Human Molecular Genetics Advance Access originally published online on October 21, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Human Molecular Genetics, 2003, Vol. 12, No. 24 3315-3323
DOI: 10.1093/hmg/ddg348
© 2003 Oxford University Press
Analysis of the ARMD1 locus: evidence that a mutation in HEMICENTIN-1 is associated with age-related macular degeneration in a large family
1Macular Degeneration Center, Casey Eye Institute, 2Department of Ophthalmology, Casey Eye Institute, 3Department of Molecular Microbiology and Immunology, 4Department of Molecular and Medical Genetics, and 5Department of Biochemistry and Molecular Biology, Oregon Health and Science University, Portland, OR 97239, USA
Received July 31, 2003; Accepted October 9, 2003
| ABSTRACT |
|---|
|
|
|---|
Age-related macular degeneration (AMD) is a common cause of severe vision loss. Identification of the genes involved in AMD will lead to a better understanding of this disease at the molecular level, which will eventually lead to early detection, prevention and treatment. Previously, we mapped the ARMD1 gene to 1q2531 in a large family with AMD. Here, we narrow the ARMD1 locus to 14.9 Mb between LAMB2 and D1S3469, a region containing 50 known genes. Twenty candidate genes within this region were screened for mutations. Only one DNA variation, an A16,263G transition in exon 104 of HEMICENTIN-1, was found to segregate exclusively with the disease haplotype in members of this large family with AMD. This variation produces a non-conservative substitution of arginine for glutamine at amino acid position 5345 (Gln5345Arg). It was also identified in 11 other individuals, all of whom share a haplotype, which envelops HEMICENTIN-1, with the large AMD family. The affected status of all but one of those individuals conforms to the age-dependent penetrance observed in AMD. The amino acid at position 5345 of HEMICENTIN-1 was conserved as glutamine in eight species analyzed. RTPCR analysis demonstrated that exon 104 of HEMICENTIN-1 is alternatively spliced in various cell types. Exclusive segregation of Gln5345Arg with the disease haplotype in this large family, amino acid conservation of glutamine at this position among mammals, the non-conservative nature of the substitution and similarities to EFEMP1 support the conclusion that HEMICENTIN-1 is the ARMD1 gene.
| INTRODUCTION |
|---|
|
|
|---|
Age-related macular degeneration (AMD) is a major cause of blindness in the elderly in the USA and other industrialized nations (13). Early age-related maculopathy (ARM) is characterized clinically by drusen, extracellular deposits of proteins, lipids and cellular debris (4) located between Bruch's membrane and the retinal pigment epithelium (RPE). The RPE provides nutritional, metabolic and phagocytic support for the overlying photoreceptors. Significant vision loss results from the dysfunction or death of photoreceptors in the central, or macular, region of the retina in association with the late stages of ARM. Late ARM is characterized by geographic atrophy of the RPE and/or subretinal neovascularization, and is termed age-related macular degeneration. The late onset and complex genetics of AMD have hindered the mapping and identification of genes that cause this common blinding disorder (5).
The ARMD1 gene was mapped to an interval on chromosome 1q2531 between markers D1S466 and D1S413 in a large family with AMD (6). Subsequently, others (Iyengar, ARVO Abstract #2113, 2003) (7) have mapped genes for AMD to regions that overlap or are located near this locus. However, we consider the ARMD1 locus to be defined by our large AMD family and the ARMD1 gene to be the gene responsible for AMD in this family. In the present work, we genotyped family members with additional markers in order to refine the ARMD1 locus and screened 20 genes in this refined region for sequence variations that segregate with the disease haplotype in this family. Fundus photographs of two affected individuals from this family are shown in Figure 1.
|
We screened HEMICENTIN-1 because of its resemblance to EFEMP1, which is mutated in similar but earlier-onset macular dystrophies (8). HEMICENTIN-1 and EFEMP1 both encode proteins containing a series of predicted calcium-binding epidermal growth factor-like (cbEGF) domains followed by a single unusual EGF-like domain at their carboxy termini (http://smart.embl-heidelberg.de/smart). These cbEGF domains contain about 40 residues with three disulfide bonds in a characteristic pattern (Cys13, Cys24, Cys56). The carboxy-terminal EGF-like domain is 120140 residues in length with two extra cysteine residues and is found in fibulins, fibrillins and hemicentins. The similarity of the carboxy terminus of HEMICENTIN-1 to fibulins led to its designation as Fibulin-6. The carboxy-terminal EGF-like domain of EFEMP1 harbors the single mutation associated with both Malattia Leventinese and Doyne honeycomb dystrophy (8), which are phenotypically similar to AMD.
The protein sequence of HEMICENTIN-1 is similar to that of hemicentin in Caenorhabditis elegans (911). HEMICENTIN-1 maps to 1q25.31q31.1, and extends over 450 kb of genomic DNA (www.Ensembl.org/Homo_sapiens/geneview?gene=ENSG00000143341). Pair-wise alignment (www.ncbi.nlm.nih.gov/blast/bl2seq/bl2.html) of the HEMICENTIN-1 mRNA with the human genomic sequence delineated 107 exons that encode a 5635 amino acid protein with a predicted molecular weight of over 600 kDa. In addition to the seven carboxy-terminal cbEGF domains and the EGF-like domain, the predicted protein contains an N-terminal von Willebrand factor type A domain, 44 tandem immunoglobulin modules, 6 thrombospondin type 1 domains, and a G2 nidogen domain (Fig. 2).
|
| RESULTS |
|---|
|
|
|---|
Genotyping of a large AMD family (6) with additional short tandem repeat (STR) markers, together with physical mapping of STR markers by the Human Genome project refined the ARMD1 locus from 16.3 to 14.9 Mb based on recombination breakpoint mapping (Fig. 3). The crossover in III-13 occurred between LAMB2 and D1S2701. The crossover in II-7 (inherited by III-14) occurred between F13B and D1S3469. This refinement excluded 10 known genes from the proximal portion of the previous ARMD1 region and three known genes from the distal portion of the region, thus reducing the maximum number of known genes in the ARMD1 region from 63 to 50.
