Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (19)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Flori, L.
Right arrow Articles by Rihet, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Flori, L.
Right arrow Articles by Rihet, P.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2003, Vol. 12, No. 4 375-378
© 2003 Oxford University Press

Linkage of mild malaria to the major histocompatibility complex in families living in Burkina Faso

Laurence Flori, Serge Sawadogo, Christelle Esnault, Nicolas Frédéric Delahaye, Francis Fumoux and Pascal Rihet*

Université de la Méditerranée, Marseille, France

Received October 9, 2002; Revised November 27, 2002; Accepted November 29, 2002


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Tumor necrosis factor alpha (TNF{alpha}) is thought to be a critical mediator of malaria fever, and mild malaria was previously reported to be linked to the MHC region containing the tumor necrosis factor alpha gene (TNF). Thirty-four families from Burkina Faso were analyzed to test for linkage between polymorphisms within the MHC region and mild malaria using the maximum-likelihood-binomial (MLB) program. Two-point analysis indicated linkage of mild malaria to TNFd (LOD=3.27; P= 5.44x10-5). Using multipoint analysis, we also found evidence for linkage of mild malaria to the MHC region, with a peak close to TNF (LOD=3.86; P=1.22x10-5). Our results support genes within the MHC region being involved in mild malaria. In particular, the genetic variation within TNF may influence susceptibility to mild malaria. Nevertheless, TNF-238, TNF-244 and TNF-308 polymorphisms are unlikely to explain linkage of mild malaria to the MHC region, and the causal mutations remain to be identified.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
A growing body of evidence suggests that the susceptibility to human malaria is influenced by genetic factors. Genetic factors have been shown to control mild malaria (1), blood infection levels (25) (MIM248310, Online Mendelian Inheritance in Man; www.ncbi.nlm.nih.gov/Omim), and to regulate anti malarial immune responses (6,7). Case–control studies have detected associations between severe malaria and several candidate genes, including genes within the MHC. The class I antigen, HLA-B53 (MIM142830), and the class II haplotype, DRB1*1302-DQB1*0501 (MIM142857), were associated with resistance to severe malaria (8). Furthermore, high serum levels of tumor necrosis factor alpha (TNF{alpha}) and polymorphisms in the TNF{alpha} gene (MIM191160) have been associated with increased susceptibility to severe malaria (911). The importance of chromosome 6p21–p23 in the control of the disease was further supported by a linkage study conducted on Gambian twins: the genetic analysis of sibling pairs concordant for mild malaria showed evidence of linkage at the TNF locus (12). This result was consistent with clinical observations, indicating that TNF{alpha} is a critical mediator of malaria fever (13,14). We present here a strong linkage between the MHC region and mild malaria in an urban population living in an endemic area in Burkina Faso.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Two-point maximum likelihood binomial-LODs (MLB-LOD) for D6S276, TNFb and TNFd were 0.82, 0.71 and 3.27, respectively (Table 1). The other markers of the region showed no evidence of linkage (P>0.05; Table 1). It should be stressed that heterozygosity and genetic information content were less than 16% for TNF-238, TNF-244 and TNF-308. The allele frequencies were 0.978 and 0.022 for TNF-238G and TNF-238A, 0.956 and 0.044 for TNF-244G and TNF-244A, and 0.917 and 0.083 for TNF-308G and TNF-308A.


View this table:
[in this window]
[in a new window]
 
Table 1. Results of the two-point linkage analysis of mild malaria.
 
Nevertheless, the information content of the inheritance pattern at each point of the 6p21–p22 region, computed with multipoint analysis, ranged from 80 to 97%. Multipoint linkage analysis in the whole region (Fig. 1) yielded an MLB-LOD of 3.86 (ZMLB=4.22; P=1.22x10-5), with a peak very close to the TNF markers. A MLB-LOD of 3.0 (ZMLB=3.71; P=0.0001) was achieved in the interval between D6S276 and the TNF markers.



