Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (53)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Marziano, N. K.
Right arrow Articles by Forge, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Marziano, N. K.
Right arrow Articles by Forge, A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2003, Vol. 12, No. 8 805-812
DOI: 10.1093/hmg/ddg076
© 2003 Oxford University Press

Mutations in the gene for connexin 26 (GJB2) that cause hearing loss have a dominant negative effect on connexin 30

Nerissa K. Marziano1, Stefano O. Casalotti2, Anne E. Portelli1, David L. Becker3 and Andrew Forge1,*

1UCL Centre for Auditory Research and Institute of Laryngology and Otology, 330-332 Gray's Inn Road, London WC1X 8EE, UK, 2Department of Physiology and 3Department of Anatomy and Developmental Biology, University College London, London, UK

Received November 6, 2002; Accepted January 27, 2003


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Mutations in the gene (GJB2) encoding connexin 26 (cx26) have been linked to sensorineural hearing loss either alone or as part of a syndrome. Here we compare the properties of four cx26 mutants derived from point mutations associated with dominantly inherited hearing loss, either non-syndromic (W44S, R75W) or with various skin disorders (G59A, D66H, R75W). Since cx26 and cx30 are co-localized within the inner ear the effect of the dominant cx26 mutations on both of these wild-type proteins was determined. Communication-deficient HeLa cells were transiently transfected with the various cDNA constructs by microinjection. Dye transfer studies using the gap junction permeant tracer Cascade Blue demonstrated a disruption to the intercellular coupling for all four of the mutant proteins. Immunostaining of the transfected cells revealed that for the G59A and D66H mutants this correlated with impaired intracellular trafficking and targeting to the plasma membrane, as both proteins had a perinuclear localization. The impaired trafficking was rescued by oligomerization both with cx26 and with cx30, suggesting that cx26 and cx30 can form heteromeric connexons. Significantly reduced dye transfer rates were observed between cells co-expressing either cx26 or cx30 together with W44S or R75W compared with the wild-type proteins alone. The dominant actions of the G59A and D66H mutants were only on cx30 and cx26, respectively. We suggest that cx26 and cx30 form heteromeric connexons in vivo, within the inner ear, with particular properties essential for hearing. Disruption of these heteromeric channels by certain mutations may underlie the non-syndromic nature of the deafness.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Hearing loss is the most common sensory deficit in humans with congenital/prelingual deafness affecting ca 1 in 1000 children (1). Approximately half of these cases are genetic in origin, and mutations in the gene GJB2 are the predominant cause of inherited, sensorineural deafness (17). GJB2 encodes the gap junction channel protein connexin 26 (Cx26).

Gap junctions are clusters of intercellular channels that allow direct communication between cells (8,9). Cx26 is one member of a family of related gap-junction channel-forming proteins, each of which is commonly named from its molecular weight (Cx26, Cx30 etc.). The genes for 20 different connexin proteins are present in the human genome (9). Six connexins oligomerise intracellularly to form the gap junction channel unit of an individual cell, a connexon, which is trafficked to the plasma membrane. There, the connexons of one cell align symmetrically with those of its neighbour to create continuous aqueous pores that functionally couple the adjacent cells. Connexons aggregate in the plane of the plasma membrane to form a gap junction plaque. The physiological properties of the different connexin proteins have not been fully elucidated but they differ in the size and charge characteristics of the channel and in their regulatory properties. Most cells that form gap junctions express more than one connexin isotype. There is thus potentially a wide variety of possible gap junction compositions, each with different physiological characteristics (8). All the connexins in an individual connexon maybe of the same type (homomeric) or heteromeric connexons may be formed by oligomerization between different connexins. The connexon composition each side of the junction maybe the same (homotypic junctions) or heterotypic junctions can be formed where the connexons of one cell are different in composition from those of its neighbour. Within the same junction plaque, there maybe separate homomeric, homotypic regions of differing composition (10), or a cell may ferry different connexins to separate locations. In the inner ear cx26 is widely expressed throughout non-sensory epithelial and connective tissue cells (11,12), and is commonly co-expressed with cx30 (13,14).

