Human Molecular Genetics Advance Access originally published online on September 30, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Human Molecular Genetics, 2003, Vol. 12, No. 22 2957-2965
DOI: 10.1093/hmg/ddg328
© 2003 Oxford University Press
RING finger 1 mutations in Parkin produce altered localization of the protein


1Laboratory of Neurogenetics, National Institute on Aging, 9000 Rockville Pike, Bethesda, MD 20892, USA, 2Department of Neuroscience, Mayo Clinic Jacksonville, 4500 San Pablo Road, Jacksonville, FL 32224, USA and 3Center for Neurologic Diseases, Brigham and Women's Hospital, Harvard Institutes of Medicine, 77 Avenue Louis Pasteur, Boston, MA 02115, USA
Received July 11, 2003; Revised August 27, 2003; Accepted September 18, 2003
| ABSTRACT |
|---|
|
|
|---|
The Parkin gene (PRKN) encodes an E3 proteinubiquitin ligase for which loss of function is associated with autosomal-recessive juvenile (<20 years) and early-onset Parkinsonism (<45 years). Although detailed pathological reports are scarce, brains from patients with homozygous exonic deletions demonstrate neuronal loss in the substantia nigra, albeit without the Lewy body pathology characteristic of idiopathic Parkinson's disease. However, there are rare descriptions of more florid pathology, including Lewy bodies and tau positive astrocytes in individuals with compound heterozygous mutations. In the present study we examined whether PRKN point mutations, leading to amino acid substitutions, may alter the cellular distribution of the protein produced. Wild-type Parkin was homogeneously distributed throughout the cytoplasm with a small amount of protein in the nucleus after transfection into human embryonic kidney cells. Mutant isoforms with A82E, G328E and C431F amino acid substitutions were also normally distributed. However, two mutant isoforms, R256C and R275W, within RING finger 1 of the Parkin protein (238293 amino acids), produced an unusual distribution of the protein, with large cytoplasmic and nuclear inclusions. We have replicated this observation in primary cultured neurons and demonstrate, by the accumulation/co-localization of cytoskeletal protein vimentin, that the inclusion bodies are aggresomes, a cellular response to misfolded protein.
| INTRODUCTION |
|---|
|
|
|---|
The discovery of multiple loci associated with familial forms of Parkinsonism gives an important insight into the pathways involved in pathogenesis of Parkinson's disease (PD), and possibly related movement disorders (1). PRKN gene mutations are the predominant cause of juvenile (ARJP) and early-onset recessive Parkinsonism (2). In one study, PRKN gene mutations were found in approximately half of all families with recessive, early onset Parkinsonism, <45 years, and in 77% of apparently sporadic patients with onset before the age of 20 (3).
The range of phenotypes and inheritance patterns associated with PRKN mutations is broad. The majority of patients present with an early onset Parkinsonian syndrome, which has a relatively benign course. However, cases have been reported with many different symptoms. For example, limb onset dystonia is often seen as an early symptom (4,5) whilst other families show predominantly tremor (6). The phenotype may vary within families (7) and may vary dramatically for patients with the same mutation(s) (8). Presently, there are few examples of cases with confirmed PRKN mutations where detailed pathological information is available. Although it is often stated that Parkin cases do not contain Lewy bodies (911), these patients had homozygous deletions leading to complete loss of Parkin function. Patients with homozygous deletion, compound heterozygous deletion and/or point mutations have been documented with tauopathy (10,12,13) and Lewy body inclusions (14). The latter inherited an exon 3 40 bp deletion (Ex3
40) in trans with a 924C->T (R275W) point mutation and developed Parkinsonism at age 41 years. He came to autopsy at 52 years as a result of an automobile accident. Post-mortem exam revealed Lewy body pathology, which was consistent with idiopathic PD, rather than incidental Lewy body disease. The brain had abundant ubiquitin and
-synuclein positive inclusions throughout the substantia nigra, locus ceruleus and basal nucleus of Meynert (14).
The Parkin protein is 465 amino acids long, having a ubiquitin-like sequence at the N-terminus and two RING fingers separated by an in-between RING (IBR) motif towards the C-terminal end of the protein. The domain motif of two RING fingers, named for Really Interesting New Gene (15), separated by an IBR domain is common to several E3 ligases, enzymes that catalyze the conjugation of activated ubiquitin to target proteins prior to their destruction via the proteasome. The E3 ligase activity of Parkin has been demonstrated (16) and several candidate substrates have now been identified in different laboratories (reviewed in 17). The identification of Parkin as an important enzyme in the ubiquitylation cycle strengthens the suggestion that proteasome dysfunction is central to neuronal loss in PD. A simple assumption about the effects of PD-linked mutations in Parkin is that they impair or ablate enzyme function. As Parkin normally protects cells against damage induced by mutant
-synuclein (18) and other agents (19), lack of Parkin activity induced by point mutations is expected to cause neuronal cell loss. However, some mutants including R275W retain ubiquitylation activity (20) and hence the way in which these mutations cause disease is unclear.
