Skip Navigation


Human Molecular Genetics Advance Access originally published online on September 23, 2003
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
12/22/2923    most recent
ddg318v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (52)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Memisoglu, A.
Right arrow Articles by Hunter, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Memisoglu, A.
Right arrow Articles by Hunter, D. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2003, Vol. 12, No. 22 2923-2929
DOI: 10.1093/hmg/ddg318
© 2003 Oxford University Press

Interaction between a peroxisome proliferator-activated receptor {gamma} gene polymorphism and dietary fat intake in relation to body mass

Asli Memisoglu1,*, Frank B. Hu2, Susan E. Hankinson1,3, JoAnn E. Manson1,3,4, Immaculata De Vivo1,3,5, Walter C. Willett1,2,3 and David J. Hunter1,2,3,4

1Department of Epidemiology, Harvard School of Public Health, Boston, MA, USA, 2Department of Nutrition, Harvard School of Public Health, Boston, MA, USA, 3Channing Laboratory, Department of Medicine, Harvard Medical School and Brigham and Women's Hospital, Boston, MA, USA, 4Division of Preventive Medicine, Department of Medicine, Harvard Medical School and Brigham and Women's Hospital, Boston, MA, USA and 5Harvard Center for Cancer Prevention, Boston, MA, USA

Received June 23, 2003; Revised August 22, 2003; Accepted September 10, 2003


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) is a critical regulator of adipogenesis. PPAR{gamma}+/- mice are resistant to high-fat diet-induced obesity and thus PPAR{gamma} may mediate physiological responses to dietary fat in other mammals. The aim of this study was to determine whether the human PPAR{gamma} proline to alanine substitution polymorphism (Pro12Ala) modifies the association between dietary fat and adiposity and plasma lipids. Subjects (n=2141) were controls selected for three case–control studies nested within the Nurses' Health Study, a large ongoing prospective cohort study. Associations between intake of total fat, fat subtypes and BMI were different in PPAR{gamma} 12Ala variant allele-carriers compared with non-carriers. Among homozygous wild-type Pro/Pro individuals, those in the highest quintile of total fat intake, had significantly higher mean body mass index (BMI) compared with those in the lowest quintile (27.3 versus 25.4 kg/m2, respectively; P-trend<0.0001) whereas among 12Ala variant allele-carriers there was no significant trend observed between dietary fat intake and BMI (P-trend=0.99; P-interaction=0.003). In contrast, intake of monounsaturated fat was not associated with BMI among homozygous wild-type women but was inversely associated with BMI among 12Ala variant allele-carriers (mean in lowest quintile=27.6 versus mean in highest quintile=25.5 kg/m2; P-trend=0.006; P-interaction=0.003). The relationship between dietary fat intake and plasma lipid concentrations also differed according to PPAR{gamma} genotype. These data suggest that PPAR{gamma} genotype is an important factor in physiological responses to dietary fat in humans.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Over the last two decades the prevalence of overweight and obesity has increased markedly in the USA and many parts of the world (1). Obesity increases the risk of numerous chronic health conditions including type 2 diabetes, coronary heart disease, hypertension and some cancers (2). Although the recent secular increases in obesity are almost certainly caused by dietary and lifestyle factors, genetic factors likely influence which individuals gain weight under specific environmental conditions. Studies on human pedigrees estimate the genetic influence on body mass to be between 30 and 40%, suggesting a substantial genetic contribution to obesity (3,4). In addition to the independent effects of genetics and diet on body weight, animal studies also support a role for interactions between genes and diet on obesity risk. Strains of rodents have been identified that are differentially sensitive to obesity induced by a high-fat diet (5). Sensitivity to dietary fat-induced obesity appears to be a polygenic phenotype and is influenced by genes mapped to at least six genetic loci in rodents (5). In humans there is much debate on the role of dietary fat in weight gain and obesity, but little empirical evidence to support specific common genotypes in gene–diet interactions (68).

PPAR{gamma} is a member of the steroid hormone receptor superfamily and is a critical transcriptional regulator of adipogenesis. PPAR{gamma} is the target of the thiazolidinedione class of antidiabetic drugs that improve insulin sensitivity. In vivo ligands for PPAR{gamma} are thought to include a variety of unsaturated fatty acids and it has been proposed that PPAR{gamma} may be a mediator of physiological responses to lipids (9,10). A reduced-activity variant protein is produced by the proline to alanine substitution in codon 12 of PPAR{gamma} (Pro12Ala) and the variant 12Ala allele is associated with reduced risk of type 2 diabetes (1113). Although many lines of research indicate that PPAR{gamma} has a central role in adipogenesis, direct associations between the Pro12Ala PPAR{gamma} polymorphism and body mass index (BMI) have been inconsistent in human studies (13).

