Skip Navigation


Human Molecular Genetics Advance Access originally published online on October 21, 2003
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Material
Right arrow All Versions of this Article:
12/24/3295    most recent
ddg350v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (69)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Ceman, S.
Right arrow Articles by Warren, S. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ceman, S.
Right arrow Articles by Warren, S. T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2003, Vol. 12, No. 24 3295-3305
DOI: 10.1093/hmg/ddg350
© 2003 Oxford University Press

Phosphorylation influences the translation state of FMRP-associated polyribosomes

Stephanie Ceman1,{dagger},{ddagger}, William T. O'Donnell1,{dagger}, Matt Reed2, Stephana Patton1, Jan Pohl2 and Stephen T. Warren1,*

1Department of Human Genetics and 2Microchemical Facility, Emory University School of Medicine, Atlanta, GA 30322, USA

Received July 28, 2003; Accepted October 6, 2003


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Fragile X mental retardation protein, FMRP, is absent in patients with fragile X syndrome, a common form of mental retardation. FMRP is a nucleocytoplasmic RNA binding protein that is primarily associated with polyribosomes. FMRP is believed to be a translational repressor and may regulate the translation of certain mRNAs at the base of dendritic spines in neurons. However, little is known about the regulation of FMRP. Using mass spectrometry and site-directed mutagenesis, we show that FMRP is phosphorylated between residues 483 and 521, N-terminal to the RGG box, both in murine brain and in cultured cells. Primary phosphorylation occurs on the highly conserved serine 499, which triggers hierarchical phosphorylation of nearby serines. FMRP is phosphorylated within 2–4 h of synthesis, however, phosphorylation has no effect on the half-life of the protein. In contrast to the Drosophila ortholog dFxr, the phosphorylation status of mammalian FMRP does not influence its association with specific mRNAs in vivo. However, we find unphosphorylated FMRP associated with actively translating polyribosomes while a fraction of phosphorylated FMRP is associated with apparently stalled polyribosomes. Our data suggest that the phosphorylation may regulate FMRP and that the release of FMRP-induced translational suppression may involve a dephosphorylation signal.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Fragile X syndrome is one of the most common forms of inherited mental retardation, affecting 1/4000 males and 1/8000 females (reviewed in 1). As its name would suggest, individuals with fragile X syndrome have a visible constriction at the distal end of the X chromosome (2,3). This region was positionally cloned and shown to contain the FMR1 gene (reviewed in 1). Expansion of a CGG repeat in the 5'UTR causes transcriptional silencing of FMR1 in fragile X syndrome (4,5). Thus, affected individuals are unable to express the protein product of the FMR1 locus, FMRP, indicating a role for FMRP in normal cognitive function.

FMRP has RNA-binding motifs including two hnRNP K-protein homology (KH) domains and an RGG box (6,7). FMRP binds mRNA both in vitro as a purified recombinant protein (8,9) and in cells as identified by co-immunoprecipitation experiments (10). Recently the identities of the in vivo associated mRNAs to which FMRP binds have been elucidated (1114).

FMRP associates with the heavy-sedimenting, polyribosome structures that contain mRNAs bound by multiple ribosomes (1518). This ribosome association was demonstrated as critical to FMRP function by the severity of the fragile X phenotype observed in a patient with a I304N mutation whose FMR protein no longer associates with ribosomes (19,20). These observations led to the hypothesis that FMRP modulates the translation of its associated mRNAs. Indeed, mRNAs found associated with FMRP by co-immunoprecipitation studies also had altered association with polyribosomes in the absence of FMRP (12). In addition, over-expression of FMRP suppresses translation of mRNAs both in vitro and in vivo (2123), suggesting that FMRP interacts with the trans-lational apparatus to modulate protein expression of associated RNAs.

Post-translational modifications, in particular phosphorylation, have been shown to modulate nuclear shuttling, RNA binding and protein–protein interactions in proteins with structural features similar to FMRP (2427 and reviewed in 28,29). Recently, the Drosophila ortholog of FMRP, dFxr, was shown to be phosphorylated on a highly conserved serine (30). We show here that murine FMRP is primarily phosphorylated on this same conserved serine residue (numbered as 499 in mouse) both in cultured cells and in the mouse brain. In vitro phosphorylation of purified recombinant dFxr increased its ability to associate with homopolymers of RNA (30). However, we found that unlike the Drosophila ortholog, the phosphorylation state of serine 499 has no effect on the ability of mammalian FMRP to associate with RNAs known to bind FMRP in vivo. Rather, we found evidence that phosphorylated FMRP may be associated with stalled ribosomes suggesting that dephosphorylation may trigger the translation of FMRP-associated messages.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
FMRP is phosphorylated on multiple residues both in cultured cells and in brain
To determine whether mammalian FMRP is a phosphoprotein, we metabolically-labeled cells with [32P]orthophosphoric acid and isolated Flag-tagged FMRP by immunoprecipitation with an anti-Flag antibody as described previously (10). We observed an 80 kDa phosphoprotein in the Flag-FMRP-expressing transfectant that was not present in the empty vector cell line (Fig. 1A) and confirmed that this was FMRP by western blotting (data not shown). To ascertain which amino acid was the kinase substrate, we gel-purified phospho-FMRP, performed phosphoamino acid analysis and found that FMRP was phosphorylated primarily on serine residues (Fig. 1B). This observation was confirmed in a number of other cultured mammalian cell lines including Cos 7, NIH 3T3 and HeLa cells (data not shown). To identify which of the 47 serines in FMRP is phosphorylated, we used the mass spectrometry-based method of precursor ion scanning where tryptic peptides are ionized and analyzed on a triple quadrupole mass spectrometer (31). FMRP was isolated from a large-scale purification, digested with trypsin and an aliquot was analyzed by MALDI-TOF, confirming the band as FMRP (data not shown). Precursor ion scanning of the tryptic digest reproducibly showed phosphorylation in a single region of FMRP (amino acids 483–521) with one, two or three phosphoresidues (Table 1, top). The data from the precursor ion scan narrowed the region of FMRP-phosphorylation to a 38 amino acid peptide located between the nuclear export sequence and the RGG box that contains seven serines shown in bold (Fig. 2A).



View larger version (30K):
[in this window]
[in a new window]
 
Figure 1. Murine FMRP is phosphorylated primarily on serine. (A) An empty-vector expressing L-M(TK-) cell (VC) and a Flag-FMRP expressing transfectant (WT) were metabolically-labeled with [32P]orthophosphoric acid, immunoprecipitated with anti-Flag M2 matrix, resolved on a 7.5% SDS–PAGE and subjected to autoradiography. (B) The band at 80 kDa was isolated and subjected to phosphoamino acid analysis. Ser, serine; thr, threonine; tyr, tyrosine.

 

View this table:
[in this window]
[in a new window]
 
Table 1. FMRP phosphopeptides identified by PIS and MS/MS
 


View larger version (16K):
[in this window]
[in a new window]
 
Figure 2. Flag-Fmr peptide 491–529 is the primary phosphopeptide in cultured cells and in brain. (A) Schematic of the domain structure of FMRP. Peptide 483–521 was identified by PIS as the primary phoshorylated fragment in cultured cells. Serines are in bold and arrows show the four possible sites of phosphorylation in mouse brain identified by uLC/MS/MS. The numbering indicates amino acid position. (B) Stably-transfected murine fibroblast L-M(TK-) cells expressing the vector alone (VC), wild type Fmr1 (WT), the alanine substitution at residue 499 (Ala) or the aspartic acid substitution at 499 (Asp) were labeled with [32P]orthophosphoric acid and immunoprecipitated with anti-Flag M2 matrix. The immunoprecipitations were then split and subjected to autoradiography (upper panel) or to western blot analysis with the anti-FMRP antibody MAb1A3 (lower panel).

