(4;22) at a detailed sequence level provides the first evidence that this is the case. Analysis of chromosome 4 sequence surrounding the t(4;22) breakpoint lends new insight into the mechanisms underlying constitutional translocations involving the LCR-B region of 22q11.2. Examination of the 4q35.1 sequence surrounding this breakpoint reveals the presence of a 554 bp palindromic sequence (with 38 mismatches), the complimentary sequences of which are separated by a 547 bp gap. Using the M-FOLD secondary structure prediction algorithm (http://bioweb.pasteur.fr/seqanal/interfaces/mfold-simple.html), this sequence would be expected to form a 277 bp stem capped by a 547 bp loop. Interestingly, the t(4;22) junction occurs at the very center of the 547 bp loop, further supporting a mechanism involving stem-loop structures in constitutional translocations involving the LCR-B region of 22q11.2.
Additional sequence analysis of this region of 4q35.1, however, fails to detect any appreciable AT-rich repeats or sequence similarity to the LCR-B region of 22q11.2, arguing against a mechanism involving alignment and recombination of homologous sequences. Together, these findings demonstrate that palindromic sequences capable of forming stemloop structures are sufficient to allow constitutional translocations with the LCR-B region of 22q11.2 to occur, and that AT-rich repeats do not appear to be necessary for these rearrangements. This observation is also supported by a constitutional t(X;22)(q27;q11) in which the chromosome 22 breakpoint was found to occur in a non-AT-rich portion of the LCR-B, and forms a junction with an X chromosome sequence lacking AT-rich repeats (20). It may simply be a coincidence that AT-rich sequences have been found at breakpoints involving 22q11.2, since stretches of AT repeats are inherently palindromic. AT-rich sequences, however, are more likely to denature and form secondary structures due to their decreased melting temperatures. This characteristic is likely to be responsible for the recurrence of t(11;22) and t(17;22) translocations, and explains why the t(4;22) does not recur.
Further, in the aforementioned manuscript (21) the authors suggest that telomeric regions of the partner chromosome are more often involved. This is an interesting observation as the 4;22 translocation we have described does occur in a terminal band (4q35). However, the breakpoint of this t(4;22) is located at a considerable distance from the telomere (>5 Mb) and therefore we propose that it is unlikely that the telomeric repeat sequences play a significant role in facilitating this rearrangement. Rather, we would suggest that the palindromic sequence at 4q35 is more likely the culprit. Molecular analysis of additional translocations involving 22q11.2, especially those involving LCR-B, should shed additional light on this hypothesis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
FISH analysis
Metaphase spreads from a patient with the t(4;22) translocation were prepared from a lymphoblastoid cell line (CH 95-248) using standard methodology. Cosmid probes for chromosome 22 were isolated from the LL22NCO3 library as previously described (12). BAC clones for chromosome 4 were selected based on their map location from the UCSC database (http://genome.ucsc.edu/) and purchased from BACPAC resources (http://bacpac.chori.org/). The probes used for FISH were labeled by nick translation (34). Pre and post hybridization conditions were as previously described with minor modifications (35).
PRINS
PRINS reactions were carried according to published protocols (30,36) with slight modifications. Forward and reverse primers for each primer pair were 2630 bp in length. Slides were aged for 1 h at 7080°C and then pretreated with 0.005% pepsin/10 mM HCl for 3045 s at 37°C. The slides were placed immediately in 1x PBS for 1 min and dehydrated through an ethanol series (70, 85, 100%). The primer sequences, annealing temperatures and distance between each primer pair are described in Table 1. For each primer pair, a 50 µl reaction mixture was prepared containing: 200400 nmol of primer, 0.2 mM each of dATP, dCTP and dGTP, and 0.02 mM of dTTP and 0.02 mM of Biotin 16-dUTP and Digoxigenin-11-dUTP (Roche Molecular Biochemicals, Indianapolis, IN, USA), 50 mM KCl, 10 mM TrisHCL, pH 8.3, 1.5 mM MgCl2, 0.01% bovine serum albumin and 1 µl of Taq DNA polymerase.