|
Genes were prioritized for mutation screening based on their expression in the retina, their similarity to genes known to cause retinal disorders, and their encoding of extracellular matrix proteins or proteins potentially related to drusen formation. A total of 20 genes in the refined ARMD1 region were screened for DNA variants (Table 1, Supplementary Table 1). Although all the variants within the refined locus on the disease chromosome segregate, presumably, with AMD in this family, only one variant, A16,263G in HEMICENTIN-1, was found to segregate exclusively. That is, this variant was found in conjunction with the disease haplotype but was not found in conjunction with any of the 17 other haplotypes found in this pedigree across the ARMD1 region. The disease haplotype is found in all affected individuals in this large family, except the married-in spouse (II-10) and one of his children (III-18). Data from the married-in spouse and his children were not used in the original linkage analysis. These were omitted because of the possible genetic heterogeneity of AMD, which has since received considerable support (1214). The disease haplotype is also found in three family members who are presumably too young to develop AMD, as well as one family member who refused to be diagnosed. DNA sequencing revealed that all 16 family members who carried the disease haplotype also carried the A16,263G mutation, including the 10 affected members described previously (6). Furthermore, none of the 11 family members who lacked the disease haplotype carried the variation. This mutation is expected to change the glutamine at amino acid position 5345 of HEMICENTIN-1 to arginine (Gln5345Arg).
|
The glutamine at position 5345 of HEMICENTIN-1 appears to be conserved among eutherian species. Since the only other HEMICENTIN-1 mammalian DNA sequence deposited at Genbank was for mouse, we sequenced a region corresponding to a portion of human exon 104 in pig, rabbit, dog, rat, cat, sheep and chicken. In all mammals analyzed, and in chicken, the amino acid at a position equivalent to 5345 in human HEMICENTIN-1 was conserved as glutamine (Fig. 2). There was approximately 85% conservation at the nucleotide level and approximately 90% conservation at the amino acid level among all mammalian species in the portion of the cbEGF domain in exon 104 sequenced. In mouse and rabbit, this glutamine is encoded by a CAG codon instead of the CAA codon found in the other species examined.
In order to further evaluate the association of the A16,263G mutation with AMD, we screened 1016 members of 100 families, 188 sporadic AMD cases and 174 control subjects. We identified 11 additional individuals with this mutation. Of these, seven individuals were affected with AMD and averaged 74 years of age. The remaining four individuals were unaffected and were 57, 61, 64 and 89 years of age. These 11 additional individuals represent only six additional, possibly independent, instances of the A16,263G (Gln5345Arg) mutation since eight additional individuals were found in three families (haplotypes B, C, and D in Table 2). The mutation was also found in a single sporadic case of AMD, who was 74 years of age at time of diagnosis (haplotype E in Table 2), and two control subjects, who were 57 and 64 years of age at time of diagnosis (haplotypes F and G in Table 2).
|
Close inspection revealed that all individuals carrying the A16,263G mutation share an allele of seven contiguous markers over a distance of approximately one megabase (Table 2). Five of these markers lie within the HEMICENTIN-1 gene. All but one (D) of the haplotypes share an allele of nine markers over 1.5 Mb, completely spanning the HEMICENTIN-1 gene. Assuming random assortment, the probability of this haplotype (consisting of seven markers) occurring by chance is 0.0002. The association of the A16,263G (Gln5345Arg) mutation with a shared haplotype suggests that this mutation may have arisen from a single founder.
Relatively few variations were identified among the 16,905 nucleotides (5635 amino acid residues) that encode HEMICENTIN-1. All 107 exons were sequenced in DNA from seven individuals. This represented only 12 unique copies of HEMICENTIN-1 because three individuals from the same family shared a haplotype across this region. Including the Gln5345Arg mutation, we detected a total of 14 variations (10 non-synonymous) in the protein-coding portion of exons, one variation in the 3'-UTR, and 34 variations in introns (Supplementary Table 2). Curiously, 38 of the 49 variations were detected in a single individual, 19 of them unique. In addition to the Gln5345Arg change, only two other alterations from the NCBI sequence (XM_053531) were detected in the proband (III-3) from the large family with AMD. However, both changes were homozygous, detected in all individuals screened, and present in the mRNA sequence for HEMICENTIN-1 (AF156100). Therefore, we detected no other DNA variations, either in exons or in the 50100 basepairs of flanking introns, on the disease chromosome carrying the Gln5345Arg mutation in HEMICENTIN-1.
RT-PCR was used to determine if HEMICENTIN-1 is expressed in the retina (Fig. 4). Two previously identified clones (GenBank Accession AL833232 and AK027344) corresponding to the 3' end of HEMICENTIN-1 lacked exon 104. Also, intron 103 has a poor acceptor site for mRNA splicing compared with the consensus sequence (elmo.ims.u-tokyo.ac.jp/altspl/score.html). Therefore, gene-specific primers were designed that bridged or terminated in exon 104 to evaluate possible alternative splicing of this exon. RTPCR analysis demonstrated HEMICENTIN-1 mRNA in human skin fibroblasts, RPE cells and microvascular endothelial cells from the retina. Alternative splicing of exon 104 occurred in HEMICENTIN-1 transcripts from all cells examined (Fig. 4).
|
| DISCUSSION |
|---|
|
|
|---|
The ARMD1 gene locus was narrowed to slightly less than 15 Mb between STR markers LAMB2 and D1S3469. Previously, the proximal and distal markers, excluded from the disease locus, had been D1S466 and D1S413, respectively. Approximately 10% of the original ARMD1 locus was excluded and the number of known or confirmed genes was reduced from 63 to 50.