 
To ask if the above data could be generalized to the mammalian brain, we isolated FMRP from murine brains and submitted it for phosphoamino acid analysis by MS/MS. Three phosphopeptides were identified by mass spectrometry and were identical to or within the phosphopeptides identified by PIS (Table 1, bottom). Although there were insufficient ions to identify the exact phospho-residue by further MS/MS fragmentation, the pattern of unphosphorylated subfragments from each of these peptides allowed us to further narrow the region of phosphorylation. Thus, in mouse brain, S496, S499, T501 and S503 are possible kinase substrates (Fig. 2A, arrows). This region of FMRP, phosphorylated both in cultured mammalian cells and in brain, contains serine 499, the highly conserved residue found phosphorylated in the Drosophila ortholog dFxr (30).

To examine if serine 499 is a primary phosphorylation site, we used site-directed mutagenesis to replace this serine with either an alanine (Ala), which cannot be phosphorylated or an aspartic acid (Asp), which mimics phosphorylation (32). These stable transfectants do not over-express FMRP with each line expressing nearly equivalent amounts of modified FMRP, in levels consistent with endogenous FMRP levels in other cell types. Using [32P]orthophosphoric acid label, the alanine-substituted FMRP was virtually unphosphorylated (Fig. 2B). However, the aspartic acid substitution partially restored phosphorylation, even though aspartic acid itself is not a substrate for a kinase. This observation suggests that a negative charge at position 499 triggers phosphorylation of a second site within the 496–503 region that flanks the primary phosphorylation site at 499. Western blot analysis shows that equal amounts of the flag-encoded transgenes were analyzed (Fig. 2B, lower). These data demonstrate that serine 499 is the primary phosphorlation site and that asp substitution for this serine is recognized by the cell as phosphoserine triggering hierarchical phosphorylation of nearby residues.

Serine 499 does not affect the half-life of FMRP
PEST sequences, which are stretches of proline (P), glutamic acid (E), serine (S) and threonine (T), can mediate the rapid destruction of proteins with short half-lives and can be modulated by phosphorylation (3337). The region of FMRP that is phosphorylated lies within a potential PEST sequence (www.at.embnet.org/embnet/tools/bio/PESTfind/). To establish whether or not FMRP degradation was modulated by a PEST sequence, we determined the half-life of the wild-type transfectant and the Fmr proteins with substitutions for serine 499 by pulse-chase analysis. We found that the half-life of FMRP, regardless of the amino acid at position 499, is ~30 h in the L-M (TK-) cells (Fig. 3A). Thus, FMRP is a long-lived protein and its half-life appears unchanged by phosphorylation at serine 499 in these cells.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 3. Pulse-chase analysis of FMRP. (A) Transfected murine fibroblast L-M cells, expressing the vector alone (VC), wild type Fmr1 (WT) or the aspartic acid-substituted Fmr1 at position 499 (Asp) were metabolically-labeled with [35S]methionine for 30 min (pulse=0) and then chased in methionine-containing medium for the various times shown in hours. After immunoprecipitation with the 7G1-1 antibody, the proteins were resolved on a 7.5% SDS polyacrylamide gel. (B) Transfected murine fibroblast L-M cells were metabolically-labeled with [35S]methionine for 30  min (pulse=0), then chased in methionine-containing medium for the times shown in hours and resolved on a 6% SDS polyacrylamide gel. (C) Pulse-chase, immunoprecipitated FMRP was treated (+) or not (-) with alkaline phosphatase at the time points indicated and resolved on a SDS 6% polyacrylamide gel.

 
Comparison of FMRP at 36 h to the newly-synthesized FMRP at the pulse-point suggests a small difference in the size of the protein (Fig. 3A). Newly synthesized FMRP appears to migrate slightly faster than it does at later time points. Phosphorylation can increase the size of a protein by 79 daltons for each site (31). In addition, a small reduction in electrophoretic mobility of phosphorylated proteins has been previously observed (38). We determined when phosphorylation was occurring by analyzing the migration of FMRP during shorter chase times and on a lower percentage acrylamide gel. In Figure 3B, FMRP increased in size after 2 h of chase. We confirmed this in an independent experiment where the pulse (0) and 4 h chase points were treated with phosphatase (Fig. 3C). Phosphatase treatment reduced the mobility of the 4 h FMRP but not of the newly-synthesized FMRP. Thus, FMRP is phosphorylated within 2–4 h after translation and this phosphorylation is still evident after 36 h.

Amino acid 499 has no effect on the association of FMRP with RNAs in cells
Since the primary phosphorylation site in FMRP is ~30 amino acids N-terminal to the RGG box, known to bind the G-quartet structure of associated mRNAs (11,13), we hypothesized that phosphorylation might modulate RNA binding. Indeed, in vitro evidence has been published indicating that Drosophila dFxr protein exhibits heightened RNA homopolymer binding when phosphorylated. To test whether or not phosphorylation of mammalian FMRP influences RNA binding we chose a more global in vivo screen using microarrays since previous approaches to this question are limited to either in vitro methodologies or examination of artificial homopolymers or, at best, a limited number of natural messages (9,30). We immunoprecipitated FMRP from the VC, WT, Ala and Asp Flag-FMRP-expressing cell lines, all containing comparable amounts of transgene product (Fig. 4A), and analyzed the associated RNAs using Affymetrix oligonucleotide microarrays. In two independent experiments, we interrogated 12 473 genes, found 4779 or ~39% expressed in these cultured cells and identified 214 transcripts immunoprecipitated with WT FMRP (Fig. 4B and Supplementary Table 1 for the complete dataset). These 214 co-immunoprecipitating transcripts reflect 4.5% of the expressed messages from the L-M(TK-) cells, which agrees well with the nearly 4% of messages co-immunoprecipitated with FMRP from the mouse brain (12). We evaluated the co-immunoprecipitating transcripts from the WT, Ala and Asp versions of FMRP utilizing Affymetrix comparison analysis and unpaired t-tests for significance. Using these criteria, only one transcript showed a significant difference while >99.5% of the associated transcripts showed no significant difference regardless of the amino acid substitution at position 499. The sole significant deviation was for an unknown EST on chromosome 5 (97437_f_at) that bound less well to the Asp-substituted FMRP compared to WT. Despite this single outlier, perhaps due to multiple testing, these data clearly suggest that the phosphorylation status of FMRP does not substantially modify global mRNA association.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 4. Effect of amino acid substitutions at 499 on RNA binding in vivo. (A) Western blot analysis of M2 anti-Flag IPs from cell lines expressing either the expression vector (VC), FMRP (WT), the alanine-substituted FMRP (Ala) or the aspartic acid-substituted FMRP (Asp). (B) Heat map of the intensity values from WT, Ala, Asp and VC IPs for the 214 transcripts found in the WT IP. Scale (shades of red proportional to the raw, unscaled Affymetrix intensity value): red represents an intensity value >200; black represents an intensity value of 0. (C) The Affymetrix intensity values (mean+SEM; n=2) of nine transcripts co-immunoprecipitated with either VC, WT, Ala or Asp FMRP are shown along with the values for Fmr1. These nine transcripts were previously shown to be ligands of FMRP in mouse brain IPs (12). No Ala or Asp value is significantly different from the WT value by Affymetrix analysis nor are there any differences by t-test except: *WT>Asp for transcript 4, P<0.05. Table shows the Affymetrix and GenBank identities as well as a description of each of the transcripts shown.

 
To examine this data at the level of individual mRNAs, we examined nine previously published FMRP RNA ligands from mouse brain (12) that were present in the WT IP. Figure 4C shows the intensity values for these nine genes in the VC, WT, Ala and Asp IPs. None of these nine showed a significant difference in the quantity of RNA between WT and Ala IPs or between WT and Asp IPs by the criteria used above.