There have been several studies examining the distribution of the Parkin protein. Parkin is predominantly cytoplasmic (21), but in one study a specific association with the Golgi was reported (22). Parkin has been localized to both actin-containing (23) and tubulin-containing microfilaments (24). Nuclear staining has also been reported (25), although this is dependent on the antibodies employed and antigen retrieval techniques (26). Parkin can also be associated with synaptic vesicles (27). In the present study we have examined the localization of mutant Parkin compared with wild-type protein and describe the mislocalization of two RING finger 1 mutants, R256C and R275W within aggresomes (28).
| RESULTS |
|---|
|
|
|---|
Transfection of human cell lines with a myc-tagged Parkin construct produced a protein of approximately 50 kDa (Fig. 1), both N- and C-terminal antibodies showing similar results. In these SDS-soluble fractions of whole cell extracts, Parkin was present as a monomeric species with little evidence of aggregated higher-molecular-weight oligomeric species as reported in the insoluble fraction of cells treated with proteasome inhibitors (29). We used a series of point mutations (A82E, R256C, R275W, G328E and C431F) distributed throughout the domain structure of Parkin (see below), all of which were expressed at similar levels in cells. We also used one deletion mutation, Ex3
40, which results in a C-terminally truncated protein (14). The truncated protein could be readily detected using antibodies to the myc tag and N-terminal anti-parkin (Fig. 1).
|
We next determined the distribution of wild-type and mutant forms of Parkin. In preliminary experiments we found that distribution of Parkin was similar whether we used untagged constructs and anti-Parkin antibodies or constructs fused to either HA or myc tags (data not shown). Figure 2 shows results of experiments using myc-tagged constructs, allowing us to determine the distribution of the deletion construct as well as full-length proteins. Similar to previous studies, we found that the majority of wild-type Parkin was homogeneously localized to the cytoplasm. Unlike previous reports, we saw no specific staining in the Golgi (21,22). We noted that a portion of Parkin was present in the nucleus. This was fixation-dependent and was not seen with some types of permeabilization. A similar distribution was noted using polyclonal antibodies to the C-terminus of Parkin or using N-terminally tagged constructs (data not shown). Several mutant Parkin molecules were distributed in the cytoplasm and nucleus in a manner indistinguishable from that of the wild-type protein. These included the point mutations A82E, G328E and C431F as well as Ex3
40 (Fig. 2). However, two point mutations, both located in RING finger 1, showed a different localization, with Parkin inclusions in the cytoplasm and nucleus of the majority of transfected cells. Nuclear inclusions were particularly prominent with the R256C mutation. Parkin-positive inclusions did not strictly overlap with DNA, as evidenced by YOYO-1 staining, suggesting that these do not interact with nuclear material directly.
|
In many cells (Fig. 2I and J) a single, large perinuclear accumulation of mutant Parkin was seen, reminiscent of centriole associated structures termed aggresomes (28,30). To address this possibility, we co-stained cells for Parkin and vimentin, the latter previously reported to be redistributed to the outside of aggresomes (28,31). Figure 3 shows that this phenomenon is also seen with R275W Parkin inclusions in cells, but not with wild-type or C431F Parkin, which do not form aggresome-like structures. Furthermore, perinuclear inclusions contained ubiquitin (Fig. 3JL). Immunoreactivity with monoclonal anti-ubiquitin varied in intensity between cells, and was more prominent after exposure to proteasome inhibitors (data not shown).
|
Other mutant proteins such as expanded huntingtin form aggresomes in cells that are also positive for
-synuclein (31), which is a major component of Lewy bodies (32). We compared the distribution of wild-type and R275W Parkin in primary hippocampal neurons, which express detectable levels of endogenous
-synuclein. Hippocampal neurons were transduced with viral particles engineered to express wild-type or mutant Parkin, and neurons were identified by staining with neuronal markers (18). Myc tagged constructs were used to avoid the contribution of endogenous mouse Parkin to the observed signal. As in transfected cell lines, Parkin was distributed throughout the cytoplasm of neurons and was also present in the nucleus (Fig. 4). Neuritic processes were readily labeled in these experiments. R275W Parkin, however, formed cytoplasmic and nuclear inclusions, similar to results in human cell lines. Mutant Parkin did not fill the neurites of the cells and instead remained localized to a few juxtanuclear areas. These inclusions overlapped with the distribution of endogenous
-synuclein (Fig. 4), although there was no specific recruitment of
-synuclein into aggresomes.
|
We considered whether mislocalization of RING finger 1 mutants might affect localization of the wild type protein. Figure 5 shows cells co-transfected with untagged R275W Parkin and myc-tagged wild-type Parkin. Wild-type Parkin remained normally distributed, outside of the inclusions. There was no additional effect of addition of the proteasome inhibitor MG132 at 5 µM for 6 h (Fig. 5B and D).
|
| DISCUSSION |
|---|
|
|
|---|
The association of PRKN mutations with recessive forms of familial Parkinsonism facilitates analysis of the mechanism(s) leading to neurodegeneration and nigral neuronal loss. The discovery that Parkin was an E3 ubiquitinprotein ligase has renewed interest in the ubiquitinproteasome system as a central pathway perturbed in idiopathic PD (33). It is widely accepted that Parkin cases lack Lewy bodies, and that Parkin expression may be a prerequisite for Lewy body formation (34). However, there are few detailed pathology reports of cases with defined Parkin mutations. Reports of tau pathology in the majority of cases (10,12,13) and Lewy bodies in another (14) suggests there may be a closer relationship between the mechanism of nigral neuronal death in Parkin cases and other causes of PD.