PPAR{gamma} null mice generally do not survive due to a placental dysfunction. However, a PPAR{gamma} knockout mouse that survived past birth had a remarkable absence of both brown and white adipose tissue. Animal studies on PPAR{gamma} heterozygous null mice demonstrate that mice lacking one copy of the PPAR{gamma} gene are similar to their wild-type littermates under standard dietary conditions while those given a high-fat diet gain significantly less weight than their corresponding wildtype controls (14). Similarly, reduction in PPAR{gamma} activity with PPAR{gamma}-specific antagonist treatment confers resistance to high-fat diet-induced weight gain in mice (15). Here we analyzed in humans whether the PPAR{gamma} Pro12Ala polymorphism interacts with dietary factors and BMI, plasma high-density lipoprotein (HDL) and plasma total cholesterol in humans. Our study population consisted of a subsample of the Nurses' Health Study, a large ongoing prospective cohort study.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Dietary information obtained from 2141 study women in 1980, 1984, 1986 and 1990 was used to calculate an average of dietary fat intake for each individual and this was examined in relation to BMI reported in 1992. Among 2141 study women there were 1637 Pro/Pro, 469 Pro/Ala and 35 Ala/Ala individuals at the PPAR{gamma} Pro12Ala position and genotype frequencies were in Hardy–Weinberg equilibrium (P>0.99). Pro/Pro homozygous women and women carrying the 12Ala allele (Ala/Ala and Pro/Ala genotypes) were similar with regard to BMI, weight gain since age 18, alcohol intake, smoking habits, menopause status and PMH use and level of physical activity (Table 1). Among the 2141 participants, the 10th and 90th percentiles of energy derived from fat were 28.2 and 40.8% for total fat; 9.8 and 15.2% for saturated fat; 10.5 and 15.9% for monounsaturated fat; 4.7 and 7.6% for polyunsaturated fat; and 1.2 and 2.5% for trans unsaturated fat, respectively. The 10th and 90th percentiles for the ratio of polyunsaturated to saturated (P : S) fat were 1.9 and 3.4, respectively. Intake of total fat, intake of each fat subtype and the P : S ratio were found to be similar in Pro12Ala variant allele-carriers and Pro/Pro homozygotes (data not shown).


View this table:
[in this window]
[in a new window]
 
Table 1. Descriptive characteristics of study population according to PPAR{gamma} genotype
 
The association between PPAR{gamma} Pro12Ala genotype and BMI according to dietary fat intake was investigated. Within the lowest quintile of total fat intake, the BMI of PPAR{gamma}12Ala variant allele carriers was higher than BMI of non-carriers (26.7 versus 25.4 kg/m2 for variant allele carriers and non-carrier, respectively, P=0.005). Moreover, a positive trend between increasing intake of total fat and BMI was observed in Pro/Pro homozygotes but not in PPAR{gamma} 12Ala variant-allele carriers (P-trend <0.0001 and 0.99 for Pro/Pro homozygotes and 12Ala allele-carriers, respectively; P-interaction 0.003). Intake of saturated fat was directly associated with increased BMI among individuals of both genotype classes (Table 2), whereas intake of monounsaturated fat was inversely associated with BMI in Ala12 allele-carriers but not in Pro/Pro homozygotes (Table 2; P-interaction 0.003; P-trend 0.28 and 0.006 for Pro/Pro homozygotes and 12Ala allele-carriers, respectively). P : S ratio was directly associated with lower BMI among Pro/Pro but not among PPAR{gamma} 12Ala allele-carriers (Table 2; P-trend 0.002 and 0.24 for Pro/Pro homozygotes and 12Ala allele-carriers, respectively). No trend for intake of polyunsaturated fat and current BMI was observed for either genotype (Table 2; P-trend 0.21 and 0.33 for Pro/Pro homozygotes and 12Ala allele-carriers, respectively). When control subjects from each case–control study were analyzed independently, the trends were almost identical to the combined trends, but the interactions did not reach statistical significance due to the smaller sample sizes (data not shown).


View this table:
[in this window]
[in a new window]
 
Table 2. Adjusted associations of PPAR{gamma} genotype and BMI by quintile of dietary fata
 
PPAR{gamma} Pro12Ala genotype modified the association between total dietary fat intake and risk of obesity (BMI of >=30 kg/m2). Among Pro/Pro homozygotes, the highest quintile of total dietary fat was associated with increased risk of obesity compared to the lowest quintile of total dietary fat intake (Fig. 1; OR=3.4; 95% confidence interval, 2.1–5.4; <0.0001). In contrast, among variant allele-carriers no trend between total dietary fat intake and obesity was observed (Fig. 1; P-trend=0.85; P-interaction=0.006).