Two independent studies have mapped a gene for AMD to loci that are nearby or overlap the ARMD1 locus. Weeks et al. identified a locus for an ARMD susceptibility gene at D1S1660, less than a megabase distal from the ARMD1 locus (7). More recently, Iyengar et al. (Iyengar, ARVO Abstract no. 2113, 2003) identified a locus for an ARMD susceptibility gene at D1S518, which is within the ARMD1 locus, approximately 1.4 Mb distal to HEMICENTIN-1. This locus appeared only after the analysis was limited to more severely affected cases of AMD. Our laboratory also identified an ARMD locus at the same marker, D1S518, in a recent genome-wide scan involving 70 families with AMD (14). However, the large AMD family in which we defined the ARMD1 locus was the primary contributor to the peak representing this locus. The studies by Weeks et al. and Iyengar et al. suggest that the loci identified should account for a significant proportion of all AMD cases [41%, (7)]; however, our estimates are no greater than 15% (14). Although these loci may harbor the ARMD1 gene, the suspected heterogeneity associated with AMD suggests this is far from certain. Indeed, the difference in the estimates of linked families suggests that this region may harbor, in addition to ARMD1, a more common susceptibility allele for AMD.
Twenty candidate genes from the refined ARMD1 locus were screened for the disease-causing mutation by DNA sequencing. Candidate genes were prioritized for screening based on their expression in the retina, similarity to genes involved in other retinal disorders, potential involvement in drusen formation (15,16), or encoding of extracellular matrix (ECM) components. Two closely related disorders, Malattia Leventinese (and Doyne honeycomb dystrophy) and Sorsby fundus dystrophy are caused by mutations in ECM proteins.
In total, 49 variations, which were identified in the mutation screen of the large family with AMD, were analyzed for segregation with the disease haplotype. Forty-eight of these did not segregate exclusively with the disease haplotype in the large AMD family. That is, they were also associated with other non-disease haplotypes across the ARMD1 locus within the family, suggesting that they are common polymorphisms. The A16,263G mutation (Gln5345Arg) was the only alteration found in this region that was both associated with the disease haplotype in the large AMD family and absent from the 17 other haplotypes present in this family. In addition to the disease-causing mutation, polymorphisms within the ARMD1 locus will segregate with the disease haplotype. While we expect common polymorphisms to be found on other, non-disease haplotypes (chromosomes) in the family, we do not expect this of the disease-causing mutation, which we assume to be fairly rare. Consistent with this notion, this mutation was found on three of 724 chromosomes (0.4%) among presumably unrelated individuals.
An additional 1378 individuals, all of whom were either members of families with AMD or belonged to a population of sporadic AMD cases or control subjects, were screened for the A16,263G (Gln5345Arg) mutation. Eleven additional individuals with the mutation were identified, seven of whom had AMD. The seven affected individuals averaged 74 years of age, while three of the four unaffected individuals averaged 61 years of age. None of the four non-penetrant individuals demonstrated large, soft drusen or other features in the macula characteristic of early AMD.
Except for the lone unaffected individual, who was 89 years of age, the affected status of individuals with the hemicentin mutation is in good accord with the age-dependent penetrance of AMD (6). The estimate of the probability that a susceptible individual in the families we ascertain will develop AMD between 50 and 54 years of age is 1%; between the ages of 55 and 64, 9%; between 65 and 74, 42%; and for ages 75 and over, the probability is 95% (17). The unaffected individuals with the mutation who are 57, 61 and 64 years old are expected to have only a 9% probability of having developed AMD by their age. Lack of penetrance also explains why three members of the large family with the mutation and disease haplotype are as yet unaffected with AMD (Fig. 3). All three are less than 50 years of age and have considerably less than a 1% chance of having developed AMD by their age.
One possible explanation for the lack of penetrance observed in the single older unaffected individual would be the presence of an allele of a gene that protects her from developing AMD. Recently, we have found evidence for epistatic interactions between AMD loci, possibly including the ARMD1 locus (14). Several genetic or environmental factors could potentially influence the penetrance of this or any other AMD mutation.
The degree of conservation of an amino acid across species is a good indication of its functional importance (18). Gln5345 is conserved in seven other mammals and in the chicken, suggesting an important functional role. A tyrosine or phenylalanine, which is involved in a hydrophobic packing interaction with the adjacent carboxy terminal cbEGF domain, is normally found at this position in cbEGF domains (19). In HEMICENTIN-1, however, it is conserved as glutamine in a novel cbEGF domain that contains an additional 76 amino acids at its carboxy terminus instead of the usual one or two linking tandem cbEGF domains (20). Since transmission of AMD in the large family is consistent with an autosomal dominant mode of inheritance, the Gln5345Arg mutation may confer a gain of function, cause haploinsufficiency or cause a dominant negative effect in susceptible individuals with the appropriate genetic background or environmental stimulus.
HEMICENTIN-1 was a likely candidate for the ARMD1 gene because of its similarity to EFEMP1. Both of these genes encode extracellular matrix proteins that have a series of cbEGF domains followed by an unusual carboxy terminal EGF-like domain with eight cysteines. This last domain in EFEMP1 contains the single mutation Arg345Trp, which causes Malattia Leventinese and Doyne honeycomb retinal dystrophy (8). Analogous to EFEMP1, there may be only a single HEMICENTIN-1 mutation, inherited from a common founder, that is associated with AMD. The genome-wide scans of Weeks (7) and Iyengar (Iyengar, ARVO Abstract no. 2113, 2003) suggest that there may be additional mutations in HEMICENTIN-1 that cause AMD, or alternately that there may be additional genes in this region that are also associated with AMD. In contrast to EFEMP1, the Gln5345Arg mutation may require additional environmental and genetic factors to effect the phenotypic expression of AMD.