In the current study we have described the distribution of Parkin protein and shown that some point mutations form intracellular inclusions. Notably, two RING finger 1 substitutions, R256C and R275W, produced striking cytoplasmic and nuclear inclusions, which may contribute to the pathogenic mechanism for these specific mutations. These are somewhat reminiscent of the types of inclusions seen with expanded polyglutamine proteins such as ataxin-1 (35), huntingtin (31,36) or androgen receptors (37), all of which produce cytoplasmic and nuclear inclusions when the mutant forms are transfected into cell lines. In these cases, it is thought that misfolding of the expanded polyglutamine protein largely drives its accumulation into aggregated, insoluble intracellular inclusions. The inclusions of mutant huntingtin and androgen receptors have been characterized as aggresomes and our results indicate that RING finger 1 Parkin mutations also form aggresomes. It is likely that the formation of intracellular and intranuclear inclusions by these RING finger 1 Parkin mutations is a function of misfolding of the parent molecule. Whether these observations are limited to mutations in RING finger 1 is not yet clear, but of the mutations we have screened to date these are the only two that form aggresomes. One caveat is that wild-type Parkin can accumulate into aggresomes under conditions where proteasome activity is diminished (29,38). It is also known that Parkin can be degraded by the proteasome (39,40), presumably a result of its autocatalytic ubiquitylation activity (41). Therefore, R275W and R256C promote a function of the wild-type protein that can also be seen at high expression levels of the wild-type protein and is likely to be an intrinsic property of Parkin. We did not see aggresome-like inclusions with wild-type Parkin, perhaps reflecting a relatively more modest level of overexpression and not exposing cells to proteasome inhibitors. However, exposure to MG132 did not noticeably increase the number of inclusions in our hands, suggesting that expression levels may be more important. We also did not see any effect of R275W Parkin on the wild-type distribution, suggesting that these mutations have dominant but not dominant-negative effects.
One of these mutations, R275W, has been shown previously to retain activity towards at least one of its putative substrates, synphilin-1 (20). Therefore, it is likely this mutation does not produce simple loss of function. Our observation of inclusion formation suggests R256C and R275W RING finger 1 mutations produce disease by an alternative mechanism. It has been suggested that Lewy bodies may be related to aggresome formation (42). The fact that a R275W mutation (in trans with an Ex3
40) has been found associated with Lewy body pathology suggests transgenic models over-expressing RING finger 1 Parkin isoforms will provide insight into Parkin function, Lewy body formation and the relationship between ARJP and idiopathic PD.
In summary, we demonstrate that not all Parkin mutations are created equal; Parkin mutations may confer recessive loss-of-function or dominant gain-of-function, depending on the protein domain affected. We show that one way in which RING finger 1 mutations may exert a toxic effect is by altered protein localization/aggregation, within aggresomes. We postulate that these observations help explain Lewy body pathology in some patients with Parkin mutations, including carriers, who may as a consequence be at increased risk of developing idiopathic PD.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cloning of Parkin and mutagenesis
The full-length cDNA of Parkin (GenBank accession number NM004562) was amplified from adult human brain using RTPCR and cloned into pCDNA3.1 mycHis (Invitrogen). The forward primer (5' GCTAGAATTCTACCCAGCCACCATGATAG) included an EcoR1 site and a 2 bp alteration to convert the native translation initiation consensus sequence GTG ACC ATG to an optimal Kozak consensus sequence GCC ACC ATG, promoting translation. For constructs lacking a C-terminal tag the reverse primer (5' GCTTCTAGACCCTGGCTACACGTCGAACCA) included an XbaI site and the native termination codon. Some constructs were produced which contained a myc/his tag at the C-terminus of the recombinant construct using an alternate reverse primer which (5' GCTTCTAGACCCTGGCCCCACGTCGAACCA) included an XbaI site and a 3 bp alteration to remove the native termination codon. Mutagenesis to introduce point mutations was performed using the Transformer Site-Directed Mutagenesis Kit (Clontech) according to the manufacturer's protocols (primer sequences used for mutagenesis are available on request from the authors). For cloning into the HSV1 amplicon, the tagged constructs were digested with HindIII/PmeI and cloned into the HindIII/EcoRV sites of a modified pHSVPrpUC (the kind gift of Dr R.L. Neve, Harvard Medical School). All constructs were fully sequenced to verify integrity utilizing the BigDye Terminator Reagent mix and an AB1377 automated sequencer (PE Applied Biosystems). DNA for transfection was purified using EndoFree maxiprep kits (Qiagen) according to the manufacturer's instructions.