View larger version (27K):
[in this window]
[in a new window]
 
Figure 1. Risk of obesity associated with total dietary fat and PPAR{gamma} Pro12Ala genotype. Estimates of obesity risk by intake of total fat for 12Ala variant allele-carriers (hatched bars) and non-carriers (shaded bars) were derived from multivariate logistic regression models including the following covariates: age (5-year categories), total energy intake (quintiles), energy derived from protein (quintiles), cigarette smoking (never, past and current smoking of 1–14, 15–24 and 25 or more cigarettes per day), menopausal status and post-menopausal hormone (PMH) therapy (premenopausal, postmenopausal without PMH use, postmenopausal current PMH user and postmenopausal past PMH user), physical activity (<1.5, 1.5–5.9, 6.0–11.9, 12–20.9 and >=21 metabolic units/week), alcohol consumption (non-drinker, <5, 5–10 and >10 g/day). Obesity was defined as having a BMI>=30 kg/m2 and compared with individuals who were neither overweight nor obese (BMI<25 kg/m2). P-trend among variant allele-carriers=0.85. P-trend among non-carriers <0.0001. P-interaction=0.006.

 
We also examined the interaction between PPAR{gamma} Pro12Ala polymorphism and intake of total dietary fat in relation to plasma lipids. Plasma HDL and total plasma cholesterol were assayed for individuals from the breast cancer case–control study (n=656). Among Pro/Pro homozygotes, intake of total fat was inversely correlated with plasma HDL (58.3 versus 61.8 mg/dl for highest quintile compared to lowest quintile, respectively; P-trend=0.11) and inversely correlated with plasma cholesterol (213 versus 230 mg/dl for highest quintile compared to lowest quintile, respectively; P-trend=0.02; Table 3). In contrast intake of total fat was directly correlated with plasma HDL among 12Ala variant allele-carriers (64.8 versus 58.1 mg/dl for highest quintile compared with lowest quintile, respectively; P-trend=0.0008; P-interaction=0.01; Table 3). The trend between intake of total fat and plasma cholesterol among 12Ala variant allele-carriers was not statistically different from zero but was significantly different from the inverse trend observed in Pro/Pro homozygotes (P-interaction=0.05). The multivariate estimates and interactions did not change appreciably when BMI was included in the model, suggesting that the association between PPAR{gamma} Pro12Ala polymorphism and plasma lipids is not mediated solely through effects on body mass (Table 3).


View this table:
[in this window]
[in a new window]
 
Table 3. Adjusted association of PPAR{gamma} genotype and serum lipids by quintile of total dietary fat
 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Consistent with numerous prior reports we observed no direct association between PPAR{gamma} Pro12Ala genotype and BMI in the Nurses' Health Study (13). However, we did observe that the relationship between total dietary fat with BMI differed according to PPAR{gamma} genotype with the relationships being attenuated in carriers of the reduced-activity 12Ala allele. This is consistent with mouse models in which reducing PPAR{gamma} activity, either genetically or pharmacologically, results in animals with resistance to diet-induced obesity (1416). This resistance is specific to high-fat diet-induced obesity and is not observed with high-carbohydrate diet-induced obesity (14). Fatty acids, particularly unsaturated fatty acids, are ligands for PPAR{gamma} (10). Thus the relation of fatty acid intake to obesity may depend on PPAR{gamma} transcriptional response.

In humans, four studies in addition to our own have investigated the interaction between PPAR{gamma} Pro12Ala polymorphism and diet with respect to body weight and weight change. Luan et al. (17) reported an inverse association between P : S ratio with BMI and plasma insulin among 12Ala allele-carriers but not among Pro/Pro homozygotes whereas they observed no interaction between PPAR{gamma} Pro12Ala genotype with total dietary fat intake in relation to BMI. More recently, Robitaille et al. (18) reported observations similar to our own in a French Canadian population; total dietary fat intake was positively associated with BMI among homozygous wild-type Pro/Pro individuals but not among 12Ala variant allele carriers. The current study and that described by Robitaille et al. (18) did not confirm the interaction between PPAR{gamma} Pro12Ala genotype and P : S ratio on BMI reported by Luan et al. (17). The discrepancy between these studies may reflect the difficulty of accurate assessment of intake of specific types of dietary fat rather than a discrepancy in biological relevance.

A third study was a 3-year longitudinal trial of individuals with impaired glucose tolerance randomized to an exercise and diet group, which included dietary advice aimed at lowering intake of total fat, versus a control group. Although the sample size was small, individuals with the Ala/Ala genotype (n=6) on the intervention arm lost more weight than Pro/Pro and Pro/Ala individuals (19). In a fourth study the weight loss and physiological changes resulting from a hypoenergetic diet were assessed. Although weight lost in variant allele-carriers was similar to that in Pro/Pro non-carriers, 12Ala variant allele carriers had more carbohydrate oxidation, less fat oxidation and a greater increase in insulin sensitivity compared with Pro/Pro wild-type individuals, consistent with metabolic differences in response to diet among individuals with different genotypes (20).