The PRINS reactions were carried out on a programmable thermocycler (MJ Research Inc., Waltham, MA, USA) using a glass slide adaptor (SGP 0196). The slide and the cover slip were pre-warmed until the master mix was added and the coverslip was sealed. Two cycle reactions were performed when two or more primer pairs were used and five cycle reactions were performed when a single primer pair was used. The program for PRINS loci (one or two pairs of primers were used, spaced
56 kb apart) consists of denaturation at 95°C for 1 min, annealing at 6062°C for 10 min, and elongation at 70°C for 20 min. After removing the sealed coverslip, the reaction was stopped by the addition of 50 µl stop buffer (0.5 M NaCl and 50 mM EDTA) and incubated for 2 min at 60°C. For the next PRINS reaction, the slides were incubated with 0.025 mM dideoxynucleotide triphosphates (ddNTPs) in a 50 µl mixture containing 0.05 M TrisHCl pH 7.2, 0.01 M MgSO4, 0.01 mM dithiothreitol, 0.15 mg/ml BSA with 1 U Klenow DNA polymerase under a coverslip for 1 h at 37°C to prevent 3' ends of the newly synthesized DNA being used as primers in subsequent reactions (37). The slides were passed through an ethanol series (70, 85 and 100%) and air-dried before proceeding with the next reaction with a new pair of primers and a second reporter. The denaturation step was omitted in this reaction but the same annealing and elongation conditions were used as in the previous reaction.
Slides were washed with 65% formamide and 2x SSC at 42°C for 15 min without shaking and then transferred to 2x SSC at same temperature for 8 min (26). The PRINS product was amplified using the Tyramide signal amplification system as per manufacturer's directions (TSA-indirect, NEN Life Sciences products, Boston, MA, USA). TSA, sometimes called CARD for Catalyzed Reporter Deposition (38), is an enzyme-mediated detection method that utilizes the catalytic activity of horseradish peroxidase (HRP) to generate high-density labeling of a target nucleic acid sequence in situ. Signals were detected with the respective horseradish peroxidase conjugates and flourochrome antibodies. The preparations were counterstained with DAPI and analyzed by epifluorescent microscopy. Selected images were digitally captured (Applied Imaging Inc., Santa Clara, CA, USA).
PCR amplification of 4q35.1 and t(4;22)junction sequences
Somatic cell hybrids prepared from the t(4;22) containing cell line (CH 95248) were obtained from GMP Genetics Inc. (Waltham, MA, USA). DNA from somatic cell hybrids containing only the der(4) (s1219003/6) or the der(22) (s1219003/2) was used for PCR analysis. The primers used in the PRINS reactions (Table 1) were used with same annealing temperatures with DNA from the der(4), der(22)-containing hybrids and genomic DNA from the patient's cell line (CH95248). PCR reactions (50 µl) consisted of 10x buffer, MgCl2, dNTPs and Taq polymerase. PCR protocols included an 85°C hot-start step for 1 min to avoid non-specific primer extension, followed by addition of Taq polymerase. The reaction was then run for 35 cycles with the following parameters: 94°C for 1 min (denaturation), 62°C for 45 s (annealing) 74°C for 30 s (extension). PCR products were run on 1.2% Agarose gels with a 100 bp ladder.
Junction fragments across the t(4;22) breakpoint were amplified by sequential nested primer PCR using the GeneAmp XL PCR kit (Applied Biosystems) with modifications to the manufacturer's instructions: hot-start protocols (described above) were run with the following parameters: 15 cycles94°C for 1 min (denaturation), 7258°C (-1°C/cycle) for 45 s (annealing), 74°C for 4 min (extension); followed by 25 cycles94°C for 1 min (denaturation), 57°C for 45 s (annealing), 74°C for 4 min (extension). Templates for these reactions included DNA purified from t(4;22) patient-derived lymphoblasts or somatic cell hybrid cells containing either the der(4) or der(22) human chromosomes only. For secondary amplification with nested primers, 50 µl reactions included 1 µl of product from the primary reaction as template. Primers corresponding to 4q35.1 and 22q11.2 sequences were oriented as depicted in Figure 5A and were designed with the following sequences: 4.7.1F, TCCAACTCTGCCTCTTGCTCTGAA; 4.7.2F, AGCACAGCAGTATGTGGGCAATTCAC; 4.8.Rb, CTCTCTGCAACCAAGCAGAACAATTTGAGT; 4.8.Rc, GTAGATGCGTAGTGATGCATGCTCCAGTT; 22.B2R, GGAAGGGAAAAACATGTTAAAAACAAAGAGAGGTAC; 22.B4R, TGTGGGGTGGGGGATGGAACGTTGAAGGATG; 22.B1, CAAAATTGTGTGAAAAGCCTCCAACGG; 22.B3, GGGGGTGGGGGATGGAACGTTGAAGGATC. To amplify der(4) junction fragments, 4.7.1F and 4.7.2F primers were used with 22.B2R and 22.B4R primers while der(22) junction fragments were amplified with 4.8Rb and 4.8.Rc primers were used with 22.B1 and 22.B3 primers. Products from these reactions were cloned into the pCRII-TopoTA vector (Invitrogen) and sequenced using vector-specific primers (Children's Hospital of Philadelphia Nucleic Acids Core Facility).