Transient transfections
HEK293 cells were maintained in OPTIMEM supplemented with 10% (v/v) fetal bovine serum (FBS), penicillin and streptomycin (all from Gibco BRL). Cells were transiently transfected using Fugene (Roche). For western blots, transfections were performed in 6-well plates with 2 µg of DNA. Protein extraction, electrophoresis and blotting were performed as described previously (43) and developed using rabbit polyclonal antibodies to the C-terminus of Parkin (Cell Signaling Technology), to the N-terminus of Parkin (34,44) or monoclonal antibodies to c-myc (clone 9E10, Roche), each diluted 1 : 1000 in blocking buffer and applied overnight at 4°C.
For localization of Parkin, cells were fixed in 4% paraformaldehyde in PBS, and permeabilized with 0.1% (w/v) TritonX100 in PBS and blocked with PBS plus 5% goat serum, 5% FBS and 0.1% Tween 20. Primary antibodies were applied overnight at 40°C, and were either monoclonal anti-myc (1 : 1000) or polyclonal anti-Parkin (1 : 500). In some experiments we co-stained with Cy5-labelled antibodies to Vimentin (Sigma, 1 : 100) or monoclonal antibodies to ubiquitin (clone FPM1, Novocastra, 1 : 50). Antibody binding was revealed using Alexa-Fluor conjugated secondary antibodies (Molecular Probes, 1 : 200) and nuclei stained with 10 nM YOYO-1 (Molecular Probes) for 10 min at room temperature. After washing in PBS, coverslips were mounted under ProLong antifade medium (Molecular Probes). For all immunofluorescence experiments, negative control of omission of primary antibody was used to evaluate non-specific fluorescence. Cells were examined using an Olympus confocal microscope running Fluoview image acquisition software. In double labeling experiments, images were collected using single excitation for each wavelength separately and channels were subsequently merged using Adobe PhotoShop.
Primary cultures and viral transduction
Primary hippocampal neurons were prepared by a modification of methods developed for culturing midbrain neurons (18,45). Briefly, hippocampi were dissected from 2-day postnatal mouse pups and dissociated with papain and plated on top of pre-established cortical glia cell monolayers at a density of 80 000 cells per well. Neuronal growth medium (47% minimal essential medium, 40% Dulbecco's modified Eagle's medium, 10% Ham's F12 medium, 3.4 g/l glucose, 0.25% albumin, 0.5 mM glutamine, 100 mg/ml transferrin, 15 mM putrescine, 30 nM triiodothyronine, 25 mg/ml insulin, 200 nM progesterone, 115 nM corticosterone, 5 mg/ml superoxide dismutase, 432 U/ml catalase and 500 µM kynenurenate) was preconditioned by adding to glial feeder layers 24 h prior to plating neurons. After 24 h, mitotic activity was inhibited by adding 11 mM 5-fluorodeoxyuridine and 55 mM uridine. Neurons from 34 week cultures were used for subsequent experiments. The pHSVPrpUC construct containing Parkin cDNA (wild-type or R275W) was packaged into recombinant viral particles using 5d11.2 helper virus and 22 cells as a packaging cell line as described (46) and purified using sucrose gradients. Recombinant viruses were titered on human neuroblastoma cell lines using staining for Parkin to score positive transduction. Primary neurons were plated exposed to viral particles for 48 h prior to fixing and staining as above. For these experiments we used multiplicities of infection (MOIs) of less than 1.0 to generate both transduced and non-transduced cells in the same cultures. To identify neurons transduced with human Parkin, cells were fixed as above and co-stained for myc and the neuronal marker microtubule associated protein-2 (MAP2).
| ACKNOWLEDGEMENTS |
|---|
We would like to thank Dr J. Paul Taylor, NINDS, for his help and advice with ubiquitin immunofluorescence. This work was supported by NINDS grants P01-14540256 and RO1-N541816-01. This work was supported in part by a M. H. Udall NIH Parkinson's disease Center of Excellence grant. P.J.L. is an Australian NHMRC CJ Martin Fellow and recipient of a Robert and Clarice Smith Fellowship in Neurodegenerative Diseases and Stroke.
| FOOTNOTES |
|---|
* To whom correspondence should be addressed. Tel: +1 9049530158; Fax: +1 9049537370; Email: farrer.matthew{at}mayo.edu
The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors. ![]()
| REFERENCES |
|---|
|
|
|---|
- Hardy, J., Cookson, M.R. and Singleton, A. (2003) Genes and parkinsonism. Lancet Neurol., 2, 221228.[CrossRef][Web of Science][Medline]
- Kitada, T., Asakawa, S., Hattori, N., Matsumine, H., Yamamura, Y., Minoshima, S., Yokochi, M., Mizuno, Y. and Shimizu, N. (1998) Mutations in the Parkin gene cause autosomal recessive juvenile Parkinsonism. Nature, 392, 605608.[CrossRef][Medline]
-
Lucking, C.B., Durr, A., Bonifati, V., Vaughan, J., De Michele, G., Gasser, T., Harhangi, B.S., Meco, G., Denefle, P., Wood, N.W. et al. (2000) Association between early-onset Parkinson's disease and mutations in the Parkin gene. French Parkinson's Disease Genetics Study Group. New Engl. J. Med., 342, 15601567.