Overall, several lines of evidence argue that HEMICENTIN-1 is the ARMD1 gene. The Gln5345Arg variation in HEMICENTIN-1 is the only one of 49 variations in 20 candidate genes to segregate exclusively with the disease haplotype in this large AMD family with 27 total members. No other changes in HEMICENTIN-1 were detected in the proband from this family. The glutamine at position 5345 in human HEMICENTIN-1 is strictly conserved among the eight various species analyzed. Conservation of Gln5345 suggests it may have an important functional role. The presence of both glutamine codons demonstrates that synonymous change can occur in this codon. The glutamine to arginine variation changes both the size and the charge of the amino acid side chain; thus, protein structure and function are likely to be affected. Lastly, the ARMD1 mutation occurs in the carboxy terminus of HEMICENTIN-1, which is similar to EFEMP1, in which the mutation occurs that causes two diseases phenotypically similar to AMD. Although this evidence is consistent with Gln5345Arg being the ARMD1 mutation, we cannot exclude the possibility that this variation is a very rare polymorphism and that the ARMD1 mutation is in another gene in our region.
The role of any variant in a complex disorder, particularly one with such late onset, is difficult to establish without a functional assay for the disease in question. The complexity of the disease progression and paucity of diagnostic, molecular or cellular changes make this a daunting task. The rarity of the Gln5345Arg mutation, which is associated with what appears to be a single founder, together with the complication of age-dependent penetrance, suggests that association studies to further verify its role in AMD are unlikely to be definitive without an extremely large cohort of individuals, preferably 75 years of age or older. Alternatively, it may be possible to use an animal model to confirm the role of the Gln5345Arg mutation of HEMICENTIN-1 in AMD. However, based on our accumulated evidence, we conclude that the Gln5345Arg mutation is very likely to be the disease-causing mutation in this large family.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Subject ascertainment
Human subjects were informed of the risks associated with this study and completed the appropriate consent forms as required by the Institutional Review Board of Oregon Health Sciences University. Approximately 20 ml of blood were collected from each subject and DNA was extracted by standard techniques. We studied a total of 100 families with three or more living members affected with AMD, 188 sporadic cases of AMD, and 174 phenotypically normal individuals matched for age, sex and ethnic background. Diagnosis of AMD was based upon stereoscopic fundus photographs as described previously (6).
Genotyping
Genotyping was performed as previously described (21).
Mutation screening
Potential disease-causing variations were initially identified by comparing the DNA sequences of two affected and two unaffected members of the large family with AMD. Later, variations were identified by comparing the two copies of chromosome 1 separated in human-mouse cell hybrids (22) derived from the proband III-3 (GMP Genetics Inc., Waltham, MA, USA). Inclusion of the ARMD1 gene locus in the hybrids was verified by genotyping with six microsatellite markers. Exons were mapped on human genomic sequence through a pair-wise comparison (www.ncbi.nlm.nih.gov/blast/bl2seq/bl2.html) of XM_053531, the reference sequence for HEMICENTIN-1 mRNA, with contigs AL121996, AL135796, AL133515, AL391824, AL118512, AL135797 and AL133553. Primers were designed to amplify each exon plus an additional 50100 bp of the adjacent introns using the Primer3 software package (www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi). Genomic DNA (25 ng) was amplified in 20 µl reactions using FastStart Taq DNA polymerase (Roche Diagnostic Corporation Indianapolis, IN, USA) with a balcony PCR protocol, which helped to prevent amplification of homologous mouse DNA. All amplifications included an initial denaturation at 95°C for 5 min, a 30 s denaturation at 95°C, an annealing step, and a 1 min extension at 72°C. Balcony refers to the first 10 cycles, in which annealing was performed at 5°C above the Tm of the primers as determined by Primer3 software. This was followed by a 20 cycle touchdown phase in which the annealing temperature dropped in 0.5°C increments from 5°C above the primer Tm to 5°C below. The final phase consisted of 25 cycles in which annealing occurred at 5°C below primer Tm. PCR products were electrophoresed on 2% agarose gels, excised, purified with Microcon-PCR Filter units (Millipore Corporation, Bedford, MA, USA), and sequenced at the Veteran's Administration Core Sequencing facility (Portland, OR, USA).
Control subjects (n=174), sporadic AMD cases (n=188), and family members (n=1016) were assayed for the A16,263G variation by Denaturing High Performance Liquid Chromatography (DHPLC) (Transgenomics, Omaha, NE, USA) (23,24) or by allele-specific oligomer (ASO) hybridization (25) or both. For DHPLC, a 194 bp PCR product, located within exon 104 of HEMICENTIN-1, was amplified using the forward primer, 5'CCGTGCAAGGTTATAGCTACTG3', and the reverse primer, 5'ATGGCATACGAGCAGACATT3'. In order to ensure detection of potential homozygous mutations, samples were mixed 1 : 1 with wild-type product prior to a final 5 min denaturation and slow reannealing step. For ASO hybridization, a 462 bp product was amplified using the forward primer, 5'TATCATGGCATACGAGCAGAC3', and the reverse primer, 5'TTCACTGCACTCAAACAATCAC3'. Blotting and hybridization were performed as previously described (26), except that blots were probed at 47°C overnight with a 17 base wild-type oligomer (16,263A), 5'ACCAGGACAACATTTAT3', or mutant oligomer (16,263G), 5'ACCAGGACGACATTTAT3'.