Sequence alignments were done using BLAST2 algorithms from the National Center for Biotechnology (http://www.ncbi.nlm.nih.gov/BLAST/). Repetitive sequences were detected using the Repeat Masker server at the University of Washington (http://ftp.genome.washington.edu/cgi-bin/RepeatMasker). Palindromic sequence and DNA secondary structure determinations were done using M-FOLD software available from the Pasteur Institute (http://bioweb.pasteur.fr/seqanal/interfaces/mfold-simple.html).
| ACKNOWLEDGEMENTS |
|---|
The authors thank Dr John Graham for providing the patient sample and Dr Gopal Rao Velagaleti for helpful discussions regarding the PRINS technique. These studies were supported in part by funds from CA39926 from the National Cancer Institute of the NIH (B.S.E.) and the Charles E. H. Upham chair in Pediatrics (B.S.E.).
| FOOTNOTES |
|---|
* To whom correspondence should be addressed. Tel: +1 2155903856; Fax: +1 2155903764; Email: beverly{at}mail.med.upenn.edu
| REFERENCES |
|---|
|
|
|---|
- Shaffer, L.G. and Lupski, J.R. (2000) Molecular mechanisms for constitutional chromosomal rearrangements in humans. Annu. Rev. Genet., 34, 297329.[CrossRef][Web of Science][Medline]
- Monaco, A.P., Bertelson, C.J., Middlesworth, W., Colletti, C.A., Aldridge, J., Fischbeck, K.H., Bartlett, R., Pericak-Vance, M.A., Roses, A.D. and Kunkel, L.M. (1985) Detection of deletions spanning the Duchenne muscular dystrophy locus using a tightly linked DNA segment. Nature, 316, 842845.[CrossRef][Medline]
- Fountain, J.W., Wallace, M.R., Brereton, A.M., O'Connell, P., White, R.L., Rich, D.C., Ledbetter, D.H., Leach, R.J., Fournier, R.E. K., Menon, A.G. et al. (1989) Physical mapping of the von Recklinghausen neurofibromatosis region on chromosome 17. Am. J. Hum. Genet., 44, 5867.[Web of Science][Medline]
- Ledbetter, D.H., Rich, D.C., O'Connell, P., Leppert, M. and Carey, J.C. (1989) Precise localization of NF1 to 17q11.2 by balanced translocation. Am. J. Hum. Genet., 44, 2024.[Web of Science][Medline]
- O'Connell, P., Leach, R.J., Ledbetter, D.H., Cawthon, R.M., Culver, M., Eldridge, J.R., Frej, A.K., Holm, T.R., Wolff, E., Thayer, M.J. et al. (1989) Fine structure DNA mapping studies of the chromosomal region harboring the genetic defect in neurofibromatosis type 1. Am. J. Hum. Genet., 44, 5157.[Web of Science][Medline]
- Pritchard-Jones, K., Fleming, S., Davidson, D., Bickmore, W., Porteous, D., Gosden, C., Bard, J., Buckler, A., Pelletier, J., Housman. D. et al. (1990) The candidate Wilms' tumour gene is involved in genitourinary development. Nature, 346, 194197.[CrossRef][Medline]
- Spinner, N.B., Rand, E.B., Fortina, P., Genin, A., Taub, R., Semeraro, A. and Piccoli, D.A. (1994) Cytologically balanced t(2;20) in a two-generation family with Alagille syndrome: cytogenetic and molecular studies. Am. J. Hum. Genet., 55, 238243.[Web of Science][Medline]
-
Kurahashi, H., Shaikh, T.H., Hu, P., Roe, B.A., Emanuel, B.S. and Budarf, M.L. (2000) Regions of genomic instability on 22q11 and 11q23 as the etiology for the recurrent constitutional t(11;22). Hum. Mol. Genet., 9, 16651670.