Kubota et al. (14) first reported resistance to dietary fat-induced obesity and insulin resistance in PPAR{gamma}-deficient (PPAR{gamma}+/-) mice. Their results suggest that PPAR{gamma}+/- mice are resistant to dietary-fat induced obesity due to both decreased food intake and increased energy expenditure. Although PPAR{gamma}+/- mice given a high-fat diet had lower fat mass than wild-type mice, they had higher levels of leptin, the appetite-suppressing hormone produced by adipocytes. The leptin promoter has a functional peroxisome proliferator response element, indicating that the transcription factor PPAR{gamma} has a direct role in modulating leptin expression (21). Higher leptin levels have also been reported in humans carrying the reduced-activity 12Ala allele of PPAR{gamma}, suggesting that modulation of leptin levels is an important biological function of PPAR{gamma} and may mediate the relation of dietary fat intake, PPAR{gamma} polymorphism and BMI (22,23).

Here we observed that PPAR{gamma} interacts with dietary fat to determine BMI. It is important to note that interpretation of cross-sectional analysis of diet and body mass are controversial in part because individuals who reduce their fat intake may also reduce energy intake, may be more physically active or may be consciously attempting to reduce their weight. It is unlikely, however, that any of the above confounding factors would be related to PPAR{gamma} genotype. The marked similarity between the current observations and those observed by Robitaille et al. (18) and the relation we observe to plasma lipids supports the hypothesis that PPAR{gamma} genotype modulates physiological responses to dietary fat, specifically. Our study is substantially larger than the previous report of this association, involving subjects from across the USA, and is the first to report an interaction between PPAR{gamma} genotype, intake of monounsaturated fat and BMI. This observation is important because it reinforces the biological plausibility of the interaction; biochemical studies have demonstrated that unsaturated fats are specific ligands for PPAR{gamma} (10). Furthermore, to our knowledge this is the first report of a statistically significant interaction between intake of dietary fats, PPAR{gamma} genotype, and plasma lipids. This observation suggests that dietary counseling aimed at optimizing plasma total and HDL-cholesterol levels may need to take into account PPAR{gamma} genotype. Thus, uniform dietary recommendations may not be appropriate for all individuals. Given the increasing incidence of obesity, identification of individuals who are genetically more likely to respond to particular dietary changes may be important for successful intervention.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Study population
The Nurses' Health Study began in 1976 with the recruitment of 121 700 married, female, registered nurses between the ages of 30 and 55 from 11 US states. The participants have been followed with biennial questionnaires updating exposure and disease status. Between 1989 and 1990, blood samples were collected from 32 826 volunteers from the original study. Samples for three case–control studies nested within the Nurses' Health Study blood cohort were selected to identify genetic and plasma biomarkers of breast cancer, type 2 diabetes and endometrial cancer. The breast cancer case–control study consists of 725 incident cases diagnosed after blood collection through 1996 and controls matched 1 : 1 with cases for the following variables: age, menopause status, postmenopausal hormone use, blood draw time of day, month of blood return and fasting status at blood draw. An additional control was matched for each postmenopausal breast cancer case not taking postmenopausal hormones, resulting in a total of 953 controls in this study. The diabetes case–control study consists of 387 incident cases of diabetes diagnosed after blood collection through 1996 and 774 controls matched to cases for the following variables: age, month of blood draw, year of blood draw and fasting status at blood draw. For each case one of the two controls was also matched according to body mass index (±1 unit). The endometrial case–control study consists of 222 cases and 666 controls matched 1 : 3 with cases for the following variables: age, menopause status, postmenopausal hormone use, blood draw time of day, month of blood return and fasting status at blood draw. Control subjects from these three nested case-control studies with PPAR{gamma} Pro12Ala genotype and dietary information were included in the present study of 2141 women.

Exposures and endpoints
All subjects were genotyped for the codon 12 proline to alanine polymorphism in the PPAR{gamma} gene (11). DNA of breast cancer case–control study subjects was genotyped by a mutagenic polymerase chain reaction (PCR)/restriction fragment length polymorphism (RFLP) method as described (11). PCR amplification using a perfect match upstream primer (5'TTGACTCATGGGTGTATT3') and a downstream mismatched primer [5'GATATGTTTGCAGACAGTG-TATCAGTGAAGGAATCGCTTTCCG3' (mismatched base is bold and underlined)] was used to create a BstUI restriction site in the PCR product only when the variant Ala allele is present. DNA of diabetes case–control study subjects was genotyped by Pyrosequencing (Pyrosequencing, Uppsala, Sweden) using the following primers: PCR primers, 5'BIOTIN-TTCACAAATT-CTGTTACTTCA3' and 5'TTGTGATATGTTTGCAGACA3'; sequencing primer, 5'ATCAGTGAAGGAATCGCTTTCT3'. DNA of endometrial case–control study subjects was genotyped by Taqman technology (Applied Biosystems, Foster City, CA, USA) using the PCR primers 5'TGCAGACAGTGTATCA-GTGAAGGA3' and 5'TTATGGGTGAAACTCTGGGAG-ATT3' and probe primers 5'TTCTG(G/C)GTCAATAGG3'. Genotype frequencies determined by RFLP, pyrosequencing and Taqman were not materially different (data not shown).