The clinical consequence of certain mutations in the cx26 gene is exclusively hearing loss (non-syndromic deafness), whereas with other mutations the deafness is part of a syn-drome. In particular, mutations responsible for dominantly-inherited hearing loss can also underlie various skin disorders (6,1521). We have undertaken to determine the properties of the gap junctions in the inner ear essential for hearing by comparing the effects of four mutant cx26 proteins on wild-type cx26 and cx30 in an in vitro expression system. Here we show that heteromeric cx26/cx30 gap junction channels can be formed and that certain mutant proteins can have dominant negative effects on both connexins. This may underlie the non-syndromic character of certain deafness-causing GJB2 mutations.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Localization of mutant cx26 proteins
Human HeLa cells deficient in gap junctional communication (22,23) were transiently transfected with cDNA constructs of wild type (wt) and mutant cx26 by microinjection of plasmids into their nuclei. In initial experiments, the cx26 constructs were injected together with a separate green fluorescent protein (GFP) construct to aid the identification of connexin-expressing cells. Following 24 h incubation, immunolabelling with an antibody specific to the intracellular loop region of cx26 revealed wt cx26 localized to the plasma membrane at points of contact between adjacent GFP-expressing cells, indicating the formation of gap junction plaques (Fig. 1A), as well as being dispersed in the cytoplasm. Similarly the W44S mutation resulted in a protein that was localized to the membrane (Fig. 1B) and dispersed intracellularly. We have shown previously that a further GJB2 mutation at the same site, W44C, also results in a protein that is trafficked to the plasma membrane (24). In contrast, the G59A and D66H mutations resulted in proteins with impaired trafficking. Both were entirely localized intracellularly, and concentrated close to the nucleus (Fig. 1C and D).



View larger version (117K):
[in this window]
[in a new window]
 
Figure 1. Intercellular localization of the wt and mutant cx26 proteins (AH), and functionality of intercellular channels revealed by Cascade Blue dye transfer (IP). All images by epifluorescence. Scale bars 10 µm. (A–D) GFP-expressing HeLa cells stained for cx26 (red). Within cells transfected with wt cx26 (A) and the W44S mutant (B), protein is present at points of contact between neighbouring cells (arrows) and distributed in the cytoplasm. The G59A (C) and D66H (D) mutant proteins are retained within the cytoplasm, concentrated in a region close to the nucleus. (E–H) HeLa cells expressing GFP-tagged cx26 proteins. The wt cx26-GFP (E) and R75W-GFP (F) proteins both traffic to the membrane to form plaques between adjacent cells (arrows). The G59A-GFP (G) and D66H-GFP (H) proteins remain within the cytoplasm, close to the nucleus. (I–L) HeLa cells expressing both wt cx26 (not stained) together with GFP (I) and wt cx26-GFP (K) form gap junction channels with neighbouring cells capable of transferring Cascade Blue (CB) dye (J, L). The asterisk indicates the nucleus of the cell injected. The Arrow in (K) indicates gap junction plaques appearing as labelled puncta outlining the border between adjacent contacting cells. (M–P) HeLa cells expressing the mutant proteins G59A (not stained) together with GFP (M) and R75W-GFP (O) have defective intercellular communication as seen by the lack of Cascade Blue dye transfer (N, P). The asterisk indicates injected cell in each case.

 
To confirm localization patterns, cells were transfected with cx26 constructs that were directly ‘tagged’ with GFP at the C-terminal end of the proteins. For wt cx26-GFP, GFP expression was observed at points of contact between adjacent cells, confirming that the GFP tagging did not interfere with the protein trafficking (25) (Fig. 1E). The R75W-GFP mutant, similar to the W44S mutation observed by immunohistochemistry, also localized to the plasma membrane as shown by the GFP expression (Fig. 1F). However, for the G59A-GFP and D66H-GFP mutants, GFP was localized intracellularly in a similar pattern to that found by immunohistochemistry (Fig. 1G and H).

Each experiment was conducted at least twice with the same results. All micro-injected cells received the same concentration of wt or mutant plasmid and all plasmids produced significant levels of protein expression. Western blotting (not shown) indicated similar levels of expression of wt and mutant proteins by transfected cells. Thus, each of the plasmids appeared to provide for efficient expression of protein under the conditions used.