View larger version (9K):
[in this window]
[in a new window]
 
Figure 1. Results of the multipoint linkage analysis of mild malaria. The horizontal axis corresponds to the partial genetic map of chromosome 6p21–p22. Genetic distances between markers are expressed in centiMorgans. The vertical axis indicates the MLB-LOD scores obtained with the multipoint analysis at each point in the studied interval. The position of the markers relative to the MHC class I and class II regions is stated.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
We obtained strong evidence of linkage between mild malaria and the MHC region by using two-point and multipoint analyses, with a peak close to the TNF{alpha} gene. Our findings strengthen a previous two-point linkage analysis, which showed a linkage at the 0.001 significance level: twins concordant for mild malaria had an excess allele sharing at the TNF locus (12). Since changes in blood TNF{alpha} levels closely precede the peak of fever (13), and since anti-TNF{alpha} therapy inhibits fever in children with cerebral malaria, TNF{alpha} is thought to be a critical factor in malaria fever (14). Our data, taken together with the clinical studies, suggest the existence of a causal(s) mutation(s) within the TNF{alpha} gene. Nevertheless, the TNF-238 and TNF-308 alleles that are associated with severe malaria (11,15) are very low in the study population, and unlikely influence the risk of malaria attack in the population. This observation is consistent with the absence of association, in other studies, between the TNF-238 and TNF-308 polymorphisms and mild malaria (16,17). This raises the possibility that different mutations within the TNF{alpha} gene may cause mild malaria and severe malaria. In the same way, different TNF promoter alleles have been shown to be associated with severe malarial anemia and cerebral malaria (18).

Other genes in the same chromosomal region may also be involved in malaria pathogenesis. In particular, the tumor necrosis factor ß gene, which is very close to TNF, presents DNA sequence homology with TNF. TNFß cytokine is produced only by lymphocytes, and TNF{alpha} is produced by macrophages, NK cells, neutrophils, mast cells and lymphocytes. Both cytokines recognize the same cell surface receptors, and have numerous similar effects (19). Nevertheless, the role of TNFß in human malarial disease remains to be studied (20). The HLA-B and HLA-DR loci were previously associated with severe malaria (8). They may also be involved in mild malaria, yet case–control studies failed to detect a clear-cut association (21).

Our data support that genes within the MHC region influence the outcome of malarial infection. In particular, TNF is probably involved in susceptibility to severe and mild malaria. However, it seems unlikely that TNF-238 and TNF-308 alleles associated with resistance to severe malaria strongly influence mild malaria. The question of whether the same alleles cause mild and severe forms of the disease remains an issue to be addressed.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Subjects
We studied 34 families that included 197 individuals. The families had the following distribution of sibship sizes: 3, 12, 8, 8, 2 and 1 sibships contained 2, 3, 4, 5, 6 and 7 sibs, respectively. The mean age of sibs was 12.1±6.2 years (range 1–34 years). The study population and the area of parasite exposure have been described (4,5). The seasonal parasite transmission intensity was homogeneous within the area. The whole population volunteered to participate in the study, and all participants were clearly informed of the objective and the protocol. The Medical Authority of Burkina Faso approved the study protocol.

Clinical data and phenotype determination
Active case detection of febrile episodes was done once a week during the season of malaria transmission. All subjects filled out a questionnaire about symptoms that occurred during the week.

The axillary temperature was recorded for every subject who complained of illness during the visit or the previous days. For patients with fever, a thick blood film was prepared following the standard procedures. Parasite determination and numeration were immediately established as described previously (22). A diagnosis of malaria attack was based on P. falciparum parasitemia and clinical symptoms, fever (axillary temperature more than 37.5°C) and the classical symptoms (headache, aching, vomiting or diarrhea in the children); in that case no threshold of parasitemia was used. In the absence of classical symptoms of malaria, and where other pathologies could not be eliminated, only children with more than 5000 infected red blood cells per µl and adults with more than 2000 infected red blood cells per µl were considered as having had a malaria attack. The successive malaria attacks separated by less than 3 weeks are not considered new ones. According to the recommendation of the CNLP (Centre National de Lutte Contre le Paludisme) of Burkina Faso, each episode of illness was treated with 25 mg/kg chloroquine during 3 days or until recovery. Parasitemia was checked at the end of the treatment.