The effect of phosphorylation on polyribosome-association
Despite the fact that serine 499 is conserved in all known paralogs and orthologs of FMRP (30), we found no evidence that phosphorylation of this site in mammalian FMRP influences RNA-binding. Since FMRP is found associated with polyribosomes (1618,20) and likely plays a role in translation (14,2123), we examined the localization of the WT and serine-substituted Fmr proteins on polyribosomes (Fig. 5). Under steady-state conditions, there was no difference in Flag-FMRP polysome localization between the WT, Ala and Asp-expressing transfectants in three independent experiments (Figs 5 and 6). By scanning densitometry, 43% (WT), 49% (Ala) and 34% (Asp) of the total Fmr protein was found in fractions 8–10, containing the heavy polyribosomes (not significantly different, Figs 5, upper, and 6).



View larger version (37K):
[in this window]
[in a new window]
 
Figure 5. Unphosphorylated FMRP is associated with actively-translating polyribosomes. Stably transfected cell lines expressing vector (VC), FMRP (WT), the alanine-substituted FMRP (Ala) or the aspartic acid-substituted FMRP (Asp) at residue 499 were treated either with cycloheximide (upper) or sodium azide (lower) and then fractionated on a linear 15–45% sucrose gradient. The profiles are shown as absorbance at 254 nm. The positions of the 40S, 60S and 80S monosomes are indicated by the arrows. The fractions were analyzed on 4–15% gradient gels, transferred to PVDF and probed with the anti-Flag antibody M2 (F-F) or with an antibody to the S6 ribosomal protein (S6).

 


View larger version (13K):
[in this window]
[in a new window]
 
Figure 6. Phosphorylated FMRP remains associated with heavy polyribosomes after sodium azide treatment. The fraction of total FMRP western blot signal contained in fractions 8–10 of cycloheximide and sodium azide treated cells was determined by densitometry for WT, Ala and Asp lines (n=4, 3 and 3, respectively). There was no significant difference between cycloheximide treated WT, Ala and Asp cells although there was a significant difference between the cycloheximide-treated and sodium azide-treated cells of each transfectant. *FMRP signal in cycloheximide treated cells>FMRP signal in Na azide treated cells, P<0.05. {alpha} WT azide>Ala azide and Asp azide>Ala azide, P<0.05.

 
To determine if the phosphorylation status of serine 499 influences ribosome migration, we next performed ribosome run-off experiments by treating cells with sodium azide, a non-specific inhibitor of translation initiation that does not affect elongation and has been extensively utilized for such analyses (20,39,40). When translation initiation is inhibited, the ribosomes involved in active translation will continue to move along the RNA without a new round of ribosome assembly. This results in the loss of heavy polysomes in the profiles as the complexes become lighter and in the accumulation of monosomes (compare the size of the 80 s peak between the upper and lower panels as well as the loss of polysomes in the sodium azide-treated lower panels of Fig. 5). The polysome fractions were probed with an antibody to the ribosomal S6 protein to show that ribosome run-off had occurred in response to the sodium azide treatment (compare the upper panels of Fig. 5 where S6 is found in fractions 2–10, to the lower panels which show that following sodium azide treatment, S6 falls back primarily to fractions 2–6). Examination of the sodium azide-treated cells by electron microscopy revealed a loss of polyribosomes upon treatment, but maintenance of the cellular architecture (data not shown).

When the FMR proteins were examined in three independent experiments, there was a significant loss of the WT and Asp-substituted proteins from the heavy polysomes upon sodium azide treatment. On average, there was a 44% reduction in FMRP in fractions 8–10 in WT azide compared to WT and a 51% reduction in Asp azide compared to Asp (Fig. 6). However, the unphosphorylated FMRP is almost completely absent from the heavy fractions after sodium azide treatment showing a 93% reduction in fractions 8–10 between Ala and Ala azide (Figs 5 and 6). This result suggests unphosphorylated FMRP runs-off more quickly than phosphorylated FMRP, which appears resistant to run-off and may be associated with stalled polyribosomes. Furthermore, we observed a persistence of middle-sized polysomes in fractions 5–7 of both the WT and Asp transfectants after sodium azide treatment that was not present in the Ala-expressing cells. To determine if this was a dominant effect of expressing ectopic FMRP, we examined the polysome profiles in a run-off experiment with the vector-only expressing cell line (VC) and found that, like Ala, there were no persistent polysomes in fractions 5–7. Our results suggest that the phosphorylated FMRP found in WT and Asp is resistant to run-off in association with the apparently stalled polysomes visible in fractions 5–7. Conversely, unphosphorylated FMRP is associated with actively translating polysomes that readily run-off transcripts in the presence of an inhibitor of translation initiation.

To rule out the possibility that the appearance of FMRP on polysomes was due to a phenomenon other than ribosome association, such as aggregation, we examined the mRNP size of the different FMRP-mRNPs by treating with EDTA, known to disrupt the ribosomes. After EDTA treatment, WT, Ala and Asp Flag-FMRP form heavy mRNP particles of similar size, slightly larger than the large ribosomal subunit (Fig. 7, upper). Furthermore, treatment of the lysates prior to centrifugation with RNase demonstrates the co-fractionation of all versions of Flag-FMRP with the polyribosomes is RNA dependent (Fig. 7, lower).



View larger version (20K):
[in this window]
[in a new window]
 
Figure 7. Phosphorylation has no effect on the fractionation of Flag-FMRP in the presence of EDTA or RNase. Stably transfected cells lines expressing Flag tagged FMRP (WT), Ala-FMRP (Ala) or Asp-FMRP (Asp) were either lysed in the presence of EDTA (upper) or subjected to RNase treatment prior to centrifugation (lower) and then fractionated on a 15–45% sucrose gradient. The fractions were analyzed by western with the anti-Flag antibody M2 (F-F).

 
Phosphorylation has no effect on the subcellular localization of FMRP
To determine whether or not the phosphorylation of FMRP affects its subcellular localization of FMRP, we stained WT, Ala and Asp Flag-FMRP expressing L-M(TK-) (Fig. 8). Neither the Ala nor the Asp substitution at residue 499 had any effect on the characteristic diffuse cytoplasmic staining of FMRP. These data also demonstrate the lack of granules of FMRP, further strengthening our conclusion that FMRP is not aggregating in these cells.



View larger version (46K):
[in this window]
[in a new window]
 
Figure 8. Phosphorylation does not affect the intracellular localization of Flag-FMRP. WT, Ala and Asp Flag-FMRP transfected cell lines were plated on chamber slides, stained with Mab1a anti-FMRP antibody and visualized with Alexia Flour 488 goat anti-mouse secondary.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Evidence has been presented suggesting FMRP is a negative regulator of translation (2123). FMRP isolated from brain associates with a limited number of mRNAs (12,14) and is found associated with ribosomes at the base of dendritic spines (41). Taken together, these data suggest the hypothesis that FMRP-bound mRNAs may be positioned on stalled ribosomes awaiting a signal to resume translation in order to supply the bolus of locally synthesized proteins required for synaptic plasticity. In this work, we probed what that signal might be. We show here that mammalian FMRP is phosphorylated on a short sequence N-terminal to the RGG box with primary phosphorylation occurring at serine 499. In pulse-chase experiments, we find FMRP phosphorylated 2–4 h after synthesis and that phosphorylation at position 499 does not affect the half-life of FMRP. Finally, dephosphorylation of FMRP appears to release translation inhibition as indicated by its ability to be freely run-off ribosomes in the presence of sodium azide.