[Abstract/Free Full Text] -
Kurahashi, H. and Emanuel, B.S. (2001) Long AT-rich palindromes and the constitutional t(11;22) breakpoint. Hum. Mol. Genet., 10, 26052617.
[Abstract/Free Full Text] - Edelmann, L., Spiteri, E., Koren, K., Pulijaal, V., Bialer, M.G., Shanske, A., Goldberg, R. and Morrow, B.E. (2001) AT-rich palindromes mediate the constitutional t(11;22) translocation. Am. J. Hum. Genet., 68, 113.[CrossRef][Web of Science][Medline]
- Kurahashi, H., Shaikh, T., Takata, M., Toda, T. and Emanuel, B.S. (2003) The constitutional t(17;22): another translocation mediated by palindromic AT-rich repeats. Am. J. Hum. Genet., 72, 733738.[CrossRef][Web of Science][Medline]
- Budarf, M.L., Collins, J., Gong, W., Roe, B., Wang, Z., Bailey, L.C., Sellinger, B., Michaud, D., Driscoll, D.A. and Emanuel, B.S. (1995) Cloning a balanced translocation associated with DiGeorge syndrome and identification of a disrupted candidate gene. Nat. Genet., 10, 269278.[CrossRef][Web of Science][Medline]
- Burn, J. and Goodship, J. (1996) Congenital heart disease. In Rimoin, D.L., Connor, J.M., Peyritz, R.E. and Emery, A.E.H. (eds), Principles and Practice of Medical Genetics. Churchill Livingstone, New York, Vol. 1, pp. 767803.
- Shaikh, T.H., Kurahashi, H. and Emanuel, B.S. (2001) Evolutionarily conserved low copy repeats (LCRs) in 22q11 mediate deletions, duplications, translocations, and genomic instability: an update and literature review. Genet. Med., 3, 613.[Web of Science][Medline]
- Kehrer-Sawatzki, H., Assum, G. and Hameister, H. (2002) Molecular characterization of t(17;22)(q11.2;q11.2) is not consistent with NF1 gene duplication. Hum. Genet., 111, 465467.[CrossRef][Web of Science][Medline]
-
Shaikh, T.H., Kurahashi, H., Saitta, S.C., O'Hare, A.M., Hu, P., Roe, B.A., Driscoll, D.A., McDonald-McGinn, D.M., Zackai, E.H., Budarf, M.L. et al. (2000) Chromosome 22-specific low copy repeats and the 22q11.2 deletion syndrome: genomic organization and deletion endpoint analysis. Hum. Mol. Genet., 9, 489501.
[Abstract/Free Full Text] - Kurahashi, H., Shaikh, T.H., Zackai, E.H., Celle, L., Driscoll, D.A., Budarf, M.L. and Emanuel, B.S. (2000) Tightly clustered 11q23 and 22q11 breakpoints permit PCR-based detection of the recurrent constitutional t(11;22). Am. J. Hum. Genet., 67, 763768.[CrossRef][Web of Science][Medline]
- Tapia-Paez, I., Kost-Alimova, M., Hu, P., Roe, B.A., Blennow, E., Fedorova, L., Imreh, S. and Dumanski, J.P. (2001) The position of t(11;22)(q23;q11) constitutional translocation breakpoint is conserved among its carriers. Hum. Genet., 109, 167177.[CrossRef][Web of Science][Medline]
- Li, M., Budarf, M.L., Chien, P., Barnoski, B.L., Emanuel, B.S. and Driscoll, D.A. (1995) Clustering of DiGeorge/velocardiofacial-associated translocations suggestive of a translocation hotspot. Am. J. Hum. Genet. Suppl., 57, A119.
- Debeer, P., Mols, R., Huysmans, C., Devriendt, K., Van de Ven, W.J. and Fryns, J-P. (2002) Involvement of a palindromic chromosome 22-specific low-copy repeat in a constitutional t(X; 22)(q27;q11). Clin. Genet., 62, 410414.[CrossRef][Web of Science][Medline]
-
Spiteri, E., Babcock, M., Kashork, C.D., Weikol, K., Gogineni, S., Lewis, Williams, K.M., Minishima, S., Sasaki, T., Shimshu, N. et al. (2003). Frequent translocations occur between low copy repeats on chromosome 22q11.2(LCR 22s) and telomeric bands of partner chromosomes. Hum. Mol. Genet., 12, 18231837.