Fifty-nine of the 197 family members (55 sibs and four parents) presented at least one uncomplicated malaria attack during the survey. They were considered in the analysis as affected individuals. Sibs from five families were unaffected. Eleven, 12, 5 and 1 families contained 1, 2, 3 and 5 affected sibs, respectively.

To take into account the influence of known covariates on the phenotype, we performed logistic regression using the SPSS software (SPSS, Boulogne, France). Since age and hemoglobin genotype are known to influence the development of malaria attacks (2325), we adjusted the logit of the probability P of malaria attack for age and hemoglobin genotype (25). The residual z of the logistic regression model was used in linkage analyses. All the sibs were included in linkage analyses.

Molecular methods
DNA microsatellite analysis was performed according to Vignal et al. (26) with DNA extracted from mononuclear cells separated by Ficoll–Hypaque density gradient. The DNA from the M134702 cell line was used as reference. The polymerase chain reaction primers (GENSET) consisted of four highly polymorphic markers of the 6p21–p22 region (D6S276, TNFd, TNFb and D6S291; Genethon; www.genethon.fr) and of TNF promoter region (11,15,27,28). The TNFd and TNFb markers are, respectively, 9.7 and 7.2 kb distal to TNF. The biallelic typing of TNF was performed using the single-strand conformational polymorphisms method. A fragment of 139 bp, which includes a single base polymorphism at -238 and -244, and a fragment of 107 bp, which includes a single base polymorphism at -308, were amplified from DNA samples by PCR. The following oligonucleotides used as primers were chosen by means of the Primer program (Human Genome Mapping Project; http://menu.hgmp.mrc.ac.uk): 5' ACACACAAATCAGTCAGTGGCC 3' and 5' TCTCGGTTTCTTCTCCATCG 3' for TNF-238 and TNF-244 and 5' AGGCAATAGGTTTTGAGGGGCAT 3' and 5' TCCTCCCTGCTCCGATTCCG 3' for TNF-308. The PCR products were separated by polyacrylamide gel electrophoresis (GENEPHOR, Amersham Pharmacia). The presence of the expected polymorphisms was checked by sequencing with the Big Dye Terminator Cycle Sequencing Ready Reaction Kit (Qiagen) and an ABI 310 automated fluorescent sequencer (PE Biosystems).

Statistical analyses
Nonparametric two-point and multipoint linkage analyses were performed with the MLBGH 2.0 program (29), which uses the general framework of Genehunter program (30). The maximum likelihood binomial (MLB) method, which is based on the binomial distribution of parental marker alleles among affected offspring, overcomes the common problem of multiple sibs by considering the sibship as a whole. The linkage analysis was based on marker allele frequencies from the study sample. The marker map position was based on a previously reported map (28,31), and on the available sequence (Human Genome Working Draft; http://genome.ucsc.edu for human DNA sequences). We used the MLB method in model-free linkage analysis of quantitative traits to assess linkage of the residual z to chromosome 6p21–p22. The quantitative trait method introduces a latent binary variable (0;1) that captures the linkage information between the observed quantitative trait and the marker. We used the fully non-parametric approach with no assumption on the distribution of the residual z. We divided the residual values into 10 consecutive equal subintervals with equal probabilities. The method is expected to specify the probability of the latent variable value according to the observed quantitative trait. We fixed the probability to have a 0 value at 0.95, 0.85, 0.75, 0.65, 0.55, 0.45, 0.35, 0.25, 0.15 and 0.05 for phenotypes belonging to the consecutive deciles (110). The MLB statistics was expressed in terms of a MLB-LOD and a one-sided standard normal deviate, denoted ZMLB.