Although phosphorylation of Drosophila dFxr was shown in vitro to enhance binding to homopolymers of RNA (30), we find that in vivo, phosphorylation of mammalian FMRP does not significantly affect the amount or identities of individual RNAs immunoprecipitated with FMRP. This difference between Drosophila and mammalian FMRP may be due to the fact that a single ortholog of FMR1 is present in Drosophila while, in mammals, three paralogs exist with greater than 60% identity (42). Thus, the Drosophila results could be true for the mammalian FXR1 and FXR2 proteins but not for FMRP. Secondly, the Drosophila results were performed in vitro in a cell free approach that may or may not truly reflect the in vivo conditions of our experiments. Third, it is possible that the Drosophila results indeed occur with purified mammalian FMRP, but under the physiological conditions of our study, the RNP complex itself was examined rather than FMRP alone, potentially masking any direct effect of phosphorylation of FMRP alone. However, this possibility would likely be of little physiologic consequence since FMRP appears rarely, if ever, as a free protein in mammalian cells (20).

Serine 499 is responsible for >85% of the phosphorylation of FMRP in cells (Fig. 2B), although both PIS and MS/MS and our labeling experiments of the Asp-substituted FMRP identify at least one other phosphorylated residue in FMRP. FMRP may be phosphorylated in a hierarchical fashion (43) where secondary phosphorylation only occurs subsequent to phosphorylation of serine 499. This possibility is supported by the observation that an aspartic acid at 499 mimics phosphoserine and triggers secondary phosphorylation (Fig. 2C). In pulse-chase experiments, we found that FMRP was phosphorylated 2–4 h after synthesis. Since Fmr protein is insoluble upon isoelectric focusing, 2D analysis to quantify the exact percentage of phosphorylated FMRP was not possible. Experiments to raise phospho-FMRP specific antibodies are ongoing.

Siomi et al. (30) used CK2 to in vitro phosphorylate dFxr. Indeed, serine 499 lies within predicted CK2 and GSK3 consensus sequences (expasy.cbr.nrc.ca/cgi-bin/scanprosite) and we have observed that both kinases phosphorylate WT FMRP and fail to phosphorylate the alanine-substituted FMRP in vitro (data not shown). However, whether or not these are the major in vivo kinases remains to be established.

To examine whether phosphorylation played a role in translation regulation, we performed ribosome run-off experiments using sodium azide to inhibit translation initiation (20,39,40). We were unable to use pactamycin, a specific inhibitor of translation elongation (44), as it is no longer available, and puromycin, a polypeptide chain terminator, that requires in vitro NaCl concentration that disrupts the FMRP-polyribosome association (39). Although incubation with sodium azide is pleiotropic, in our experiments it did not change the intracellular architecture of the cells based on electron microscopy (data not shown). Translation run-off showed that a fraction of phosphorylated FMRP is found associated with apparently stalled ribosomes while unphos-phorylated FMRP is associated only with actively translating ribosomes. It should be noted that a recent study suggests FMRP does not associate with polyribosomes in brain lysates or in synaptoneurosomes (45). However, the presence of deoxycholate in those experiments would have altered the sedimentation properties of FMRP—stripping it from the ribosomes (15). Thus, deoxycholate is not typically used to examine FMRP polyribosomes (15,18,20).

Local protein synthesis in dendrites is thought to be required for synaptic plasticity and information storage (46) involving a number of kinases and phosphatases (4751). How this local protein synthesis is regulated is poorly understood, but one hypothesis is that selected messages are stored at the base of dendritic spines in association with stalled ribosomes and following the appropriate signal, these messages immediately are translated, providing a bolus of the locally required protein(s). The data reported above fit well into this hypothesis. FMRP is found associated with a subset of messages (12,14), is found at the base of dendritic spines (41), and is a translational repressor (21,22). We suggest, based upon the experiments above, that the FMRP associated with stalled ribosomes is serine 499 phosphorylated and that a possible signal to trigger translation of the associated messages may be the dephos-phorylation of FMRP. Thus, the absence of FMRP may lead to cognitive deficits by the dysregulation of the local translation of key mRNAs at the base of dendritic spines.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Cell lines and DNA constructs
Transfected L-M(TK-) cells were maintained and characterized as described (10). Site-directed mutagenesis was performed on either the Flag-Fmr1 in the RSV.gpt[5] vector or DS-Red-Fmr1 using the QuickChange XL site-directed mutagenesis kit (Stratagene). The alanine substitution at 499 was introduced by using the following primers: forward GCATCAAATGCTGCTGAAACAGAATCTGACCACA GAGAC; reverse GTCTCTGTGGTCAGATTCTGTTTCAGCAGCATTTGATGC. The aspartic acid at 499 was introduced using the following primers: forward GCATCAAATGCTGACGAAACAGAATCTGACCACAGAGAC; reverse GTCTCT GTGGTCAGATTCTGTTTCGTCAGCATTTGATGC.

Metabolic labeling
Cells 5x105–106 were plated in 60 mm tissue culture dishes. The following day, the cells were rinsed twice in either phosphate-free or methionine-free DMEM (GibcoBRL) and labeled in DMEM supplemented with 5–10% dialyzed FCS and 1 mCi/ml of [32P]orthophosphoric acid (NEN) for 10 h or in 250 µCi/ml of [35S]methionine (Amersham) for 30 min. If the cells were being ‘chased’, they were incubated in pre-warmed complete media supplemented with 15 µg/ml of methionine and harvested at the appropriate chase time point. Labeled cells were washed twice in ice-cold PBS and lysed in 1 ml per dish of lysis buffer (50 mM Tris–HCl, 300 mM NaCl, 30 mM EDTA, 0.5% Triton X-100, pH 7.6) with protease-inhibitor tablets (Roche) and phosphatase inhibitors (Sigma). All subsequent manipulations were carried out at 4°C or on ice as described (10). The lysates were sequentially pre-cleared for 1 h with 100 µl per sample of protein G agarose (Boehringer Mannheim) and then for 1–2 h with an irrelevant antibody (16-1-11N—American Type Culture Collection). The lysate was then immunoprecipitated for 2–3 h with 50 µl of the anti-Flag M2 matrix. After immunoprecipitation, the matrix was washed and eluted as described (10). The proteins were resolved on either a 6 or a 7.5% SDS polyacrylamide gel and either fixed (10% acetic acid, 30% methanol) for 20–30 min before drying (75°C for 45 min) or transferred to nitrocellulose (Schleicher and Schuell) or PVDF membrane (Amersham) for subsequent autoradiography and/or western blotting.

Antibodies and western blotting
The anti-FMRP antibody, MAb1a, was obtained from Dr Jean-Louis Mandel at the Institute of Genetics in llkirch, France and the S6 antibody was obtained from Cell Signalling Technology and used per manufacturer's instructions. The anti-Flag M2 antibody was obtained from Sigma and used at 0.25 µg/ml. Antibody reactivity was visualized using either an anti-mouse HRP conjugate (KPL) or an anti-rabbit HRP conjugate (Amersham) and developed with ECL (Amersham).

Phosphoamino acid analysis
Phosphoamino acid analysis was performed with modifications to the method described (52). The FMRP band was cut from the membrane and hydrolyzed in 6 M HCl at 110°C for 1 h. The samples were spotted onto TLC plates that were electrophoresed at pH 1.9 (horizontal) and then at pH 3.5 (vertical). The plates were visualized via phosphoimager.

Large-scale purification of FMRP
Approximately 109 Flag-FMRP-expressing L-M(TK-) cells were harvested and immunoprecipitated as described (10). The Flag-mRNP was eluted by resuspending the matrix in 0.3 ml of 1xSDS sample buffer prepared without glycerol, B-mercaptoethanol or bromophenol and then boiled. The eluted FMRP was purified from associated proteins by re-immunoprecipitating with the 7G1-1 antibody-coupled to protein A sepharose (12) overnight. The matrix was washed twice and boiled in 1x sample buffer. The proteins were resolved on a 7.5% SDS polyacrylamide gel and stained with Coomassie Brilliant blue to visualize the purified FMRP.