Plasma total cholesterol and HDL were determined as previously described (2426). Within-individual coefficients of variation among redundant samples were 3.2 and 5.0% for total cholesterol and HDL, respectively.

A semiquantitative food-frequency questionnaire was administered to all participants of the Nurses' Health Study in 1980, 1984, 1986 and 1990. Nutrient intake was computed from the reported consumption frequency and the known nutrient content for a particular food. Reproducibility and validity of this method has been described elsewhere (27). Correlation between values obtained from these food-frequency questionnaires and weekly dietary records ranged between 0.46 and 0.68 for dietary fat. Further, the correlation between dietary polyunsaturated fat intake estimated by food-frequency questionnaire and intake estimated from sampling subcutaneous fat was 0.50 (28). Nutrient density for total fat, saturated fat, monounsaturated fat, polyunsaturated fat and trans unsaturated fat was calculated as energy derived from dietary fat divided by total dietary energy. Using information from four questionnaires, average nutrient density was used as a cumulative measure of nutrient intake. For subjects missing one or more of the administered food-frequency questionnaires, average nutrient density was computed from the available data. BMI was calculated as weight in kilograms (obtained in 1992) divided by height in meters (obtained in 1976) squared. Validation of self-reported anthropometric measures has been previously addressed in a subset of individuals. Self-reports of weight and height were highly correlated with measurements and reports from other sources (correlation coefficients of 0.96 and 0.94 for weight and height, respectively) (29,30).

Statistical analysis
All statistical analyses were performed using the Statistical Analysis Software package (SAS Institute Inc., Cary, NC, USA). Associations of energy derived from fat and PPAR{gamma} genotype with BMI, HDL and total plasma cholesterol were evaluated using linear regression models adjusting for total calorie intake (quintiles of cumulative average), energy derived from protein (quintiles of cumulative average), age (5-year categories), smoking at blood draw (1–14, 15–24 and >=25 cigarettes/day, never smoker and past smoker), menopause status and post-menopausal hormone (PMH) therapy at blood draw (pre-menopausal, post-menopausal no PMH use, post-menopausal current PMH user, post-menopausal past PMH user), physical activity at blood draw (<1.5, 1.5–5.9, 6.0–11.9, 12.0–20.9 and >=21 metabolic units/week) and alcohol consumption at blood draw (non-drinker, 0–4.9, 5–10 and >10 g alcohol/day). To minimize the influence of potential outlying values and to allow for non-linear associations dietary fat intake was treated as categorical (quintiles). Nearly identical associations were observed when dietary fat intake was treated as continuous (data not shown). The association between energy derived from fat and PPAR{gamma} genotype with obesity was evaluated using unconditional logistic regression adjusting for the same covariates listed above. Obese individuals, defined as having a BMI of >=30 kg/m2, were compared to individuals who were normal weight or underweight, defined as having a BMI<25. Estimates for continuous outcomes were derived for each of five strata of dietary fat intake (quintiles), stratified by PPAR{gamma} genotype, from multivariate linear regression models. The interaction between PPAR{gamma} genotype and dietary fat was assessed using a cross-product term between genotype and quintiles of dietary fat (treated as an ordinal variable); statistical significance was calculated using a Wald test for the interaction.


    ACKNOWLEDGEMENTS
 
Supported by National Institutes of Health Grants CA49449, CA65725, DK058845 and CA082838. A.M. was supported by a postdoctoral training grant from the National Cancer Institute (CA09001).


    FOOTNOTES
 
* To whom correspondence should be addressed at: Harvard School of Public Health, 677 Huntington Avenue, Bldg II Rm 105, Boston, MA 02115, USA. Fax: +1 6174321722; Email: amemisog{at}hsph.harvard.edu Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Flegal, K.M., Carroll, M.D., Ogden, C.L. and Johnson, C.L. (2002) Prevalence and trends in obesity among US adults, 1999–2000. JAMA, 288, 1723–1727.[Abstract/Free Full Text]

  2. Must, A., Spadano, J., Coakley, E.H., Field, A.E., Colditz, G. and Dietz, W.H. (1999) The disease burden associated with overweight and obesity. JAMA, 282, 1523–1529.[Abstract/Free Full Text]