Intercellular communication between cells expressing the mutant cx26 proteins
In order to explore whether functional intercellular channels are formed, in particular by the mutant proteins that traffic to the plasma membrane, the transfer of the gap junction permeant tracer Cascade Blue (26) between transfected cells was investigated. Dye transfer efficiency was quantified by counting the number of Cascade Blue injected cells from which the dye passed to more than one neighbour. No dye transfer was observed between untransfected HeLa cells (Table 1). HeLa cells transfected with either wt cx26 or wt cx26-GFP cDNA showed a high efficiency of dye transfer (Fig. 1I–L), with no statistically significant difference between the two (Table 1). This confirms that the GFP-tag does not affect the intercellular communication (22,25). All four of the mutants, however, showed altered properties, with little or no dye transfer occurring between transfected cells (Fig. 1M–P and Table 1). While for G59A and D66H this correlates with impaired trafficking of the mutant proteins to the membrane, for W44S and R75W, both of which appear to form gap junction plaques, the results indicate an effect on the ability of these mutant proteins to form properly functional channels.


View this table:
[in this window]
[in a new window]
 
Table 1. Dye transfer efficiency between transfected HeLa cells. The percentage of injected cells that passed dye to more than one neighbour was determined. cb=Cascade Blue; nb=neurobiotin
 
Effects of the mutant proteins on wt cx26
All four of the mutations are reported to result in dominantly inherited hearing loss. Consequently, co-expression studies were carried out to examine the effects of the mutant proteins on wt cx26 in cells micro-injected with equal amounts of the two respective plasmids. Immunolabelling of cells expressing both wt cx26 and the W44S mutant revealed a staining pattern similar to that found with W44S alone. These cells exhibited reduced Cascade Blue dye transfer efficiency compared to wt cx26 transfected cells (Table 1), suggesting a dominant effect of the mutant on the wt protein. Similarly, co-expression of wt cx26-GFP with R75W-GFP resulted in GFP expression at points of contact between adjacent cells in the same manner as with R75W-GFP alone (Fig. 2A). Dye transfer between these cells was completely inhibited (Fig. 2B and Table 1), indicating that the R75W mutant has a strong dominant negative action on the wt protein.



View larger version (70K):
[in this window]
[in a new window]
 
Figure 2. Co-expression of mutant proteins with wt cx26. Epifluorescence images. Scale bars 10 µm. (A, B) HeLa cells co-expressing wt cx26-GFP and R75W-GFP form gap junction plaques between adjacent cells (A) but are unable to transfer Cascade Blue dye (CB) (B) [the asterisk in (A) indicates injected cell]. (C, E) Images of GFP-expressing HeLa cells co-transfected with wt cx26 and either G59A (C) or D66H (E) immunostained for cx26 (red). Arrows indicate plaques at points of contact between adjacent cells and intracellular labelling for connexin is reduced in comparison with mutant protein alone (Fig. 1C and D). (D, F) Co-expression of wt cx26 with either G59A-GFP (D) or D66H-GFP (F) reveals mutant protein at the membrane at points of contact between adjacent cells (arrows).

 
Co-expression of either the G59A or D66H mutants with wt cx26 resulted in a change from the cytoplasmic localization of these mutant proteins previously observed (Fig. 1C and D). Initial immunolabelling of co-transfected cells revealed protein at the plasma membrane at points of contact between adjacent cells (Fig. 2C and E). To exclude the possibility that the antibody was detecting only wt cx26 at the membrane, and to identify the cellular location of the mutant proteins, cells were co-transfected (1:1) with GFP-tagged mutant and untagged wt cx26 cDNA. Junctional GFP expression showed that both mutant proteins were incorporated into gap junction plaques at the plasma membrane (Fig. 2D and F), demonstrating that their impaired trafficking can be rescued by wt cx26. In cells co-transfected with wt cx26 and D66H Cascade Blue dye transfer efficiency was significantly reduced. However, a dominant action could not be demonstrated for the G59A mutant (Table 1).