[Abstract/Free Full Text] - Bonifati, V., De Michele, G., Lucking, C.B., Durr, A., Fabrizio, E., Ambrosio, G., Vanacore, N., De Mari, M., Marconi, R., Capus, L. et al. (2001) The Parkin gene and its phenotype. Italian PD Genetics Study Group, French PD Genetics Study Group and the European Consortium on Genetic Susceptibility in Parkinson's Disease. Neurol. Sci., 22, 5152.[CrossRef][Web of Science][Medline]
-
Tassin, J., Durr, A., Bonnet, A.M., Gil, R., Vidailhet, M., Lucking, C.B., Goas, J.Y., Durif, F., Abada, M., Echenne, B. et al. (2000) Levodopa-responsive dystonia. GTP cyclohydrolase I or Parkin mutations? Brain, 123, 11121121.
[Abstract/Free Full Text] - Klein, C., Pramstaller, P.P., Kis, B., Page, C.C., Kann, M., Leung, J., Woodward, H., Castellan, C.C., Scherer, M., Vieregge, P. et al. (2000) Parkin deletions in a family with adult-onset, tremor-dominant parkinsonism: expanding the phenotype. Ann. Neurol., 48, 6571.[CrossRef][Web of Science][Medline]
- Pramstaller, P.P., Kis, B., Eskelson, C., Hedrich, K., Scherer, M., Schwinger, E., Breakefield, X.O., Kramer, P.L., Ozelius, L.J. and Klein, C. (2002) Phenotypic variability in a large kindred (Family LA) with deletions in the Parkin gene. Mov. Disord., 17, 424426.[CrossRef][Web of Science][Medline]
-
Lincoln, S., Wiley, J., Lynch, T., William Langston, J., Chen, R., Lang, A., Rogaeva, E., Sa, D.S., Munhoz, R.P., Harris, J. et al. (2003) Parkin proven disease: Common founders but divergent phenotypes. Neurology, 60, 16051610.
[Abstract/Free Full Text] - Ishikawa, A. and Takahashi, H. (1998) Clinical and neuropathological aspects of autosomal recessive juvenile Parkinsonism. J. Neurol., 245, 49.
-
Mori, H., Kondo, T., Yokochi, M., Matsumine, H., Nakagawa-Hattori, Y., Miyake, T., Suda, K. and Mizuno, Y. (1998) Pathologic and biochemical studies of juvenile Parkinsonism linked to chromosome 6q. [See comments.] Neurology, 51, 890892.
[Abstract/Free Full Text] - Hayashi, S., Wakabayashi, K., Ishikawa, A., Nagai, H., Saito, M., Maruyama, M., Takahashi, T., Ozawa, T., Tsuji, S. and Takahashi, H. (2000) An autopsy case of autosomal-recessive juvenile Parkinsonism with a homozygous exon 4 deletion in the Parkin gene. Mov. Disord., 15, 884888.[CrossRef][Web of Science][Medline]
-
van de Warrenburg, B.P., Lammens, M., Lucking, C.B., Denefle, P., Wesseling, P., Booij, J., Praamstra, P., Quinn, N., Brice, A. and Horstink, M.W. (2001) Clinical and pathologic abnormalities in a family with Parkinsonism and Parkin gene mutations. Neurology, 56, 555557.