  3. Hunt, M.S., Katzmarzyk, P.T., Perusse, L., Rice, T., Rao, D.C. and Bouchard, C. (2002) Familial resemblance of 7-year changes in body mass and adiposity. Obes. Res., 10, 507–517.[Web of Science][Medline]

  4. Coady, S.A., Jaquish, C.E., Fabsitz, R.R., Larson, M.G., Cupples, L.A. and Myers, R.H. (2002) Genetic variability of adult body mass index: a longitudinal assessment in Framingham families. Obes. Res., 10, 675–681.[Web of Science][Medline]

  5. West, D.B. and York, B. (1998) Dietary fat, genetic predisposition, and obesity: lessons from animal models. Am. J. of Clin. Nutr., 67 (suppl.), 505S–512S.[Abstract]

  6. Astrup, A. (2002) Dietary fat is a major player in obesity—but not the only one. Obes. Rev., 3, 57–58.[CrossRef][Medline]

  7. Willett, W.C. (2002) Dietary fat plays a major role in obesity: no. Obes. Rev., 3, 59–68.[CrossRef][Medline]

  8. Bray, G.A. and Popkin, B.M. (1998) Dietary fat intake does affect obesity! Am. J. Clin. Nutr., 68, 1157–1173.[Abstract]

  9. Krey, G., Braissant, O., L'Horset, F., Kalkhoven, E., Perroud, M., Parker, M.G. and Wahli, W. (1997) Fatty acids, eicosanoids, and hypolipidemic agents identified as ligands of peroxisome proliferator-activated receptors by coactivator-dependent receptor ligand assay. Mol. Endocrinol., 11, 779–791.[Abstract/Free Full Text]

  10. Xu, H.E., Lambert, M.H., Montana, V.G., Parks, D.J., Blanchard, S.G., Brown, P.J., Sternbach, D.D., Lehmann, J.M., Wisely, G.B., Willson, T.M. et al. (1999) Molecular recognition of fatty acids by peroxisome proliferator-activated receptors. Mol. Cell, 3, 397–403.[CrossRef][Web of Science][Medline]

  11. Yen, C.J., Beamer, B.A., Negri, C., Silver, K., Brown, K.A., Yarnall, D.P., Burns, D.K., Roth, J. and Shuldiner, A.R. (1997) Molecular scanning of the human peroxisome proliferator activated receptor {gamma} (hPPAR{gamma}) gene in diabetic Caucasians: identification of a Pro12Ala PPAR{gamma}2 missense mutation. Biochem. Biophys. Res. Commun., 241, 270–274.[CrossRef][Web of Science][Medline]

  12. Deeb, S.S., Fajas, L., Nemoto, M., PihlaJAMAki, J., Mykkanen, L., Kuusisto, J., Laakso, M., Fujimoto, W. and Auwerx, J. (1998) A Pro12Ala substitution in PPAR{gamma}2 associated with decreased receptor activity, lower body mass index and improved insulin sensitivity. Nat. Genet., 20, 284–287.[CrossRef][Web of Science][Medline]

  13. Stumvoll, M. and Haring, H. (2002) The peroxisome proliferator-activated receptor-{gamma}2 Pro12Ala polymorphism. Diabetes, 51, 2341–2347.[Abstract/Free Full Text]

  14. Kubota, N., Terauchi, Y., Miki, H., Tamemoto, H., Yamauchi, T., Komeda, K., Satoh, S., Nakano, R., Ishii, C., Sugiyama, T. et al. (1999) PPAR{gamma} mediates high-fat diet-induced adipocyte hypertrophy and insulin resistance. Mol. Cell, 4, 597–609.[CrossRef][Web of Science][Medline]

  15. Yamauchi, T., Waki, H., Kamon, J., Murakami, K., Motojima, K., Komeda, K., Miki, H., Kubota, N., Terauchi, Y., Tsuchida, A. et al. (2001) Inhibition of RXR and PPAR{gamma} ameliorates diet-induced obesity and type 2 diabetes. J. Clin. Invest., 108, 1001–1013.[CrossRef][Web of Science][Medline]

  16. Yamauchi, T., Kamon, J., Waki, H., Murakami, K., Motojima, K., Komeda, K., Ide, T., Kubota, N., Terauchi, Y., Tobe, K. et al. (2001) The mechanisms by which both heterozygous peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) deficiency and PPAR{gamma} agonist improve insulin resistance. J. Biol. Chem., 276, 41245–41254.[Abstract/Free Full Text]

  17. Luan, J., Browne, P.O., Harding, A.H., Halsall, D.J., O'Rahilly, S., Chatterjee, V.K. and Wareham, N.J. (2001) Evidence for gene–nutrient interaction at the PPAR{gamma} locus. Diabetes, 50, 686–689.[Abstract/Free Full Text]