    ACKNOWLEDGEMENTS
 
We thank Dr Laurent Abel for providing the MLBGH software, and Dr Pierre Pontarotti for helpful advice. We are grateful to the Ministère de la Santé, Ouagadougou, Burkina Faso and the Direction Régionale de la Santé, Bobo-Dioulasso for their encouragement. This research was supported by the French Ministry of Research and Technology, the Fondation pour la Recherche Médicale, the PACA Conseil Régional, and the Conseil Général des Bouches du Rhône. L.F. and S.S. are supported by a studentship from the French Ministry of Research and Technology.


    FOOTNOTES
 
* To whom correspondence should be addressed at: Université de la Méditerranée, IFR 48, Faculté de Pharmacie, Laboratoire d'immunogénétique et de pharmacologie du paludisme-EA 864, 27 Bd Jean Moulin 13385 Marseille Cedex 5, France. Tel: +33 491803674; Fax: +33 491803674; Email: rihet{at}luminy.univ-mrs.fr Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Jepson, A.P., Banya, W.A., Sisay, J.F., Hassan, K.M., Bennett, S. and Whittle, H.C. (1995) Genetic regulation of fever in Plasmodium falciparum malaria in Gambian twin children. J. Infect. Dis., 172, 316–319.[Web of Science][Medline]

  2. Abel, L., Cot, M., Mulder, L., Carnevale, P. and Feingold, J. (1992) Segregation analysis detects a major gene controlling blood infection levels in human malaria. Am. J. Hum. Genet., 50, 1308–1317.[Web of Science][Medline]

  3. Garcia, A., Cot, M., Chippaux, J.P., Ranques, S., Feingold, J., Demenais, F. and Abel, L. (1998) Genetic control of bloof infection levels in human malaria: evidence for a complex genetic model. Am. J. Trop. Med. Hyg., 58, 480–488.[Abstract]

  4. Rihet, P., Abel, L., Traore, Y., Traore-Leroux, T., Aucan, C. and Fumoux, F. (1998) Human malaria: segregation analysis of blood infection levels in a suburban area and a rural area in Burkina Faso. Genet. Epidemiol., 15, 435–450.[CrossRef][Web of Science][Medline]

  5. Rihet, P., Traore, Y., Abel, L., Aucan, C., Traore-Leroux, T. and Fumoux, F. (1998) Malaria in humans: Plasmodium falciparum blood infection levels are linked to chromosome 5q31–q33. Am. J. Hum. Genet., 63, 498–505.[CrossRef][Web of Science][Medline]

  6. Sjoberg, K., Lepers, J.P., Raharimalala, L., Larsson, A., Olerup, O., Marbiah, N.T., Troye, B.M. and Perlmann, P. (1992) Genetic regulation of human anti-malarial antibodies in twins. Proc. Natl Acad. Sci. USA, 89, 2101–2104.[Abstract/Free Full Text]

  7. Aucan, C., Traore, Y., Fumoux, F. and Rihet, P. (2001) Familial correlation of immunoglobulin G subclass responses to Plasmodium falciparum antigens in Burkina Faso. Infect. Immun., 69, 996–1001.[Abstract/Free Full Text]

  8. Hill, A.V., Allsopp, C.E., Kwiatkowski, D., Anstey, N.M., Twumasi, P., Rowe, P.A., Bennett, S., Brewster, D., McMichael, A.J. and Greenwood, B.M. (1991) Common west African HLA antigens are associated with protection from severe malaria. Nature, 352, 595–600.[CrossRef][Medline]

  9. Grau, G.E., Taylor, T.E., Molyneux, M.E., Wirima, J.J., Vassalli, P., Hommel, M. and Lambert, P.H. (1989) Tumor necrosis factor and disease severity in children with falciparum malaria. New Engl. J. Med., 320, 1586–1591.[Abstract]

  10. Kwiatkowski, D., Hill, A.V., Sambou, I., Twumasi, P., Castracane, J., Manogue, K.R., Cerami, A., Brewster, D.R. and Greenwood, B.M. (1990) TNF concentration in fatal cerebral, non-fatal cerebral, and uncomplicated Plasmodium falciparum malaria. Lancet, 336, 1201–1204.[CrossRef][Web of Science][Medline]