FMRP was isolated from mouse brain by asphyxiating 20 adult C57Bl/6 mice with CO2, harvesting the brains and preparing lysate as described (12). The clarified supernatant was immunoprecipitated with an FMRP-immunoprecipitating antibody, 6G2, which will be described elsewhere (S. Ceman, manuscript in preparation). The immunoprecipitated material was re-immunoprecipitated with 7G1-1 as described above. The purified FMRP was identified by Coomassie Brilliant blue staining and sent to the Harvard Microchemical facility where the tryptic peptides were analyzed using microcapillary reverse-phase HPLC nano-electrospray tandem mass spectrometry (uLC/MS/MS) on a Finnigan LCQ DECA quadrupole ion trap mass spectrometer.

Precursor ion scan mass spectrometry
The FMRP band was excised, washed and digested with sequencing grade trypsin (Promega) overnight. The nanocolumn was prepared and operated essentially as previously described (53). Each nano-column fraction was analyzed separately on an API 3000 triple quadrupole (PE-Sciex, Ontario, Canada) with a nanoelectrospray source installed (Protana, Denmark). For each fraction, a Q1 scan was collected in both the positive and negative ion modes (data not shown). For precursor ion scans, the instrument was set to scan for negative ions, and the collision energy and collision gas were optimized to efficiently produce the desired phosphate (PO3-) fragment ion in Q2. The instrument monitored Q3 for m/z–79 while Q1 scanned through m/z 400 to 2000.

Microarray analysis of FMRP-associated RNAs
L-M(TK-) cells expressing the empty expression vector (VC), Flag-FMRP (WT), an alanine at position 499 (Ala) or an aspartic acid at position 499 (Asp) were grown to ~2x108 cells. The cells were lysed in RNAse-free lysis buffer [as above+80 units of RNasin/ml (Promega)] and pre-cleared as described above. All manipulations were carried out at 4°C. Before immunoprecipitation, the anti-Flag M2-coupled-matrix (Sigma) was pre-blocked with 0.12 mg/ml of BSA (NEB), glycogen (Ambion) and tRNA (Gibco) for 1 h. The lysates were then immunoprecipitated for 3 h with 50 µl of the pre-blocked M2 matrix followed by 3–10 min washes. The last wash contained 30 units of RNAse-free DNAse (Promega). The immunoprecipitates were resuspended in 150 µl of nuclease-free water (Ambion) plus 0.1 mg of proteinase K (Sigma) and incubated at 37°C for 15 min. The reaction was phenol/chloroform extracted and ethanol-precipitated to isolate associated RNAs. Immunoprecipitated RNAs and pre-cleared inputs were prepared for genechip analysis on the MG-U74Av2 chips using standard Affymetrix protocols.

Data analysis was performed using Affymetrix Microarray Suite 5.0 and Spotfire DecisionSite 7.0. A specific transcript was considered to be an FMRP ligand if it met the following criteria: (i) the transcript was ‘present’ by Affymetrix absolute analysis algorithms in both replicates of the FMRP IP; (ii) it was ‘increased’ in each FMRP IP compared to each VC IP (four total comparisons); and (iii) it was ‘increased’ when compared to the pre-cleared input. Affymetrix comparison analyses as well as unpaired t-tests were used to compare the WT IP to the Ala IP and to the Asp IP.

Linear sucrose gradient fractionation
Transfected murine fibroblast L-M(TK-) cells were plated at 1.25–1.39x107 cells/25 mls in T225 flasks two days before harvesting. For analysis of the polyribosomes, the cells were treated for 15 min with cycloheximide (100 µg/ml) as described (20). For the run-off experiments, the cells were treated for 30 min with 20–25 mM sodium azide. Linear 15–45% sucrose gradients containing 100 mM KCl, 20 mM Tris (pH 7.5), 5 mM MgCl2 were prepared using a gradient maker (BioComp). Cells were trypsinized, washed in PBS and lysed in the buffer described above supplemented with 0.3% IGEPAL CA-630 (Sigma). In the EDTA treatment experiments, cell lysis was performed in the presence of 30 mM EDTA, and fractionation was performed in the presence of 5 mM EDTA. For the RNase experiments, prior to centrifugation, lysates were treated with 300 µg/ml RNase A at 30°C for 15 min. Postnuclear supernatants were overlayed on the gradient and centrifuged for 75 min at 188 000g at 4°C. Each gradient was fractionated into 1 ml fractions by bottom displacement using a gradient fractionator (Isco) with the ribosomal profile monitored at OD254. Prior to SDS-PAGE analysis, 40 µl of each fraction was denatured in 1x Laemmli buffer. Westerns were quantified using densitometry and t-tests were performed on each comparison to determine significance.

Fluorescence microscopy
WT, Ala or Asp Flag-FMRP expressing L-M(TK-) cells were plated on chamber slides (Lab-Tek) overnight. The cells were washed twice with PBS, and fixed in 4% paraformaldehyde for 20 min at room temperature. After two PBS washes the cells were then permeabilized with 0.1% triton X for 5 min at room temperature. The cells were then blocked in 10% fetal calf serum at 37°C for 1 h. Anti-FMRP MAb1a primary antibody was applied for 2 h at 37°C. The slides were then washed 3x5 min in PBS and subjected to secondary staining with Alexa Fluor 488 goat anti-mouse antibody (Molecular Probes).


    SUPPLEMENTARY MATERIAL
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Supplementary Material is available at HMG Online.


    ACKNOWLEDGEMENTS
 
We thank Olga Stuchlik for performing the in-gel digests, Enrique Torre for providing the DsRed-Fmr1 construct and Keith Wilkinson for pointing out the potential PEST sequence. This work was supported by HD41591-01 (SC), HD20521 (S.T.W.) and HD35576 (S.T.W.). The Emory Microchemical Facility is supported by NIH-NCRR grants 02878, 12878 and 13948.


    FOOTNOTES
 
* To whom correspondence should be addressed at: Room 305E Whitehead Building, Department of Human Genetics, 615 Michael St, Atlanta, GA 30322, USA. Tel: +1 4047275979; Fax: +1 4047273949; E-mail: swarren{at}emory.edu Back

{dagger} The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors. Back

{ddagger} Present address:

Department of Cell and Structural Biology, University of Illinois, Urbana, IL 61801, USA. Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 

  1. O'Donnell, W.T. and Warren, S.T. (2002) A decade of molecular studies of fragile X syndrome. Annu. Rev. Neurosci., 25, 315–338.[Medline]

  2. Lubs, J.A. (1969) A marker X chromosome. Am. J. Hum. Genet., 21, 231–244.[Web of Science][Medline]

  3. Sutherland, G.R., Jacky, P.B., Baker, E. and Manuel, A. (1983) Heritable fragile sites on human chromosomes. X. New folate-sensitive fragile sites: 6p23, 9p21, 9q32, 11q23. Am. J. Hum. Genet., 35, 432–437.[Web of Science][Medline]

  4. Verkerk, A.J.M.H., Pieretti, M., Sutcliffe, J.S., Fu, Y.-H., Kuhl, D.P.A., Pizutti, A., Reiner, O., Richards, S., Victoria, M.F., Zhang, F. et al. (1991) Identification of a gene (FMR-1) containing a CGG repeat coincident with a breakpoint cluster region exhibiting length variation in fragile X syndrome. Cell, 65, 905–914.[CrossRef][Web of Science][Medline]

  5. Fu, Y.-H., Kuhl, D.P., Pizzuti, A., Pieretti, M., Sutcliffe, J.S., Richards, S., Verkerk, A.J.M.H., Holden, J.J.A., Fenwick, R.G., Jr, Warren, S.T. et al. (1991) Variation of the CGG repeat at the fragile X site results in genetic instability: resolution of the Sherman paradox. Cell, 67, 1047–1058.[CrossRef][Web of Science][Medline]

  6. Siomi, H., Siomi, M.C., Nussbaum, R.L. and Dreyfuss, G. (1993) The protein product of the fragile X gene, FMR1, has characteristics of an RNA binding protein. Cell, 74, 291–298.[CrossRef][Web of Science][Medline]