[Abstract/Free Full Text] - Morales, B., Martinez, A., Gonzalo, I., Vidal, L., Ros, R., Gomez-Tortosa, E., Rabano, A., Ampuero, I., Sanchez, M., Hoenicka, J. et al. (2002) SteeleRichardsonOlszewski syndrome in a patient with a single C212Y mutation in the Parkin protein. Mov. Disord., 17, 13741380.[CrossRef][Web of Science][Medline]
- Farrer, M., Chan, P., Chen, R., Tan, L., Lincoln, S., Hernandez, D., Forno, L., Gwinn-Hardy, K., Petrucelli, L., Hussey, J. et al. (2001) Lewy bodies and Parkinsonism in families with Parkin mutations. Ann. Neurol., 50, 293300.[CrossRef][Web of Science][Medline]
- Freemont, P.S. (1993) The RING finger. A novel protein sequence motif related to the zinc finger. Ann. NY Acad. Sci., 684, 174192.[Web of Science][Medline]
- Shimura, H., Hattori, N., Kubo, S., Mizuno, Y., Asakawa, S., Minoshima, S., Shimizu, N., Iwai, K., Chiba, T., Tanaka, K. et al. (2000) Familial Parkinson disease gene product, Parkin, is a ubiquitin-protein ligase. Nat. Genet., 25, 302305.[CrossRef][Web of Science][Medline]
- Cookson, M.R. (2003) Parkin's substrates and the pathways leading to neuronal damage. Neuromol. Med., 3, 113.[CrossRef]
- Petrucelli, L., O'Farrell, C., Lockhart, P.J., Baptista, M., Kehoe, K., Vink, L., Choi, P., Wolozin, B., Farrer, M., Hardy, J. et al. (2002) Parkin protects against the toxicity associated with mutant alpha-synuclein: proteasome dysfunction selectively affects catecholaminergic neurons. Neuron, 36, 10071019.[CrossRef][Web of Science][Medline]
- Feany, M.B. and Pallanck, L.J. (2003) Parkin. A multipurpose neuroprotective agent? Neuron, 38, 1316.[CrossRef][Web of Science][Medline]
-
Chung, K.K., Zhang, Y., Lim, K.L., Tanaka, Y., Huang, H., Gao, J., Ross, C.A., Dawson, V.L. and Dawson, T.M. (2001) Parkin ubiquitinates the
-synuclein-interacting protein, synphilin-1: implications for Lewy-body formation in Parkinson disease. Nat. Med., 7, 11441150.[CrossRef][Web of Science][Medline] - Shimura, H., Hattori, N., Kubo, S., Yoshikawa, M., Kitada, T., Matsumine, H., Asakawa, S., Minoshima, S., Yamamura, Y., Shimizu, N. et al. (1999) Immunohistochemical and subcellular localization of Parkin protein: absence of Parkin in autosomal recessive juvenile Parkinsonism patients. Ann. Neurol., 45, 668672.[CrossRef][Web of Science][Medline]
- Kubo, S.I., Kitami, T., Noda, S., Shimura, H., Uchiyama, Y., Asakawa, S., Minoshima, S., Shimizu, N., Mizuno, Y. and Hattori, N. (2001) Parkin is associated with cellular vesicles. J. Neurochem., 78, 4254.[CrossRef][Web of Science][Medline]
- Huynh, D.P., Scoles, D.R., Ho, T.H., Del Bigio, M.R. and Pulst, S.M. (2000) Parkin is associated with actin filaments in neuronal and nonneural cells. Ann. Neurol., 48, 737744.[CrossRef][Web of Science][Medline]
-
Ren, Y., Zhao, J. and Feng, J. (2003) Parkin binds to alpha/beta tubulin and increases their ubiquitination and degradation. J. Neurosci., 23, 33163324.
[Abstract/Free Full Text] - Stichel, C.C., Augustin, M., Kuhn, K., Zhu, X.R., Engels, P., Ullmer, C. and Lubbert, H. (2000) Parkin expression in the adult mouse brain. Eur. J. Neurosci., 12, 41814194.[CrossRef][Web of Science][Medline]
- Horowitz, J.M., Vernace, V.A., Myers, J., Stachowiak, M.K., Hanlon, D.W., Fraley, G.S. and Torres, G. (2001) Immunodetection of Parkin protein in vertebrate and invertebrate brains: a comparative study using specific antibodies. J. Chem. Neuroanat., 21, 7593.[CrossRef][Web of Science][Medline]
- Fallon, L., Moreau, F., Croft, B.G., Labib, N., Gu, W.-J. and Fon, E.A. (2001) Parkin and CASK/LIN-2 associate via a PDZ-mediated interaction and are co-localized in lipid rafts and postsynaptic densities in brain. J. Biol. Chem., 277, 486491.[Medline]
-
Johnston, J.A., Ward, C.L. and Kopito, R.R. (1998) Aggresomes: a cellular response to misfolded proteins. J. Cell. Biol., 143, 18831898.
[Abstract/Free Full Text] - Ardley, H.C., Scott, G.B., Rose, S.A., Tan, N.G., Markham, A.F. and Robinson, P.A. (2003) Inhibition of proteasomal activity causes inclusion formation in neuronal and non-neuronal cells over-expressing Parkin. Mol. Biol. Cell (in press).
- Kopito, R.R. and Sitia, R. (2000) Aggresomes and Russell bodies. Symptoms of cellular indigestion? EMBO Rep., 1, 225231.[CrossRef][Web of Science][Medline]
-
Waelter, S., Boeddrich, A., Lurz, R., Scherzinger, E., Lueder, G., Lehrach, H. and Wanker, E.E. (2001) Accumulation of mutant huntingtin fragments in aggresome-like inclusion bodies as a result of insufficient protein degradation. Mol. Biol. Cell, 12, 13931407.