Effects of the mutant proteins on wt cx30
This latter finding, together with observations that cx26 and cx30 are co-expressed in the inner ear (13,14), prompted an investigation into the effects of the wt and mutant cx26 proteins on wt cx30. Immunolabelling of HeLa cells co-transfected with wt cx26-GFP and wt cx30 cDNA (at 1:1 ratio) with an antibody specific to cx30 revealed that both proteins were expressed almost equally in individual co-transfected cells and were co-localized at points of contact between adjacent cells (Fig. 3A). This result demonstrates that both connexins can be trafficked to the same gap junction plaque. Cells expressing cx30 do not transfer Cascade Blue (Table 1) or the related dye Lucifer Yellow, but are permeant to the smaller gap junction tracer neurobiotin (27) (Table 1) [which also passes through channels formed by cx26 (27)]. Similarly, the cells co-expressing both wt proteins were unable to transfer Cascade Blue or Lucifer Yellow but did pass neurobiotin (Fig. 3B and Table 1). The inability of the cells to transfer the larger dyes despite the presence at the membrane of cx26 suggests that cx30 interacts with cx26 modifying its permeability properties. Neurobiotin transfer efficiency between co-transfected cells was not significantly different from that of cells expressing cx30 alone (Table 1). No neurobiotin transfer was observed between untransfected HeLa cells (Table 1).



View larger version (107K):
[in this window]
[in a new window]
 
Figure 3. Co-expression of mutant cx26 proteins with wt cx30. Confocal images. Scale bars: 10 µm; (A) HeLa cells co-transfected with wt cx30 and wt cx26-GFP and immunostained for cx30 (red) reveal co-localization of the two proteins at the membrane (yellow, arrow). (B) Neurobiotin (NB) (red), but not Lucifer Yellow (LY) (yellow), passes between the co-transfected cells. (C) HeLa cells co-expressing wt cx30 and G59A-GFP and immunostained for cx30 (red; arrowhead, area enlarged in E) reveal co-localization of the two proteins at the membrane (yellow; short arrow, area enlarged in F; and elsewhere). Where no cx30 is present the GFP expression remains cytoplasmic (long arrow; area enlarged in D). (G) HeLa cells co-expressing wt cx30 and R75W-GFP and immunostained for cx30 (blue) reveal co-localization of the two proteins (blue-green at arrowhead and elsewhere). The transfer efficiency of neurobiotin (NB) (red) is significantly reduced.

 
To investigate further the possibility of interaction between cx26 and cx30 proteins, HeLa cells were co-transfected, at 1:1 ratio, with wt cx30 and G59A-GFP or D66H-GFP mutant constructs. GFP expression was observed at adjoining plasma membranes within both the G59A-GFP (Fig. 3C–F) and D66H-GFP transfected cells. Since the G59A and D66H mutant proteins, when expressed alone, do not traffic to the membrane, their appearance in plasma membrane plaques indicates that cx30, like wt cx26, can rescue the impairment in trafficking. Immunolabelling of the co-transfected cells with an antibody specific to cx30 revealed co-localization of wt cx30 and the mutant proteins (Fig. 3C and D). Interestingly, the GFP expression was cytoplasmic within cells where no cx30 was detected (Fig. 3C and D). Dye transfer studies revealed a significant decrease in the ability of cells co-expressing wt cx30 and the mutants W44S, R75W (Fig. 3G) or G59A to transfer neurobiotin to neighbouring cells (Table 1). These results show that the two mutations that have been associated with non-syndromic deafness, W44S (14) and R75W (15), produce proteins that have a dominant negative action on both cx26 and cx30. Interestingly, the dominant action of G59A appears to be only upon cx30, as it caused a significant reduction in the ability of the wt protein to form functional intercellular communication pathways (Table 1). In contrast, the D66H mutant has a dominant action only upon cx26 as no significant impairment of transfer of neurobiotin between cells expressing D66H and wt cx30 was observed.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The results from these co-expression studies suggest that cx26 and cx30 can oligomerize to form heteromeric connexons. First, wt cx26 and wt cx30 co-localize to the same gap junction plaques and the permeability properties of wt cx26 are altered when it is present in gap junction plaques that also contain cx30. This change in permeability properties is unlikely to be due merely to a much greater level of cx30 expression than of cx26. GFP-tagging clearly showed cx26 present at high levels in all cells which also labelled positively with antibodies specific for cx30 and consistently plasma membrane plaques that were intensely labelled for cx30 also showed intense GFP fluorescence (Fig. 3C). Furthermore, dye transfer was examined over a prolonged period, so that if cx26-only channels were present, separately from cx30 but at a low level, transfer of cascade blue would have been detected. Thus, a direct interaction between wt cx26 and wt cx30 that affects the functioning of the gap junction channels is indicated. Second, cx30 can rescue the defective trafficking of certain mutant cx26 proteins. Connexins oligomerize intracellularly to form connexons which are then trafficked to the plasma membrane. The presence of significant levels of GFP at the plasma membrane when the normally trafficking-defective mutant proteins tagged with GFP are co-expressed with wt cx30 therefore indicates the ability of cx30 to oligomerize with cx26. Third, mutant cx26 proteins impair the permeability of cx30 channels. Although we did not examine in this study whether the mutant cx26 proteins on their own or in conjunction with cx26 affected the ability of gap junction channels to transfer neurobiotin, the impairment of neurobiotin transfer between cells that were clearly expressing both wt cx30 and certain mutant cx26 proteins compared with cells expressing only wt cx30 can only have occurred because of an interaction between those mutant cx26 proteins and wt cx30. Taken together, therefore, these results are highly suggestive that cx26 and cx30 form heteromeric connexons. Sucrose gradient analysis and immunoprecipitation (24) would provide further confirmation and help resolve the interesting question of the ratio of the two connexins within individual connexons. It would also be of interest to compare in detail whether and to what extent different individual point mutations in the connexin gene affect the ionic and dye transfer selectivity of homomeric and heteromeric gap-junctions hemi-channels as a means of analysing structure–function relationships in the connexin molecule. This is a subject of further investigations.