  7. Siomi, H., Matunis, M.J., Michael, W.M. and Dreyfuss, G. (1993) The pre-mRNA binding K protein contains a novel evolutionarily conserved motif. Nucl. Acids Res., 21, 1193–1198.[Abstract/Free Full Text]

  8. Ashley, C.T., Wilkinson, K.D., Reines, D. and Warren, S.T. (1993b) FMR1 protein: conserved RNP family domains and selective RNA binding. Science, 262, 563–566.[Abstract/Free Full Text]

  9. Brown, V., Small, K., Lakkis, L., Feng, Y., Gunter, C., Wilkinson, K.D. and Warren, S.T. (1998) Purified recombinant FMRP exhibits selective RNA binding as an intrinsic property of the fragile X mental retardation protein. J. Biol. Chem., 273, 15521–15527.[Abstract/Free Full Text]

  10. Ceman, S., Brown, V. and Warren, S.T. (1999) Isolation of an FMRP-associated messenger ribonucleoprotein particle and identification of nucleolin and the fragile X-related proteins as components of the complex. Mol. Cell. Biol., 19, 7925–7932.[Abstract/Free Full Text]

  11. Schaeffer, C., Bardoni, B., Mandel, J.L., Ehresmann, B., Ehresmann, C. and Moine, H. (2001) The fragile X mental retardation protein binds specifically to its mRNA via a purine quartet motif. EMBO J, 20, 4803–4813.[CrossRef][Web of Science][Medline]

  12. Brown, V., Jin, P., Ceman, S., Darnell, J.C., O'Donnell, W.T., Tenenbaum, S.A., Jin, X., Feng, Y., Wilkinson, K., Keene, J.D. et al. (2001) Microarray identification of FMRP-associated brain mRNAs and altered mRNA translational profiles in fragile X syndrome. Cell, 107, 477–487.[CrossRef][Web of Science][Medline]

  13. Darnell, J.C., Jensen, K.B., Jin, P., Brown, V., Warren, S.T. and Darnell, R.B. (2001) Fragile X mental retardation protein targets G quartet mRNAs important for neuronal function. Cell, 107, 489–499.[CrossRef][Web of Science][Medline]

  14. Miyashiro, K., Beckel-Mitchener, A., Purk, T., Becker, K., Barret, T., Liu, L., Carbonetto, S., Weiler, I., Greenough, W. and Eberwine, J. (2003) RNA cargoes associating with FMRP reveal deficits in cellular functioning in Fmr1 null mice. Neuron, 37, 417–431.[CrossRef][Web of Science][Medline]

  15. Khandjian, E.W., Corbin, F., Woerly, S. and Rousseau, F. (1996) The fragile X mental retardation protein is associated with ribosomes. Nat. Genet., 12, 91–93.[CrossRef][Web of Science][Medline]

  16. Eberhart, D.E., Malter, H.E., Feng, Y. and Warren, S.T. (1996) The fragile X mental retardation protein is a ribonucleoprotein containing both nuclear localization and nuclear export signals. Hum. Mol. Genet., 5, 1083–1091.[Abstract/Free Full Text]

  17. Tamanini, F., Meijer, N., Verheij, C., Willems, P.J., Galjaard, H., Oostra, B.A. and Hoogeveen, A.T. (1996) FMRP is associated to the ribosomes via RNA. Hum. Mol. Genet., 5, 809–813.[Abstract/Free Full Text]

  18. Corbin, F., Bouillon, M., Fortin, A., Morin, S., Rousseau, F. and Khandjian, E.W. (1997) The fragile X mental retardation protein is associated with poly (A)+ mRNA in actively translating polyribosomes. Hum. Mol. Genet., 6, 1465–1472.[Abstract/Free Full Text]

  19. De Boulle, K., Verkerk, A.J.M.H, Reyniers, E., Vits, L., Hendrickx, J., Van Roy, B., Van den Bos, F., de Graaff, E., Oostra, B.A., Willems, P.J. (1993) A point mutation in the FMR-1 gene associated with fragile X mental retardation. Nat. Genet., 3, 31–35.[CrossRef][Web of Science][Medline]

  20. Feng, Y., Absher, D., Eberhart, D.E., Brown, V., Malter, H. and Warren, S.T. (1997) FMRP associates with polyribosomes as an mRNP, and the I304N mutation of severe fragile X syndrome abolishes this association. Mol. Cell, 1, 109–118.[CrossRef][Web of Science][Medline]

  21. Laggerbauer, B., Ostareck, D., Keidel, E.M., Ostareck-Lederer, A. and Fischer, U. (2001) Evidence that fragile X mental retardation protein is a negative regulator of translation. Hum. Mol. Genet., 10, 329–338.[Abstract/Free Full Text]

  22. Li, Z., Zhang, Y., Ku, L., Wilkinson, K.D., Warren, S.T. and Feng, Y. (2001) The fragile X mental retardation protein inhibits translation via interacting with mRNA. Nucl. Acids Res., 29, 2276–2283.[Abstract/Free Full Text]

  23. Mazroui, R., Huot, M., Tremblay, S., Filion, C., Labelle, Y. and Khandjian, E. (2002) Trapping of messenger RNA by fragile X mental retardation protein into cytoplasmic granules induces translation repression. Hum. Mol. Genet., 11, 3007–3017.[Abstract/Free Full Text]

  24. Wang, L.L., Richard, S. and Shaw, A.S. (1995) P62 association with RNA is regulated by tyrosine phosphorylation. J. Biol. Chem., 270, 2010–2013.[Abstract/Free Full Text]

  25. Idriss, H., Kumar, A., Casas-Finet, J.R., Guo, H., Damuni, Z. and Wilson, S.H. (1994) Regulation of in vitro nucleic acid strand annealing activity of heterogeneous nuclear ribonucleoprotein protein A1 by reversible phosphorylation. Biochem., 33, 11382–11390.[CrossRef][Medline]

  26. Municio, M.M., Lozano, J., Sanchez, P., Moscat, J. and Diaz-Meco, M.T. (1995) Identification of heterogeneous ribonucleoprotein A1 as a novel substrate for protein kinase C zeta. J. Biol. Chem., 270, 15884–15891.[Abstract/Free Full Text]

  27. Venables, J.P., Elliott, D.J., Makarova, O.V., Makarov, E.M., Cooke, H.J. and Eperon, I.C. (2000) RBMY, a probable human spermatogenesis factor, and other hnRNP G proteins interact with Tra2beta and affect splicing. Hum. Mol. Genet., 9, 685–694.[Abstract/Free Full Text]

  28. Spirin, A.S. (1996) Masked and Translatable Messenger Ribonucleoproteins in Higher Eukaryotes. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

  29. Jans, D.A. and Hubner, S. (1996) Regulation of protein transport to the nucleus: central role of phosphorylation. Phys. Rev., 76, 651–682.[Abstract/Free Full Text]

  30. Siomi, M., Higashijima, K., Ishizuka, A. and Siomi, H. (2002) Casein kinase II phosphorylates the fragile X mental retardation protein and modulates its biological properties. Mol. Cell. Biol., 22, 8438–8447.[Abstract/Free Full Text]

  31. Carr, S., Huddleston, M.J. and Annan, R.S. (1996) Selective detection and sequencing of phosphopeptides at the femtomole level by mass spectrometry. Anal. Biochem., 239, 180–192.[CrossRef][Web of Science][Medline]

  32. Casanova, J., Breitfeld, P., Ross, S. and Mostov, K. (1990) Phosphorylation of the polymeric immunoglobulin receptor required for its efficient transcytosis. Science, 248, 742–745.[Abstract/Free Full Text]

  33. Rogers, S., Wells, R. and Rechsteiner, M. (1986) Amino acid sequences common to rapidly degraded proteins: the PEST hypothesis. Science, 234, 364–368.[Abstract/Free Full Text]