[Abstract/Free Full Text] - Spillantini, M.G., Schmidt, M.L., Lee, V.M., Trojanowski, J.Q., Jakes, R. and Goedert, M. (1997) Alpha-synuclein in Lewy bodies. Nature, 388, 839840.[CrossRef][Medline]
- Kruger, R., Eberhardt, O., Reiss, O. and Schulz, J.B. (2002) Parkinson's disease: one biochemical pathway to fit all genes? Trends Mol. Med., 8, 236240.[CrossRef][Web of Science][Medline]
-
Shimura, H., Schlossmacher, M.G., Hattori, N., Frosch, M.P., Trockenbacher, A., Schneider, R., Mizuno, Y., Kosik, K.S. and Selkoe, D.J. (2001) Ubiquitination of a new form of
-synuclein by Parkin from human brain: Implications for Parkinson's disease. Science, 293, 263269.[Abstract/Free Full Text] - Cummings, C.J., Mancini, M.A., Antalffy, B., DeFranco, D.B., Orr, H.T. and Zoghbi, H.Y. (1998) Chaperone suppression of aggregation and altered subcellular proteasome localization imply protein misfolding in SCA1. Nat. Genet., 19, 148154.[CrossRef][Web of Science][Medline]
-
Cooper, J.K., Schilling, G., Peters, M.F., Herring, W.J., Sharp, A.H., Kaminsky, Z., Masone, J., Khan, F.A., Delanoy, M., Borchelt, D.R. et al. (1998) Truncated N-terminal fragments of huntingtin with expanded glutamine repeats form nuclear and cytoplasmic aggregates in cell culture. Hum. Mol. Genet., 7, 783790.
[Abstract/Free Full Text] -
Taylor, J.P., Tanaka, F., Robitschek, J., Sandoval, C.M., Taye, A., Markovic-Plese, S. and Fischbeck, K.H. (2003) Aggresomes protect cells by enhancing the degradation of toxic polyglutamine-containing protein. Hum. Mol. Genet., 12, 749757.
[Abstract/Free Full Text] -
Junn, E., Lee, S.S., Suhr, U.T. and Mouradian, M.M. (2002) Parkin accumulation in aggresomes due to proteasome impairment. J. Biol. Chem., 277, 4787047877.
[Abstract/Free Full Text] -
Finney, N., Walther, F., Mantel, P.Y., Stauffer, D., Rovelli, G. and Dev, K.K. (2003) The cellular protein level of Parkin is regulated by its Ubiquitin-like domain. J. Biol. Chem., 278, 1605416058.
[Abstract/Free Full Text] - Choi, P., Ostrerova-Golts, N., Sparkman, D., Cochran, E., Lee, J.M. and Wolozin, B. (2000) Parkin is metabolized by the ubiquitin/proteosome system. Neuroreport, 11, 26352638.[Web of Science][Medline]
-
Zhang, Y., Gao, J., Chung, K.K., Huang, H., Dawson, V.L. and Dawson, T.M. (2000) Parkin functions as an E2-dependent ubiquitin- protein ligase and promotes the degradation of the synaptic vesicle-associated protein, CDCrel-1. Proc. Natl Acad. Sci. USA, 97, 1335413359.
[Abstract/Free Full Text] - McNaught, K.S., Shashidharan, P., Perl, D.P., Jenner, P. and Olanow, C.W. (2002) Aggresome-related biogenesis of Lewy bodies. Eur. J. Neurosci., 16, 21362148.[CrossRef][Web of Science][Medline]
- O'Farrell, C.A., Murphy, D.D., Petrucelli, L., Singleton, A.B., Hussey, J., Farrer, M., Hardy, J., Dickson, D.W. and Cookson, M.R. (2001) Transfected synphilin-1 forms cytoplasmic inclusions in HEK293 cells. Mol. Brain Res., 97, 94102.[Medline]
-
Schlossmacher, M.G., Frosch, M.P., Gai, W.P., Medina, M., Sharma, N., Forno, L., Ochiishi, T., Shimura, H., Sharon, R., Hattori, N. et al. (2002) Parkin localizes to the Lewy bodies of Parkinson disease and dementia with Lewy bodies. Am. J. Pathol., 160, 16551667.
[Abstract/Free Full Text] - Burke, R.E., Antonelli, M. and Sulzer, D. (1998) Glial cell line-derived neurotrophic growth factor inhibits apoptotic death of postnatal substantia nigra dopamine neurons in primary culture. J. Neurochem., 71, 517525.[Web of Science][Medline]
-
Neve, R.L., Howe, J.R., Hong, S. and Kalb, R.G. (1997) Introduction of the glutamate receptor subunit 1 into motor neurons in vitro and in vivo using a recombinant herpes simplex virus. Neuroscience, 79, 435447.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:
![]() |
T. Fishman-Jacob, L. Reznichenko, M. B. H. Youdim, and S. A. Mandel A Sporadic Parkinson Disease Model via Silencing of the Ubiquitin-Proteasome/E3 Ligase Component SKP1A J. Biol. Chem., November 20, 2009; 284(47): 32835 - 32845. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Rubio de la Torre, B. Luzon-Toro, I. Forte-Lago, A. Minguez-Castellanos, I. Ferrer, and S. Hilfiker Combined kinase inhibition modulates parkin inactivation Hum. Mol. Genet., March 1, 2009; 18(5): 809 - 823. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-H. Lu, S. M. Fleming, B. Meurers, L. C. Ackerson, F. Mortazavi, V. Lo, D. Hernandez, D. Sulzer, G. R. Jackson, N. T. Maidment, et al. Bacterial Artificial Chromosome Transgenic Mice Expressing a Truncated Mutant Parkin Exhibit Age-Dependent Hypokinetic Motor Deficits, Dopaminergic Neuron Degeneration, and Accumulation of Proteinase K-Resistant {alpha}-Synuclein J. Neurosci., February 18, 2009; 29(7): 1962 - 1976. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Schlehe, A. K. Lutz, A. Pilsl, K. Lammermann, K. Grgur, I. H. Henn, J. Tatzelt, and K. F. Winklhofer Aberrant Folding of Pathogenic Parkin Mutants: AGGREGATION VERSUS DEGRADATION J. Biol. Chem., May 16, 2008; 283(20): 13771 - 13779. [Abstract] [Full Text] [PDF] |