[Abstract/Free Full Text] - Wilkens, L., Tchinda, J., Komminoth, P. and Werner, M. (1997) Single- and double-color oligonucleotide primed in situ labeling (PRINS): applications in pathology. Histochem. Cell. Biol., 108, 439446.[CrossRef][Web of Science][Medline]
- Shaikh, T.H., Budarf, M.L., Celle, L., Zackai, E.H. and Emanuel, B.S. (1999) Clustered 11q23 and 22q11 breakpoints and 3 : 1 meiotic malsegregation in multiple unrelated t(11;22) families. Am. J. Hum. Genet., 65, 15951607.[CrossRef][Web of Science][Medline]
- Kadandale, J.S., Wachtel, S.S., Tunca, Y., Martens, P.R., Wilroy, R.S. and Tharapel, A.T. (2002) Deletion of RBM and DAZ in azoospermia: evaluation by PRINS. Am. J. Med. Genet., 107, 105108.[CrossRef][Web of Science][Medline]
- Tharapel, A.T., Kadandale, J.S., Martens, P.R., Wachtel, S.S. and Wilroy, R.S., Jr (2002) Prader Willi/Angelman and DiGeorge/velocardiofacial syndrome deletions:diagnosis by primed in situ labeling (PRINS). Am. J. Med. Genet., 107, 119122.[CrossRef][Web of Science][Medline]
- Cinti, C., Stuppia, L. and Maraldi, N.M. (2002) Combined use of PRINS and FISH in the study of the dystrophin gene. Am. J. Med. Genet., 107, 115118.[CrossRef][Web of Science][Medline]
- Koch, J.E., Kolvraa, S., Petersen, K.B., Gregersen, N. and Bolund, L. (1989) Oligonucleotide-priming methods for the chromosome-specific labelling of alpha satellite DNA in situ.Chromosoma, 98, 259265.[CrossRef][Web of Science][Medline]
-
Gosden, J. and Lawson, D. (1994) Rapid chromosome identification by oligonucleotide-primed in situ DNA synthesis (PRINS). Hum. Mol. Genet., 3, 931936.
[Abstract/Free Full Text] - Pellestor, F., Girardet, A., Andreo, B. and Charlieu, J.P. (1994) A polymorphic alpha satellite sequence specific for human chromosome 13 detected by oligonucleotide primed in situ labelling (PRINS). Hum. Genet., 94, 346348.[Web of Science][Medline]
- Pellestor, F., Girardet, A., Lefort, G., Andreo, B. and Charlieu, J.P. (1995) Selection of chromosome-specific primers and their use in simple and double PRINS techniques for rapid in situ identification of human chromosomes. Cytogenet. Cell. Genet., 70, 138142.[Web of Science][Medline]
-
Cinti, C., Santi, S. and Maraldi, N.M. (1993) Localization of single copy gene by PRINS technique. Nucl. Acids Res., 21, 57995800.
[Free Full Text] - Kadandale, J.S., Wachtel, S.S., Tunca, Y., Wilroy, R.S., Jr, Martens, P.R. and Tharapel, A.T. (2000) Localization of SRY by primed in situ labeling in XX and XY sex reversal. Am. J. Med. Genet., 95, 7174.[CrossRef][Web of Science][Medline]
- Kurahashi, H. and Emanuel, B.S. (2001) Unexpectedly high rate of de novo constitutional t(11;22) translocations in sperm from normal males. Nat. Genet., 29, 139140.[CrossRef][Web of Science][Medline]
-
Lichter, P., Tang, C.J., Call, K., Hermanson, G., Evans, G.A., Housman, D. and Ward, D.C. (1990) High-resolution mapping of human chromosome 11 by in situ hybridization with cosmid clones. Science, 247, 6469.