  34. Salmeron, A., Janzen, J., Soneji, Y., Bump, N., Kamens, J., Allen, H. and Ley, S.C. (2001) Direct phosphorylation of NF-kappaB1 p105 by the IkappaB kinase complex on serine 927 is essential for signal-induced p105 proteolysis. J. Biol. Chem., 276, 22215–22222.[Abstract/Free Full Text]

  35. Turnell, A.S., Grand, R.J., Gorbea, C., Zhang, X., Wang, W., Mymryk, J.S. and Gallimore, P.H. (2000) Regulation of the 26S proteasome by adenovirus E1A. EMBO J., 19, 4759–4773.[CrossRef][Web of Science][Medline]

  36. Penrose, K.J. and McBride, A.A. (2000) Proteasome-mediated degradation of the papillomavirus E2-TA protein is regulated by phosphorylation and can modulate viral genome copy number. J. Virol., 74, 6031–6038.[Abstract/Free Full Text]

  37. Hericourt, F., Blanc, S., Redeker, V. and Jupin, I. (2000) Evidence for phosphorylation and ubiquitinylation of the turnip yellow mosaic virus RNA-dependent RNA polymerase domain expressed in a baculovirus-insect cell system. Biochem. J., 349, 417–425.[CrossRef][Web of Science][Medline]

  38. Ostareck-Lederer, A., Ostareck, D., Cans, C., Neubauer, G., Bomsztyk, K., Superti-Furga, G. and Hentze, M. (2002) c-Src-mediated phosphorylation of hnRNP K drives translational activation of specifically silenced mRNAs. Mol. Cell. Biol., 22, 4535–4543.[Abstract/Free Full Text]

  39. Nelson, R.J., Ziegelhoffer, T., Nicolet, C., Werner-Washburne, M. and Craig, E.A. (1992) The translation machinery and 70 kd heat shock protein cooperate in protein synthesis. Cell, 71, 97–105.[CrossRef][Web of Science][Medline]

  40. Jefferies, H.B.J., Thomas, G. and Thomas, G. (1994) Elongation factor-1{alpha} mRNA is selectively translated following mitogenic stimulation. J. Biol. Chem., 269, 4367–4372.[Abstract/Free Full Text]

  41. Feng, Y., Gutekunst, C.-A., Eberhart, D.E., Yi, H., Warren, S.T. and Hersch, S.M. (1997) Fragile X mental retardation protein: nucleocytoplasmic shuttling and association with somatodendritic ribosomes. J. Neurosci., 17, 1539–1547.[Abstract/Free Full Text]

  42. Morales, J., Hiesinger, P., Schroeder, A., Kume, K., Verstreken, P., Jackson, F., Nelson, D. and Hassan, B. (2002) Drosophila fragile X protein, DFXR, regulates neuronal morphology and function in the brain. Neuron, 34, 961–972.[CrossRef][Web of Science][Medline]

  43. Cohen, P. and Frame, S. (2001) The renaissance of GSK3. Nat. Rev. Mol. Cell Biol., 2, 769–776.[CrossRef][Web of Science][Medline]

  44. Brodersen, D.E., Clemons, W.M.J., Carter, A.P., Morgan-Warren, R.J., Wimberly, B.T. and Ramakrishnan, V. (2000) The structural basis for the action of the antibiotics tetracycline, pactamycin, and hygromycin B on the 30S ribosomal subunit. Cell, 103, 1143–1154.[CrossRef][Web of Science][Medline]

  45. Zalfa, F., Giorgi, M., Primerano, B., Moro, A., Di Penta, A., Reis, S., Oostra, B. and Bagni, C. (2003) The fragile X syndrome protein FMRP associates with BC1 RNA and regulates the translation of specific mRNAs at synapses. Cell, 112, 317–327.[CrossRef][Web of Science][Medline]

  46. Steward, O. and Schuman, E. (2001) Protein synthesis at synaptic sites on dendrites. Annu. Rev. Neurosci., 24, 299–325.[CrossRef][Web of Science][Medline]

  47. Trivier, E., De Cesare, D., Jacquot, S., Pannetier, S., Zackai, E., Young, I., Mandel, J.L., Sassone-Corsi, P. and Hanauer, A. (1996) Mutations in the kinase Rsk-2 associated with Coffin-Lowry syndrome. Nature, 384, 567–570.[CrossRef][Medline]

  48. Ulloa, L., Diaz-Nido, J. and Avila, J. (1993) Depletion of casein kinase II by antisense oligonucleotide prevents neuritogenesis in neuroblastoma cells. EMBO J., 12, 1633–1640.[Web of Science][Medline]

  49. Kao, H., Song, H., Porton, B., Ming, G., Hoh, J., Abraham, M., Czernik, A., Pieribone, V., Poo, M. and Greengard, P. (2002) A protein kinase A-dependent molecular switch in synapsins regulates neurite outgrowth. Nat. Neurosci., 5, 431–437.[Web of Science][Medline]

  50. Winder, D. and Sweatt, J. (2001) Roles of serine/threonine phosphatases in hippocampal synaptic plasticity. Nat. Rev. Neurosci., 2, 461–474.[CrossRef][Web of Science][Medline]

  51. Strack, S. (2002) Overexpression of the protein phosphatase 2A regulatory subunit B gamma promotes neuronal differentiation by activating the MAP kinase (MAPK) cascade. J. Biol. Chem., 277, 41525–41532.[Abstract/Free Full Text]

  52. van der Geer, P. and Hunter, T. (1994) Phosphopeptide mapping and phosphoamino acid analysis by electrophoresis and chromatography on thin-layer cellulose plates. Electrophoresis, 15, 544–554.[CrossRef][Web of Science][Medline]

  53. Neubauer, G. and Mann, M. (1999) Mapping phosphorylation sites of gel-isolated proteins by nanoelectrospray tandem mass spectrometry: potentials and limitations. Anal. Chem., 71, 235–242.[Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
NeuroscientistHome page
B. E. Pfeiffer and K. M. Huber
The State of Synapses in Fragile X Syndrome
Neuroscientist, October 1, 2009; 15(5): 549 - 567.
[Abstract] [PDF]


Home page
J. Neurosci.Home page
J. Zhong, S.-C. Chuang, R. Bianchi, W. Zhao, H. Lee, A. A. Fenton, R. K. S. Wong, and H. Tiedge
BC1 Regulation of Metabotropic Glutamate Receptor-Mediated Neuronal Excitability
J. Neurosci., August 12, 2009; 29(32): 9977 - 9986.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
A.-M. J. Cziko, C. T. McCann, I. C. Howlett, S. A. Barbee, R. P. Duncan, R. Luedemann, D. Zarnescu, K. E. Zinsmaier, R. R. Parker, and M. Ramaswami
Genetic Modifiers of dFMR1 Encode RNA Granule Components in Drosophila
Genetics, August 1, 2009; 182(4): 1051 - 1060.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
A. Cheever and S. Ceman
Phosphorylation of FMRP inhibits association with Dicer
RNA, March 1, 2009; 15(3): 362 - 366.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Fahling, R. Mrowka, A. Steege, K. M. Kirschner, E. Benko, B. Forstera, P. B. Persson, B. J. Thiele, J. C. Meier, and H. Scholz
Translational Regulation of the Human Achaete-scute Homologue-1 by Fragile X Mental Retardation Protein
J. Biol. Chem., February 13, 2009; 284(7): 4255 - 4266.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
J. D. Richter and E. Klann
Making synaptic plasticity and memory last: mechanisms of translational regulation
Genes & Dev., January 1, 2009; 23(1): 1 - 11.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M.-C. Didiot, Z. Tian, C. Schaeffer, M. Subramanian, J.-L. Mandel, and H. Moine
The G-quartet containing FMRP binding site in FMR1 mRNA is a potent exonic splicing enhancer
Nucleic Acids Res., September 1, 2008; 36(15): 4902 - 4912.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
U. Narayanan, V. Nalavadi, M. Nakamoto, G. Thomas, S. Ceman, G. J. Bassell, and S. T. Warren
S6K1 Phosphorylates and Regulates Fragile X Mental Retardation Protein (FMRP) with the Neuronal Protein Synthesis-dependent Mammalian Target of Rapamycin (mTOR) Signaling Cascade
J. Biol. Chem., July 4, 2008; 283(27): 18478 - 18482.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Piazzon, F. Rage, F. Schlotter, H. Moine, C. Branlant, and S. Massenet
In Vitro and in Cellulo Evidences for Association of the Survival of Motor Neuron Complex with the Fragile X Mental Retardation Protein
J. Biol. Chem., February 29, 2008; 283(9): 5598 - 5610.
[Abstract] [Full Text] [PDF]