||||
![]() |
S Lesage, E Lohmann, F Tison, F Durif, A Durr, A Brice, and for the French Parkinson's Disease Genetics Study Rare heterozygous parkin variants in French early-onset Parkinson disease patients and controls J. Med. Genet., January 1, 2008; 45(1): 43 - 46. [Abstract] [Full Text] [PDF] |
||||
![]() |
T.-K. Sang, H.-Y. Chang, G. M. Lawless, A. Ratnaparkhi, L. Mee, L. C. Ackerson, N. T. Maidment, D. E. Krantz, and G. R. Jackson A Drosophila Model of Mutant Human Parkin-Induced Toxicity Demonstrates Selective Loss of Dopaminergic Neurons and Dependence on Cellular Dopamine J. Neurosci., January 31, 2007; 27(5): 981 - 992. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Hampe, H. Ardila-Osorio, M. Fournier, A. Brice, and O. Corti Biochemical analysis of Parkinson's disease-causing variants of Parkin, an E3 ubiquitin-protein ligase with monoubiquitylation capacity Hum. Mol. Genet., July 1, 2006; 15(13): 2059 - 2075. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. N. Clark, S. Afridi, E. Karlins, Y. Wang, H. Mejia-Santana, J. Harris, E. D. Louis, L. J. Cote, H. Andrews, S. Fahn, et al. Case-control study of the parkin gene in early-onset Parkinson disease. Arch Neurol, April 1, 2006; 63(4): 548 - 552. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Matsuda, T. Kitami, T. Suzuki, Y. Mizuno, N. Hattori, and K. Tanaka Diverse Effects of Pathogenic Mutations of Parkin That Catalyze Multiple Monoubiquitylation in Vitro J. Biol. Chem., February 10, 2006; 281(6): 3204 - 3209. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Wang, H. S. Ko, B. Thomas, F. Tsang, K. C.M. Chew, S.-P. Tay, M. W.L. Ho, T.-M. Lim, T.-W. Soong, O. Pletnikova, et al. Stress-induced alterations in parkin solubility promote parkin aggregation and compromise parkin's protective function Hum. Mol. Genet., December 15, 2005; 14(24): 3885 - 3897. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Springer, T. Hoppe, E. Schmidt, and R. Baumeister A Caenorhabditis elegans Parkin mutant with altered solubility couples {alpha}-synuclein aggregation to proteotoxic stress Hum. Mol. Genet., November 15, 2005; 14(22): 3407 - 3423. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Sriram, X. Li, H. S. Ko, K. K.K. Chung, E. Wong, K. L. Lim, V. L. Dawson, and T. M. Dawson Familial-associated mutations differentially disrupt the solubility, localization, binding and ubiquitination properties of parkin Hum. Mol. Genet., September 1, 2005; 14(17): 2571 - 2586. [Abstract] [Full Text] [PDF] |
||||
![]() |
R.-M. Wu, R. Bounds, S. Lincoln, M. Hulihan, C.-H. Lin, W.-L. Hwu, J. Chen, K. Gwinn-Hardy, and M. Farrer Parkin Mutations and Early-Onset Parkinsonism in a Taiwanese Cohort Arch Neurol, January 1, 2005; 62(1): 82 - 87. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Marin, J. I. Lucas, A.-C. Gradilla, and A. Ferrus Parkin and relatives: the RBR family of ubiquitin ligases Physiol Genomics, May 19, 2004; 17(3): 253 - 263. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. P. Munhoz, D. S. Sa, E. Rogaeva, S. Salehi-Rad, C. Sato, H. Medeiros, M. Farrer, and A. E. Lang Clinical Findings in a Large Family With a Parkin Ex3{Delta}40 Mutation Arch Neurol, May 1, 2004; 61(5): 701 - 704. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. F. Mata, P. J. Lockhart, and M. J. Farrer Parkin genetics: one model for Parkinson's disease Hum. Mol. Genet., April 1, 2004; 13(90001): R127 - 133. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M.K. Muqit, S. M. Davidson, M. D. Payne Smith, L. P. MacCormac, S. Kahns, P. H. Jensen, N. W. Wood, and D. S. Latchman Parkin is recruited into aggresomes in a stress-specific manner: over-expression of parkin reduces aggresome formation but can be dissociated from parkin's effect on neuronal survival Hum. Mol. Genet., January 1, 2004; 13(1): 117 - 135. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||