RTPCR of human cell lines
Human RPE cells and skin fibroblasts were cultured as previously detailed (2729). Human microvascular endothelial cells were established as described (30). Total RNA was extracted from various cultured cell lines using an RNAqueous kit (Ambion, Austin, TX, USA). RTPCR utilized an RNA Amplification kit (Roche Laboratories, Nutley, NJ, USA) in a Roche LightCycler with detection after each cycle based on SybrGreen binding. Two sets of primers were used to differentiate alternative splicing involving exon 104. A common upstream primer, 5'-CAAGAAGCAGCTATCGTTGTG-3', was located approximately 100 bp proximal to the 3' end of exon 103. One downstream primer, 5'-ACTGTCTGTAATGCTGTTGAGGT-3', was located within exon 104 and produced a 297 bp PCR product when exon 104 was present in the transcript. The other primer, 5'-GCATGTCTTTCCATTGTGTGT-3', was located approximately 100 bp downstream of the 5' end of exon 105 and yielded products of 536 or 185 bp depending on the presence or absence of exon 104 in the transcript. Products were verified by electrophoretic mobility on gels and by post-run melting curve analysis. Several resultant PCR products were gel-purified and sequenced for further verification.
Sequencing of additional species
Oryctolagus cuniculus cDNA was the kind gift of Binoy Appukuttan, Casey Eye Institute, Oregon Health and Science University (OHSU). Canis familiaris, Felis catus, Ovis sp. and Rattus norvegicus blood samples were the kind gift of Vicki Feldmann, Department of Comparative Medicine, OHSU. A chicken cell line was the kind gift of Rick Press, Pathology Department, OHSU. Porcine tissues were obtained from Carlton Packing (Carlton, OR, USA). Three sets of primers were designed to the most conserved regions between mouse and human copies of exon 104 of HEMICENTIN-1 that included the codon for the Gln5345. Amplifications used less stringent conditions than normal to compensate for potential non-complementarity between primers and template. An initial, touchup phase of PCR included 820 cycles in which the annealing temperature was raised incrementally from 1015°C below the primer Tm to 510°C below. This was followed by 25 cycles of PCR in which annealing occurred at 510°C below the primer Tm. The magnesium concentration was also increased to 24 mM. If the initial PCR product was weak or not unique, the amplification was repeated with a 1 : 1000 dilution of product as template under normal stringent conditions (annealing at 5°C below Tm and 1.5 mM magnesium concentration).
| SUPPLEMENTARY MATERIAL |
|---|
|
|
|---|
Supplementary Material is available at HMG Online.
| ACKNOWLEDGEMENTS |
|---|
We thank Binoy Appukuttan, PhD, and J. Timothy Stout, MD, PhD, for providing technical assistance, and Patricia Kramer, PhD, for insightful discussions of the data. This study was supported in part by grants EY 12203 (M.L.K.), EY 03279, EY 08247 and EY 10572 (T.S.A.) and EY 13139 (T.M.M.) from the National Institutes of Health, Bethesda, MD, USA. Support was also provided by PHS Grant 5 M01 RR000334; the Collins Medical Trust, Portland, OR (D.W.S.); The Foundation Fighting Blindness, Owings Mills, MD (D.W.S., R.G.W.); and an unrestricted grant from Research to Prevent Blindness, New York, NY, USA.
| FOOTNOTES |
|---|
* To whom correspondence should be addressed at: Casey Eye Institute, CERES, 3375 SW Terwilliger Blvd, Portland, OR 97239-4197, USA. Tel: +1 5034945672; Fax: +1 5034946875; Email: schultzd{at}ohsu.edu
| REFERENCES |
|---|
|
|
|---|
-
Evans, J. and Wormald, R. (1996) Is the incidence of registrable age-related macular degeneration increasing? Br. J. Ophthal., 80, 914.
[Abstract/Free Full Text] - Klein, R., Klein, B.E.K. and Linton, K.L.P. (1992) Prevalence of age-related maculopathy: the Beaver Dam eye study. Ophthalmology, 99, 933943.[Web of Science][Medline]
- Vingerling, J.R., Dielemans, I., Hofman, A., Grobbee, D.E., Hijmering, M., Kramer, C.F.L. and de Jong, P.T.V.M. (1995) The prevalence of age-related maculopathy in the Rotterdam Study. Ophthalmology, 102, 205210.[Web of Science][Medline]
- Hageman, G.S. and Mullins, R.F. (1999) Molecular composition of drusen as related to substructural phenotype. Mol. Vis., 5, 28.[Medline]
- Gorin, M.B., Breitner, J.C., De Jong, P.T., Hageman, G.S., Klaver, C.C., Kuehn, M.H. and Seddon, J.M. (1999) The genetics of age-related macular degeneration. Mol. Vis., 5, 29.[Medline]
-
Klein, M.L., Schultz, D.W., Edwards, A., Matise, T.C., Rust, K., Berselli, C.B., Trzupek, K., Weleber, R.G., Ott, J., Wirtz, M.K. et al. (1998) Age-related macular degeneration. Clinical features in a large family and linkage to chromosome 1q. Arch. Ophthal., 116, 10821088.
[Abstract/Free Full Text] - Weeks, D.E., Conley, Y.P., Tsai, H.-J., Mah, T.S., Rosenfeld, P.J., Paul, T.O., Eller, A.W., Morse, L.S., Dailey, J.P., Ferrell, R.E. et al. (2001) Age-related maculopathy: an expanded genome-wide scan with evidence of susceptibility loci within the 1q31 and 17q25 regions. Am. J. Ophthal., 132, 682692.[CrossRef][Web of Science][Medline]
- Stone, E.M., Lotery, A.J., Munier, F.L., Heon, E., Piguet, B., Guymer, R.H., Vandenburgh, K., Cousin, P., Nishimura, D., Swiderski, R.E. et al. (1999) A single EFEMP1 mutation associated with both Malattia Leventinese and Doyne honeycomb retinal dystrophy. Nat. Genet., 22, 199202.[CrossRef][Web of Science][Medline]
- Carpten, J.D., Makalowska, I., Robbins, C.M., Scott, N., Sood, R., Connors, T.D., Bonner, T.I., Smith, J.R., Faruque, M.U., Stephan, D.A. et al. (2000) A 6-Mb high-resolution physical and transcription map encompassing the hereditary prostate cancer 1 (HPC1) region. Genomics, 64, 114.[CrossRef][Web of Science][Medline]
- Vogel, B.E. and Hedgecock, E.M. (2001) Hemicentin, a conserved extracellular member of the immunoglobulin superfamily, organizes epithelial and other cell attachments into oriented line-shaped junctions. Development, 128, 883894.[Abstract]
-
Hubbard, T., Barker, D., Birney, E., Cameron, G., Chen, Y., Clark, L., Cox, T., Cuff, J., Curwen, V., Down, T. et al. (2002) The Ensembl genome database project. Nucl. Acids Res., 30, 3841.