[Abstract/Free Full Text] - Nimmakayalu, M., Henegariu, O., Ward, D.C. and Bray-Ward, P. (2000) Simple method for preparation of fluor/hapten-labeled dUTP. Biotechniques, 28, 518522.[Web of Science][Medline]
- Velagaleti, G.V., Tharapel, S.A., Martens, P.R. and Tharapel, A.T. (1997) Rapid identification of marker chromosomes using primed in situ labeling (PRINS). Am. J. Med. Genet., 71, 130133.[CrossRef][Web of Science][Medline]
- Speel, E.J., Lawson, D., Hopman, A.H. and Gosden. J. (1995) Multi-PRINS: multiple sequential oligonucleotide primed in situ DNA synthesis reactions label specific chromosomes and produce bands. Hum. Genet., 95, 2933.[Web of Science][Medline]
-
Speel, E.J., Hopman, A.H. and Komminoth, P. (1999) Amplification methods to increase the sensitivity of in situ hybridization: play CARD(S). J. Histochem. Cytochem., 47, 281288.
[Abstract/Free Full Text]
This article has been cited by other articles:
![]() |
H. Inagaki, T. Ohye, H. Kogo, T. Kato, H. Bolor, M. Taniguchi, T. H. Shaikh, B. S. Emanuel, and H. Kurahashi Chromosomal instability mediated by non-B DNA: Cruciform conformation and not DNA sequence is responsible for recurrent translocation in humans Genome Res., February 1, 2009; 19(2): 191 - 198. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gajecka, A. J. Gentles, A. Tsai, D. Chitayat, K. L. Mackay, C. D. Glotzbach, M. R. Lieber, and L. G. Shaffer Unexpected complexity at breakpoint junctions in phenotypically normal individuals and mechanisms involved in generating balanced translocations t(1;22)(p36;q13) Genome Res., November 1, 2008; 18(11): 1733 - 1742. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kato, H. Inagaki, H. Kogo, T. Ohye, K. Yamada, B. S. Emanuel, and H. Kurahashi Two different forms of palindrome resolution in the human genome: deletion or translocation Hum. Mol. Genet., April 15, 2008; 17(8): 1184 - 1191. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kurahashi, H. Inagaki, E. Hosoba, T. Kato, T. Ohye, H. Kogo, and B. S. Emanuel Molecular cloning of a translocation breakpoint hotspot in 22q11 Genome Res., April 1, 2007; 17(4): 461 - 469. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Gotter, M. A. Nimmakayalu, G. R. Jalali, A. M. Hacker, J. Vorstman, D. Conforto Duffy, L. Medne, and B. S. Emanuel A palindrome-driven complex rearrangement of 22q11.2 and 8q24.1 elucidated using novel technologies Genome Res., April 1, 2007; 17(4): 470 - 481. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kogo, H. Inagaki, T. Ohye, T. Kato, B. S. Emanuel, and H. Kurahashi Cruciform extrusion propensity of human translocation-mediating palindromic AT-rich repeats Nucleic Acids Res., February 28, 2007; 35(4): 1198 - 1208. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kato, H. Inagaki, K. Yamada, H. Kogo, T. Ohye, H. Kowa, K. Nagaoka, M. Taniguchi, B. S. Emanuel, and H. Kurahashi Genetic variation affects de novo translocation frequency. Science, February 17, 2006; 311(5763): 971 - 971. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Bacolla, A. Jaworski, J. E. Larson, J. P. Jakupciak, N. Chuzhanova, S. S. Abeysinghe, C. D. O'Connell, D. N. Cooper, and R. D. Wells Breakpoints of gross deletions coincide with non-B DNA conformations PNAS, September 28, 2004; 101(39): 14162 - 14167. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kurahashi, H. Inagaki, K. Yamada, T. Ohye, M. Taniguchi, B. S. Emanuel, and T. Toda Cruciform DNA Structure Underlies the Etiology for Palindrome-mediated Human Chromosomal Translocations J. Biol. Chem., August 20, 2004; 279(34): 35377 - 35383. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Shaw and J. R. Lupski Implications of human genome architecture for rearrangement-based disorders: the genomic basis of disease Hum. Mol. Genet., April 1, 2004; 13(90001): R57 - 64. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Gotter, T. H. Shaikh, M. L. Budarf, C. H. Rhodes, and B. S. Emanuel A palindrome-mediated mechanism distinguishes translocations involving LCR-B of chromosome 22q11.2 Hum. Mol. Genet., January 1, 2004; 13(1): 103 - 115. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||