Home page
Sci SignalHome page
J. A. Ronesi and K. M. Huber
Metabotropic Glutamate Receptors and Fragile X Mental Retardation Protein: Partners in Translational Regulation at the Synapse
Sci. Signal., February 5, 2008; 1(5): pe6 - pe6.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Iacoangeli, T. S. Rozhdestvensky, N. Dolzhanskaya, B. Tournier, J. Schutt, J. Brosius, R. B. Denman, E. W. Khandjian, S. Kindler, and H. Tiedge
On BC1 RNA and the fragile X mental retardation protein
PNAS, January 15, 2008; 105(2): 734 - 739.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
H. Wang, J. B. Dictenberg, L. Ku, W. Li, G. J. Bassell, and Y. Feng
Dynamic Association of the Fragile X Mental Retardation Protein as a Messenger Ribonucleoprotein between Microtubules and Polyribosomes
Mol. Biol. Cell, January 1, 2008; 19(1): 105 - 114.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
U. Narayanan, V. Nalavadi, M. Nakamoto, D. C. Pallas, S. Ceman, G. J. Bassell, and S. T. Warren
FMRP Phosphorylation Reveals an Immediate-Early Signaling Pathway Triggered by Group I mGluR and Mediated by PP2A
J. Neurosci., December 26, 2007; 27(52): 14349 - 14357.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. L. Hayashi, B. S. S. Rao, J.-S. Seo, H.-S. Choi, B. M. Dolan, S.-Y. Choi, S. Chattarji, and S. Tonegawa
Inhibition of p21-activated kinase rescues symptoms of fragile X syndrome in mice
PNAS, July 3, 2007; 104(27): 11489 - 11494.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
R. S. Muddashetty, S. Kelic, C. Gross, M. Xu, and G. J. Bassell
Dysregulated Metabotropic Glutamate Receptor-Dependent Translation of AMPA Receptor and Postsynaptic Density-95 mRNAs at Synapses in a Mouse Model of Fragile X Syndrome
J. Neurosci., May 16, 2007; 27(20): 5338 - 5348.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
B. E. Pfeiffer and K. M. Huber
Fragile X Mental Retardation Protein Induces Synapse Loss through Acute Postsynaptic Translational Regulation
J. Neurosci., March 21, 2007; 27(12): 3120 - 3130.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
C. M. Spencer, E. Serysheva, L. A. Yuva-Paylor, B. A. Oostra, D. L. Nelson, and R. Paylor
Exaggerated behavioral phenotypes in Fmr1/Fxr2 double knockout mice reveal a functional genetic interaction between Fragile X-related proteins
Hum. Mol. Genet., June 15, 2006; 15(12): 1984 - 1994.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
N. Dolzhanskaya, G. Merz, J. M. Aletta, and R. B. Denman
Methylation regulates the intracellular protein-protein and protein-RNA interactions of FMRP.
J. Cell Sci., May 1, 2006; 119(Pt 9): 1933 - 1946.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
L. Davidovic, E. Bechara, M. Gravel, X. H. Jaglin, S. Tremblay, A. Sik, B. Bardoni, and E. W. Khandjian
The nuclear MicroSpherule protein 58 is a novel RNA-binding protein that interacts with fragile X mental retardation protein in polyribosomal mRNPs from neurons
Hum. Mol. Genet., May 1, 2006; 15(9): 1525 - 1538.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
A. Stetler, C. Winograd, J. Sayegh, A. Cheever, E. Patton, X. Zhang, S. Clarke, and S. Ceman
Identification and characterization of the methyl arginines in the fragile X mental retardation protein Fmrp
Hum. Mol. Genet., January 1, 2006; 15(1): 87 - 96.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
H. Wang, A. Iacoangeli, D. Lin, K. Williams, R. B. Denman, C. U.T. Hellen, and H. Tiedge
Dendritic BC1 RNA in translational control mechanisms
J. Cell Biol., December 5, 2005; 171(5): 811 - 821.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Garnon, C. Lachance, S. Di Marco, Z. Hel, D. Marion, M. C. Ruiz, M. M. Newkirk, E. W. Khandjian, and D. Radzioch
Fragile X-related Protein FXR1P Regulates Proinflammatory Cytokine Tumor Necrosis Factor Expression at the Post-transcriptional Level
J. Biol. Chem., February 18, 2005; 280(7): 5750 - 5763.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Aschrafi, B. A. Cunningham, G. M. Edelman, and P. W. Vanderklish
The fragile X mental retardation protein and group I metabotropic glutamate receptors regulate levels of mRNA granules in brain
PNAS, February 8, 2005; 102(6): 2180 - 2185.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Miyashiro and J. Eberwine
Fragile X syndrome: (What's) lost in translation?
PNAS, December 14, 2004; 101(50): 17329 - 17330.
[Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
I. J. Weiler, C. C. Spangler, A. Y. Klintsova, A. W. Grossman, S. H. Kim, V. Bertaina-Anglade, H. Khaliq, F. E. de Vries, F. A. E. Lambers, F. Hatia, et al.
From the Cover: Fragile X mental retardation protein is necessary for neurotransmitter-activated protein translation at synapses
PNAS, December 14, 2004; 101(50): 17504 - 17509.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
L. A. Gabel, S. Won, H. Kawai, M. McKinney, A. M. Tartakoff, and J. R. Fallon
Visual Experience Regulates Transient Expression and Dendritic Localization of Fragile X Mental Retardation Protein
J. Neurosci., November 24, 2004; 24(47): 10579 - 10583.
[Abstract] [Full Text] [PDF]


Home page
NeuroscientistHome page
H. Wang and H. Tiedge
Translational Control at the Synapse
Neuroscientist, October 1, 2004; 10(5): 456 - 466.
[Abstract] [PDF]


Home page
J. Neurosci.Home page
G. Stefani, C. E. Fraser, J. C. Darnell, and R. B. Darnell
Fragile X Mental Retardation Protein Is Associated with Translating Polyribosomes in Neuronal Cells
J. Neurosci., August 18, 2004; 24(33): 7272 - 7276.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
E. J. Mientjes, R. Willemsen, L. L. Kirkpatrick, I. M. Nieuwenhuizen, M. Hoogeveen-Westerveld, M. Verweij, S. Reis, B. Bardoni, A. T. Hoogeveen, B. A. Oostra, et al.
Fxr1 knockout mice show a striated muscle phenotype: implications for Fxr1p function in vivo
Hum. Mol. Genet., July 1, 2004; 13(13): 1291 - 1302.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
L. N. Antar, R. Afroz, J. B. Dictenberg, R. C. Carroll, and G. J. Bassell
Metabotropic Glutamate Receptor Activation Regulates Fragile X Mental Retardation Protein and Fmr1 mRNA Localization Differentially in Dendrites and at Synapses
J. Neurosci., March 17, 2004; 24(11): 2648 - 2655.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Material
Right arrow All Versions of this Article:
12/24/3295    most recent
ddg350v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (69)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Ceman, S.
Right arrow Articles by Warren, S. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ceman, S.
Right arrow Articles by Warren, S. T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?