[Abstract/Free Full Text] - Weeks, D.E., Conley, Y.P., Tsai, H.-J., Mah, T.S., Rosenfeld, P.J., Paul, T.O., Eller, A.W., Morse, L.S., Dailey, J.P., Ferrell, R.E. et al. (2001) Age-related maculopathy: an expanded genome-wide scan with evidence of susceptibility loci within the 1q31 and 17q25 regions. Am. J. Ophthal., 132, 682692.[CrossRef][Web of Science][Medline]
- Schick, J.H., Iyengar, S.K., Klein, B.E., Klein, R., Reading, K., Liptak, R., Millard, C., Lee, K.E., Tomany, S.C., Moore, E.L. et al. (2003) A whole-genome screen of a quantitative trait of age-related maculopathy in sibships from the beaver dam eye study. Am. J. Hum. Genet., 72, 14121424.[CrossRef][Web of Science][Medline]
- Majewski, J., Schultz, D.W., Weleber, R.G., Schain, M.B., Edwards, A.O., Matise, T.C., Acott, T.S., Ott, J. and Klein, M.L. (2003) Age-related macular degenerationa genome scan in extended families. Am. J. Hum. Genet., 73, 540550.[CrossRef][Web of Science][Medline]
- Johnson, L.V., Ozaki, S., Staples, M.K., Erickson, P.A. and Anderson, D.H. (2000) A potential role for immune complex pathogenesis in drusen formation. Exp. Eye Res., 70, 441449.[CrossRef][Web of Science][Medline]
-
Mullins, R.F., Russell, S.R., Anderson, D.H. and Hageman, G.S. (2000) Drusen associated with aging and age-related macular degeneration contain proteins common to extracellular deposits associated with atherosclerosis, elastosis, amyloidosis, and dense deposit disease. FASEB J., 14, 835846.
[Abstract/Free Full Text] - Ott, J. (1991) Analysis of Human Genetic Linkage. The Johns Hopkins University Press, Baltimore, MD.
- Valdar, W.S. (2002) Scoring residue conservation. Proteins, 48, 227241.[CrossRef][Web of Science][Medline]
- Handford, P.A. (2000) Fibrillin-1, a calcium binding protein of extracellular matrix. Biochim. Biophys. Acta, 1498, 8490.[Medline]
- Downing, A.K., Knott, V., Werner, J.M., Cardy, C.M., Campbell, I.D. and Handford, P.A. (1996) Solution structure of a pair of calcium-binding epidermal growth factor-like domains: implications for the Marfan syndrome and other genetic disorders. Cell, 85, 597605.[CrossRef][Web of Science][Medline]
- Wirtz, M.K., Samples, J.R., Kramer, P.L., Rust, K., Topinka, J.R., Yount, J., Koler, R.D. and Acott, T.S. (1997) Mapping a gene for adult-onset primary open-angle glaucoma to chromosome 3q. Am. J. Hum. Genet., 60, 296304.[Web of Science][Medline]
- Yan, H., Papadopoulos, N., Marra, G., Perrera, C., Jiricny, J., Boland, C.R., Lynch, H.T., Chadwick, R.B., de la Chapelle, A., Berg, K. et al. (2000) Conversion of diploidy to haploidy. Nature, 403, 723724.[CrossRef][Medline]
-
Underhill, P.A., Jin, L., Lin, A.A., Mehdi, S.Q., Jenkins, T., Vollrath, D., Davis, R.W., Cavalli-Sforza, L.L. and Oefner, P.J. (1997) Detection of numerous Y chromosome biallelic polymorphisms by denaturing high-performance liquid chromatography. Genome Res., 7, 9961005.
[Abstract/Free Full Text] - Oefner, P.J. and Underhill, P.A. (1995) Comparative DNA sequencing by denaturing high-performance liquid chromatography (DHPLC). Am. J. Hum. Genet., 57 (suppl.), A266.
-
Wallace, R.B., Shaffer, J., Murphy, R.F., Bonner, J., Hirose, T. and Itakura, K. (1979) Hybridization of synthetic oligodeoxyribonucleotides to phi chi 174 DNA: the effect of single base pair mismatch. Nucl. Acids Res., 6, 35433557.
[Abstract/Free Full Text] -
Litt, M., Kramer, P., LaMorticella, D.M., Murphey, W., Lovrien, E.W. and Weleber, R.G. (1998) Autosomal dominant congenital cataract associated with a missense mutation in the human alpha crystallin gene CRYAA. Hum. Mol. Genet., 7, 471474.
[Abstract/Free Full Text] -
Alexander, J.P., Bradley, J.M.B., Gabourel, J.D. and Acott, T.S. (1990) Expression of matrix metalloproteinases and inhibitor by human retinal pigment epithelium. Invest. Ophthal. Visual Sci., 31, 25202528.
[Abstract/Free Full Text] - Vranka, J.A., Johnson, E., Zhu, X., Shepardson, A., Alexander, J.P., Bradley, J.M.B., Wirtz, M.K., Weleber, R.G., Klein, M.L. and Acott, T.S. (1997) Discrete expression and distribution pattern of TIMP-3 in the human retina and choroid. Curr. Eye Res., 16, 102110.[CrossRef][Web of Science][Medline]
-
Alexander, J.P., Samples, J.R., Van Buskirk, E.M. and Acott, T.S. (1991) Expression of matrix metalloproteinases and inhibitor by human trabecular meshwork. Invest. Ophthal. Visual Sci., 32, 172180.