  11. McGuire, W., Hill, A.V., Allsopp, C.E., Greenwood, B.M. and Kwiatkowski, D. (1994) Variation in the TNF-alpha promoter region associated with susceptibility to cerebral malaria. Nature, 371, 508–510.[CrossRef][Medline]

  12. Jepson, A., Sisay, J.F., Banya, W., Hassan, K.M., Frodsham, A., Bennett, S., Hill, A.V. and Whittle, H. (1997) Genetic linkage of mild malaria to the major histocompatibility complex in Gambian children: study of affected sibling pairs. Br. Med. J., 315, 96–97.[Free Full Text]

  13. Karunaweera, N.D., Carter, R., Grau, G.E., Kwiatkowski, D., Del Giudice, G. and Mendis, K.N. (1992) Tumour necrosis factor-dependent parasite-killing effects during paroxysms in non-immune Plasmodium vivax malaria patients. Clin. Exp. Immunol., 88, 499–505.[Web of Science][Medline]

  14. Kwiatkowski, D., Molyneux, M.E., Stephens, S., Curtis, N., Klein, N., Pointaire, P., Smit, M., Allan, R., Brewster, D.R., Grau, G.E. et al. (1993) Anti-TNF therapy inhibits fever in cerebral malaria. Q. J. Med., 86, 91–98.[Web of Science][Medline]

  15. Knight, J.C., Udalova, I., Hill, A.V., Greenwood, B.M., Peshu, N., Marsh, K. and Kwiatkowski, D. (1999) A polymorphism that affects OCT-1 binding to the TNF promoter region is associated with severe malaria. Nat. Genet., 22, 145–150.[CrossRef][Web of Science][Medline]

  16. Stirnadel, H.A., Stockle, M., Felger, I., Smith, T., Tanner, M. and Beck, H.P. (1999) Malaria infection and morbidity in infants in relation to genetic polymorphisms in Tanzania. Trop. Med. Int. Health, 4, 187–193.[CrossRef][Web of Science][Medline]

  17. Migot-Nabias, F., Mombo, L.E., Luty, A.J., Dubois, B., Nabias, R., Bisseye, C., Millet, P., Lu, C.Y. and Deloron, P. (2000) Human genetic factors related to susceptibility to mild malaria in Gabon. Genes Immun., 1, 435–441.[CrossRef][Web of Science][Medline]

  18. McGuire, W., Knight, J.C., Hill, A.V., Allsopp, C.E., Greenwood, B.M. and Kwiatkowski, D. (1999) Severe malarial anemia and cerebral malaria are associated with different tumor necrosis factor promoter alleles. J. Infect. Dis., 179, 287–290.[CrossRef][Web of Science][Medline]

  19. Krakauer, T., Vilcek, J. and Oppenheim J.J., (1999) Proinflammatory cytokines TNF and IL-1 families, chemokines, TGF-ß, and others. In Paul, W.E. (ed.), Fundamental Immunology, 4th edn. Lippincott-Raven, Philadelphia, PA, pp. 775–811.

  20. Wattavidanage, J., Carter, R., Perera, K.L., Munasingha, A., Bandara, S., McGuinness, D., Wickramasinghe, A.R., Alles, H.K., Mendis, K.N. and Premawansa, S. (1999) TNFalpha*2 marks high risk of severe disease during Plasmodium falciparum malaria and other infections in Sri Lankans. Clin. Exp. Immunol., 115, 350–355.[CrossRef][Web of Science][Medline]

  21. Bennett, S., Allen, S.J., Olerup, O., Jackson, D.J., Wheeler, J.G., Rowe, P.A., Riley, E.M. and Greenwood, B.M. (1993) Human leucocyte antigen (HLA) and malaria morbidity in a Gambian community. Trans. R. Soc. Trop. Med. Hyg., 87, 286–287.[CrossRef][Web of Science][Medline]