  18. Robitaille, J., Despres, J.P., Perusse, L. and Vohl, M.C. (2003) The PPAR-{gamma} P12A polymorphism modulates the relationship between dietary fat intake and components of the metabolic syndrome: results from the Quebec Family Study. Clin. Genet., 63, 109–116.[CrossRef][Web of Science][Medline]

  19. Lindi, V.I., Uusitupa, M.I., Lindstrom, J., Louheranta, A., Eriksson, J.G., Valle, T.T., Hamalainen, H., Ilanne-Parikka, P., Keinanen-Kiukaanniemi, S., Laakso, M. et al. (2002) Association of the Pro12Ala polymorphism in the PPAR-{gamma}2 gene with 3-year incidence of type 2 diabetes and body weight change in the Finnish Diabetes Prevention Study. Diabetes, 51, 2581–2586.[Abstract/Free Full Text]

  20. Nicklas, B.J., van Rossum, E.F., Berman, D.M., Ryan, A.S., Dennis, K.E. and Shuldiner, A.R. (2001) Genetic variation in the peroxisome proliferator-activated receptor-{gamma}2 gene (Pro12Ala) affects metabolic responses to weight loss and subsequent weight regain. Diabetes, 50, 2172–2176.[Abstract/Free Full Text]

  21. Hollenberg, A.N., Susulic, V.S., Madura, J.P., Zhang, B., Moller, D.E., Tontonoz, P., Sarraf, P., Spiegelman, B.M. and Lowell, B.B. (1997) Functional antagonism between CCAAT/Enhancer binding protein-alpha and peroxisome proliferator-activated receptor-{gamma} on the leptin promoter. J. Biol. Chem., 272, 5283–5290.[Abstract/Free Full Text]

  22. Cole, S.A., Mitchell, B.D., Hsueh, W.C., Pineda, P., Beamer, B.A., Shuldiner, A.R., Comuzzie, A.G., Blangero, J. and Hixson, J.E. (2000) The Pro12Ala variant of peroxisome proliferator-activated receptor-{gamma}2 (PPAR-{gamma}2) is associated with measures of obesity in Mexican Americans. Int. J. Obes. Relat. Metab. Disord., 24, 522–524.[CrossRef][Web of Science][Medline]

  23. Simon, I., Vendrell, J., Gutierrez, C., Fernandez-Real, J.M., Vendrell, I., Gallart, L., Fontova, R. and Richart, C. (2002) Pro12Ala substitution in the peroxisome proliferator-activated receptor-{gamma} is associated with increased leptin levels in women with type-2 diabetes mellitus. Horm. Res., 58, 143–149.[CrossRef][Web of Science][Medline]

  24. Allain, C.C., Poon, L.S., Chan, C.S., Richmond, W. and Fu, P.C. (1974) Enzymatic determination of total serum cholesterol. Clin. Chem., 20, 470–475.[Abstract]

  25. Warnick, G.R., Nguyen, T. and Albers, A.A. (1985) Comparison of improved precipitation methods for quantification of high-density lipoprotein cholesterol. Clin. Chem., 31, 217–222.[Abstract/Free Full Text]

  26. Demacker, P.N., Vos-Janssen, H.E., Hijmans, A.G., van't Laar, A. and Jansen, A.P. (1980) Measurement of high-density lipoprotein cholesterol in serum: comparison of six isolation methods combined with enzymic cholesterol analysis. Clin. Chem., 26, 1780–1786.[Free Full Text]

  27. Willett, W.C. (1998) Nutritional Epidemiology, 2nd edn. Oxford University Press, Oxford.

  28. Garland, M., Sacks, F.M., Colditz, G.A., Rimm, E.B., Sampson, L.A., Willett, W.C. and Hunter, D.J. (1998) The relation between dietary intake and adipose tissue composition of selected fatty acids in US women. Am. J. Clin. Nutr., 67, 25–30.[Abstract]

  29. Willett, W.C., Manson, J.E., Stampfer, M.J., Colditz, G.A., Rosner, B., Speizer, F.E. and Hennekens, C.H. (1995) Weight, weight change, and coronary heart disease in women. Risk within the ‘normal’ weight range. JAMA, 273, 461–465.[Abstract/Free Full Text]

  30. Troy, L.M., Hunter, D.J., Manson, J.E., Colditz, G.A., Stampfer, M.J. and Willett, W.C. (1995) The validity of recalled weight among younger women. Int. J. Obes. Relat. Metab. Disord., 19, 570–572.[Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
DiabetesHome page
D. O. Mook-Kanamori, E. A.P. Steegers, A. G. Uitterlinden, H. A. Moll, C. M. van Duijn, A. Hofman, and V. W.V. Jaddoe
Breast-Feeding Modifies the Association of PPAR{gamma}2 Polymorphism Pro12Ala With Growth in Early Life: The Generation R Study
Diabetes, April 1, 2009; 58(4): 992 - 998.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
J. E Cecil, C. N. Palmer, B. Fischer, P. Watt, D. J Wallis, I. Murrie, and M. M Hetherington
Variants of the peroxisome proliferator-activated receptor {gamma}- and {beta}-adrenergic receptor genes are associated with measures of compensatory eating behaviors in young children
Am. J. Clinical Nutrition, July 1, 2007; 86(1): 167 - 173.
[Abstract] [Full Text] [PDF]