[Abstract/Free Full Text] -
Silverman, M.D., Zamora, D.O., Pan, Y., Texeira, P.V., Planck, S.R. and Rosenbaum, J.T. (2001) Cell adhesion molecule expression in cultured human iris endothelial cells. Invest. Ophthal. Visual Sci., 42, 28612866.
[Abstract/Free Full Text]
This article has been cited by other articles:
![]() |
K. Nakai, M. S. Rogers, T. Baba, T. Funakoshi, A. E. Birsner, D. S. Luyindula, and R. J. D'Amato Genetic loci that control the size of laser-induced choroidal neovascularization FASEB J, July 1, 2009; 23(7): 2235 - 2243. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Jarvelainen, A. Sainio, M. Koulu, T. N. Wight, and R. Penttinen Extracellular Matrix Molecules: Potential Targets in Pharmacotherapy Pharmacol. Rev., June 1, 2009; 61(2): 198 - 223. [Abstract] [Full Text] [PDF] |
||||
![]() |
P J Francis, S C Hamon, J Ott, R G Weleber, and M L Klein Polymorphisms in C2, CFB and C3 are associated with progression to advanced age related macular degeneration associated with visual loss J. Med. Genet., May 1, 2009; 46(5): 300 - 307. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sisto, M. D'Amore, D. D. Lofrumento, P. Scagliusi, S. D'Amore, V. Mitolo, and S. Lisi Fibulin-6 expression and anoikis in human salivary gland epithelial cells: implications in Sjogren's syndrome Int. Immunol., March 1, 2009; 21(3): 303 - 311. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Leveziel, J. Zerbib, F. Richard, G. Querques, G. Morineau, V. Fremeaux-Bacchi, G. Coscas, G. Soubrane, P. Benlian, and E. H. Souied Genotype-Phenotype Correlations for Exudative Age-Related Macular Degeneration Associated with Homozygous HTRA1 and CFH Genotypes Invest. Ophthalmol. Vis. Sci., July 1, 2008; 49(7): 3090 - 3094. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Thompson, B. E.K. Klein, R. Klein, Z. Xu, J. Capriotti, T. Joshi, D. Leontiev, K. E. Lee, R. C. Elston, and S. K. Iyengar Complement factor H and hemicentin-1 in age-related macular degeneration and renal phenotypes Hum. Mol. Genet., September 1, 2007; 16(17): 2135 - 2148. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Thompson, G. Jun, B. E. K. Klein, R. Klein, J. Capriotti, K. E. Lee, and S. K. Iyengar Genetics of Pigment Changes and Geographic Atrophy Invest. Ophthalmol. Vis. Sci., July 1, 2007; 48(7): 3005 - 3013. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Xu, C. Dong, and B. E. Vogel Hemicentins Assemble on Diverse Epithelia in the Mouse J. Histochem. Cytochem., February 1, 2007; 55(2): 119 - 126. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Barral, P. J. Francis, D. W. Schultz, M. B. Schain, C. Haynes, J. Majewski, J. Ott, T. Acott, R. G. Weleber, and M. L. Klein Expanded Genome Scan in Extended Families with Age-Related Macular Degeneration Invest. Ophthalmol. Vis. Sci., December 1, 2006; 47(12): 5453 - 5459. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. N. A. Mandal, V. Vasireddy, G. B. Reddy, X. Wang, S. E. Moroi, B. R. Pattnaik, B. A. Hughes, J. R. Heckenlively, P. F. Hitchcock, M. M. Jablonski, et al. CTRP5 Is a Membrane-Associated and Secretory Protein in the RPE and Ciliary Body and the S163R Mutation of CTRP5 Impairs Its Secretion Invest. Ophthalmol. Vis. Sci., December 1, 2006; 47(12): 5505 - 5513. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Aisenbrey, M. Zhang, D. Bacher, J. Yee, W. J. Brunken, and D. D. Hunter Retinal Pigment Epithelial Cells Synthesize Laminins, Including Laminin 5, and Adhere to Them through {alpha}3- and {alpha}6-Containing Integrins Invest. Ophthalmol. Vis. Sci., December 1, 2006; 47(12): 5537 - 5544. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. N. Baird, F. M. A. Islam, A. J. Richardson, M. Cain, N. Hunt, and R. Guymer Analysis of the Y402H Variant of the Complement Factor H Gene in Age-Related Macular Degeneration. Invest. Ophthalmol. Vis. Sci., October 1, 2006; 47(10): 4194 - 4198. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Kaur, A. Hussain, N. Hussain, T. Das, A. Pathangay, A. Mathai, A. Hussain, R. Nutheti, P. K. Nirmalan, and S. Chakrabarti Analysis of CFH, TLR4, and APOE Polymorphism in India Suggests the Tyr402His Variant of CFH to be a Global Marker for Age-Related Macular Degeneration. Invest. Ophthalmol. Vis. Sci., September 1, 2006; 47(9): 3729 - 3735. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Dong, J. M. Muriel, S. Ramirez, H. Hutter, E. M. Hedgecock, L. Breydo, I. V. Baskakov, and B. E. Vogel Hemicentin Assembly in the Extracellular Matrix Is Mediated by Distinct Structural Modules J. Biol. Chem., August 18, 2006; 281(33): 23606 - 23610. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. McLaughlin, Q. Chen, M. Horiguchi, B. C. Starcher, J. B. Stanton, T. J. Broekelmann, A. D. Marmorstein, B. McKay, R. Mecham, T. Nakamura, et al. Targeted disruption of fibulin-4 abolishes elastogenesis and causes perinatal lethality in mice. Mol. Cell. Biol., March 1, 2006; 26(5): 1700 - 1709. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. N. Roybal, L. Y. Marmorstein, D. L. Vander Jagt, and S. F. Abcouwer Aberrant Accumulation of Fibulin-3 in the Endoplasmic Reticulum Leads to Activation of the Unfolded Protein Response and VEGF Expression Invest. Ophthalmol. Vis. Sci., November 1, 2005; 46(11): 3973 - 3979. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Rivera, S. A. Fisher, L. G. Fritsche, C. N. Keilhauer, P. Lichtner, T. Meitinger, and B. H.F. Weber Hypothetical LOC387715 is a second major susceptibility gene for age-related macular degeneration, contributing independently of complement factor H to disease risk Hum. Mol. Genet., November 1, 2005; 14(21): 3227 - 3236. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Muriel, C. Dong, H. Hutter, and B. E. Vogel Fibulin-1C and Fibulin-1D splice variants have distinct functions and assemble in a hemicentin-dependent manner Development, October 1, 2005; 132(19): 4223 - 4234. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Jun, B. E. K. Klein, R. Klein, K. Fox, C. Millard, J. Capriotti, K. Russo, K. E. Lee, R. C. Elston, and S. K. Iyengar Genome-Wide Analyses Demonstrate Novel Loci That Predispose to Drusen Formation Invest. Ophthalmol. Vis. Sci., September 1, 2005; 46(9): 3081 - 3088. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ayyagari, M. N. A. Mandal, A. J. Karoukis, L. Chen, N. C. McLaren, M. Lichter, D. T. Wong, P. F. Hitchcock, R. C. Caruso, S. E. Moroi, et al. Late-Onset Macular Degeneration and Long Anterior Lens Zonules Result from a CTRP5 Gene Mutation Invest. Ophthalmol. Vis. Sci., September 1, 2005; 46(9): 3363 - 3371. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Fisher, G. R. Abecasis, B. M. Yashar, S. Zareparsi, A. Swaroop, S. K. Iyengar, B. E.K. Klein, R. Klein, K. E. Lee, J. Majewski, et al. Meta-analysis of genome scans of age-related macular degeneration Hum. Mol. Genet., August 1, 2005; 14(15): 2257 - 2264. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. P. Conley, A. Thalamuthu, J. Jakobsdottir, D. E. Weeks, T. Mah, R. E. Ferrell, and M. B. Gorin Candidate gene analysis suggests a role for fatty acid biosynthesis and regulation of the complement system in the etiology of age-related maculopathy Hum. Mol. Genet., July 15, 2005; 14(14): 1991 - 2002. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Zareparsi, M. Buraczynska, K. E.H. Branham, S. Shah, D. Eng, M. Li, H. Pawar, B. M. Yashar, S. E. Moroi, P. R. Lichter, et al. Toll-like receptor 4 variant D299G is associated with susceptibility to age-related macular degeneration Hum. Mol. Genet., June 1, 2005; 14(11): 1449 - 1455. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. S. Hageman, D. H. Anderson, L. V. Johnson, L. S. Hancox, A. J. Taiber, L. I. Hardisty, J. L. Hageman, H. A. Stockman, J. D. Borchardt, K. M. Gehrs, et al. From The Cover: A common haplotype in the complement regulatory gene factor H (HF1/CFH) predisposes individuals to age-related macular degeneration PNAS, May 17, 2005; 102(20): 7227 - 7232. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. G. Marneros and B. R. Olsen Physiological role of collagen XVIII and endostatin FASEB J, May 1, 2005; 19(7): 716 - 728. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Haines, M. A. Hauser, S. Schmidt, W. K. Scott, L. M. Olson, P. Gallins, K. L. Spencer, S. Y. Kwan, M. Noureddine, J. R. Gilbert, et al. Complement Factor H Variant Increases the Risk of Age-Related Macular Degeneration Science, April 15, 2005; 308(5720): 419 - 421. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. O. Edwards, R. Ritter III, K. J. Abel, A. Manning, C. Panhuysen, and L. A. Farrer Complement Factor H Polymorphism and Age-Related Macular Degeneration Science, April 15, 2005; 308(5720): 421 - 424. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Klein, C. Zeiss, E. Y. Chew, J.-Y. Tsai, R. S. Sackler, C. Haynes, A. K. Henning, J. P. SanGiovanni, S. M. Mane, S. T. Mayne, et al. Complement Factor H Polymorphism in Age-Related Macular Degeneration Science, April 15, 2005; 308(5720): 385 - 389. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Seddon, J. Cote, W. F. Page, S. H. Aggen, and M. C. Neale The US Twin Study of Age-Related Macular Degeneration: Relative Roles of Genetic and Environmental Influences Arch Ophthalmol, March 1, 2005; 123(3): 321 - 327. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. McKay, S. Clarke, J. A. Davis, D. A. C. Simpson, and G. Silvestri Pigmented Paravenous Chorioretinal Atrophy Is Associated with a Mutation within the Crumbs Homolog 1 (CRB1) Gene Invest. Ophthalmol. Vis. Sci., January 1, 2005; 46(1): 322 - 328. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. V. Johnson and D. H. Anderson Age-Related Macular Degeneration and the Extracellular Matrix N. Engl. J. Med., July 22, 2004; 351(4): 320 - 322. [Full Text] [PDF] |
||||
![]() |
E. M. Stone, T. A. Braun, S. R. Russell, M. H. Kuehn, A. J. Lotery, P. A. Moore, C. G. Eastman, T. L. Casavant, and V. C. Sheffield Missense Variations in the Fibulin 5 Gene and Age-Related Macular Degeneration N. Engl. J. Med., July 22, 2004; 351(4): 346 - 353. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

