  22. Traore, Y., Rihet, P., Traore-Leroux, T., Aucan, C., Gazin, P., Coosemans, M., Smith, A., Abel, L., Tall, F., Nacro, B. et al. (1999) Analysis of the genetic factors controlling malarial infection in man. Sante, 9, 53–59.[Medline]

  23. Marsh, K., Otoo, L., Hayes, R.J., Carson, D.C. and Greenwood, B.M. (1989) Antibodies to blood stage antigens of Plasmodium falciparum in rural Gambians and their relation to protection against infection. Trans. R. Soc. Trop. Med. Hyg., 83, 293–303.[CrossRef][Web of Science][Medline]

  24. Allen, S.J., Bennett, S., Riley, E.M., Rowe, P.A., Jakobsen, P.H., O'Donnell, A. and Greenwood, B.M. (1992) Morbidity from malaria and immune responses to defined Plasmodium falciparum antigens in children with sickle cell trait in The Gambia. Trans. R. Soc. Trop. Med. Hyg., 86, 494–498.[CrossRef][Web of Science][Medline]

  25. Aucan, C., Traore, Y., Tall, F., Nacro, B., Traore-Leroux, T., Fumoux, F. and Rihet, P. (2000) High immunoglobulin G2 (IgG2) and low IgG4 levels are associated with human resistance to Plasmodium falciparum malaria. Infect. Immun., 68, 1252–1258.[Abstract/Free Full Text]

  26. Vignal, A., Gyapay, G., Hazan, J., N'Guyen, S., Dupraz, C., Cheron, N. and Beeuwe, N. (1993) A non-radioactive multiplex procedure for genotyping of microsatellite markers. In Adolph, K. (ed.), Methods in Molecular Genetics 1: Gene and Chromosome Analysis. Academic press, San Diego, CA, pp. 211–221.

  27. Udalova, I.A., Nedospasov, S.A., Webb, G.C., Chaplin, D.D. and Turetskaya, R.L. (1993) Highly informative typing of the human TNF locus using six adjacent polymorphic markers. Genomics, 16, 180–186.[CrossRef][Web of Science][Medline]

  28. Dib, C., Faure, S., Fizames, C., Samson, D., Drouot, N., Vignal, A., Millasseau, P., Marc, S., Hazan, J., Seboun, E. et al. (1996) A comprehensive genetic map of the human genome based on 5,264 microsatellites. Nature, 380, 152–154.[CrossRef][Medline]

  29. Alcais, A. and Abel, L. (1999) Maximum-Likelihood-Binomial method for genetic model-free linkage analysis of quantitative traits in sibships. Genet. Epidemiol., 17, 102–117.[CrossRef][Web of Science][Medline]

  30. Kruglyak, L., Daly, M.J., Reeve, D.M. and Lander, E.S. (1996) Parametric and nonparametric linkage analysis: a unified multipoint approach. Am. J. Hum. Genet., 58, 1347–1363.[Web of Science][Medline]

  31. Fisher, S.E., Marlow, A.J., Lamb, J., Maestrini, E., Williams, D.F., Richardson, A.J., Weeks, D.E., Stein, J.F. and Monaco, A.P. (1999) A quantitative-trait locus on chromosome 6p influences different aspects of developmental dyslexia. Am. J. Hum. Genet., 64, 146–156.[CrossRef][Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Proc R Soc BHome page
H. Westerdahl, J. Waldenstrom, B. Hansson, D. Hasselquist, T. von Schantz, and S. Bensch
Associations between malaria and MHC genes in a migratory songbird
Proc R Soc B, July 22, 2005; 272(1571): 1511 - 1518.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
P. Rihet, L. Flori, F. Tall, A. S. Traore, and F. Fumoux
Hemoglobin C is associated with reduced Plasmodium falciparum parasitemia and low risk of mild malaria attack
Hum. Mol. Genet., January 1, 2004; 13(1): 1 - 6.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (19)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Flori, L.
Right arrow Articles by Rihet, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Flori, L.
Right arrow Articles by Rihet, P.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?