Home page
Diabetes CareHome page
O. Vaccaro, E. Lapice, A. Monticelli, M. Giacchetti, I. Castaldo, R. Galasso, M. Pinelli, G. Donnarumma, A. A. Rivellese, S. Cocozza, et al.
Pro12Ala Polymorphism of the PPAR{gamma}2 Locus Modulates the Relationship Between Energy Intake and Body Weight in Type 2 Diabetic Patients
Diabetes Care, May 1, 2007; 30(5): 1156 - 1161.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
L. D. Yee, N. Williams, P. Wen, D. C. Young, J. Lester, M. V. Johnson, W. B. Farrar, M. J. Walker, S. P. Povoski, S. Suster, et al.
Pilot Study of Rosiglitazone Therapy in Women with Breast Cancer: Effects of Short-term Therapy on Tumor Tissue and Serum Markers
Clin. Cancer Res., January 1, 2007; 13(1): 246 - 252.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
F. Soriguer, S. Morcillo, F. Cardona, G. Rojo-Martinez, M. de la Cruz Almaraz, M. de la Soledad Ruiz de Adana, G. Olveira, F. Tinahones, and I. Esteva
Pro12Ala Polymorphism of the PPARG2 Gene Is Associated with Type 2 Diabetes Mellitus and Peripheral Insulin Sensitivity in a Population with a High Intake of Oleic Acid
J. Nutr., September 1, 2006; 136(9): 2325 - 2330.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
T. Pischon, J. K. Pai, J. E. Manson, F. B. Hu, K. M. Rexrode, D. Hunter, and E. B. Rimm
Peroxisome Proliferator-Activated Receptor-{gamma}2 P12A Polymorphism and Risk of Coronary Heart Disease in US Men and Women
Arterioscler. Thromb. Vasc. Biol., August 1, 2005; 25(8): 1654 - 1658.
[Abstract] [Full Text] [PDF]


Home page
Am J EpidemiolHome page
V. Paracchini, P. Pedotti, and E. Taioli
Genetics of Leptin and Obesity: A HuGE Review
Am. J. Epidemiol., July 15, 2005; 162(2): 101 - 114.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Vanttinen, P. Nuutila, J. Pihlajamaki, K. Hallsten, K. A. Virtanen, R. Lautamaki, P. Peltoniemi, J. Kemppainen, T. Takala, A. P. M. Viljanen, et al.
The Effect of the Ala12 Allele of the Peroxisome Proliferator-Activated Receptor-{gamma}2 Gene on Skeletal Muscle Glucose Uptake Depends on Obesity: A Positron Emission Tomography Study
J. Clin. Endocrinol. Metab., July 1, 2005; 90(7): 4249 - 4254.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
M. A. Murtaugh, K.-n. Ma, B. J. Caan, C. Sweeney, R. Wolff, W. S. Samowitz, J. D. Potter, and M. L. Slattery
Interactions of Peroxisome Proliferator-Activated Receptor {gamma} and Diet in Etiology of Colorectal Cancer
Cancer Epidemiol. Biomarkers Prev., May 1, 2005; 14(5): 1224 - 1229.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
S.-M. Brand-Herrmann, T. Kuznetsova, A. Wiechert, K. Stolarz, V. Tikhonoff, K. Schmidt-Petersen, R. Telgmann, E. Casiglia, J.-G. Wang, L. Thijs, et al.
Alcohol intake modulates the genetic association between HDL cholesterol and the PPAR{gamma}2 Pro12Ala polymorphism
J. Lipid Res., May 1, 2005; 46(5): 913 - 919.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
R. L. Prentice, W. C. Willett, P. Greenwald, D. Alberts, L. Bernstein, N. F. Boyd, T. Byers, S. K. Clinton, G. Fraser, L. Freedman, et al.
Nutrition and Physical Activity and Chronic Disease Prevention: Research Strategies and Recommendations
J Natl Cancer Inst, September 1, 2004; 96(17): 1276 - 1287.
[Abstract] [Full Text] [PDF]


Home page
ANN INTERN MEDHome page
W. C. Willett
Reduced-Carbohydrate Diets: No Roll in Weight Management?
Ann Intern Med, May 18, 2004; 140(10): 836 - 837.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
12/22/2923    most recent
ddg318v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (52)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Memisoglu, A.
Right arrow Articles by Hunter, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Memisoglu, A.
Right arrow Articles by Hunter, D. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?