Heteromeric channels composed of cx26 and cx30 will have particular physiological properties, different from those of either cx26 or cx30 alone and may exist in the inner ear. Immunohistochemistry of inner ear tissues has shown that cx26 and cx30 co-localize (13,14), and immunogold labelling has demonstrated that individual gap junction plaques throughout the inner ear contain both cx26 and cx30 and the labelling for each is evenly distributed along both sides of gap junction section profiles (A. Forge, unpublished data), a labelling pattern consistent with heteromeric channels. Preliminary immunoprecipitation studies (S. Casalotti, unpublished data) also suggest the presence of heteromeric cx26/cx30 channels in the cochlea but this needs confirmation. Furthermore, both mice deficient in cx30 (9) and mice where cx26 has been ablated from the supporting cells of the cochlear sensory epithelium (28) show severe hearing impairment, suggesting that in the inner ear these connexins do not complement each other. Although at least two other connexins, cx31 and cx43, have been localized in the cochlea (2931), cx26 and cx30 are more widespread in their distribution and are present together in regions where neither of the other two connexins are identified. Thus, these other connexins may not be able to compensate for defects in either cx26 or cx30. In the skin, at least 10 connexins are expressed, including cx26 and cx30, but in normal skin these two connexins localize to different cell types (32,33). Co-localization of cx26 and cx30 is observed in various skin disorders, including those caused by cx26 mutations (6,20,32) and it has been suggested that mutations in the cx26 gene may affect differentiation. The targetted ablation of cx26 from the organ of Corti, however, does not appear to affect the normal development and cellular differentiation of cochlear tissues (28).

The cx26/cx30 combination may, thus, be uniquely suited to the physiological requirements of the inner ear, where gap junction channels are thought to play a role in potassium homeostasis (11,12,34), and to be essential for normal hearing. The present finding that certain mutations in GJB2 result in proteins that have a negative effect on both wt cx26 and cx30 could, therefore, provide one explanation for the non-syndromic deafness they cause: namely, the mutant proteins affect the ability of heteromeric junctions to function effectively. The W44S and R75W mutations are more closely associated with hearing loss than either G59A of D66H. Both are reported to cause non-syndromic hearing loss, although R75W has also been associated with a relatively mild case of a skin disorder, palmoplantar keratoderma (16). R75W also causes profound hearing loss and while the level of hearing impairment caused by W44S has not been reported, another mutation at the same site, W44C produces profound, non-syndromic deafness (35). The W44S and R75W mutations also appear to have more profound effects on intercellular communication than either of the other two mutations studied. Both of them significantly affect both wt cx26 and cx30. The most common GJB2 deafness mutation in Caucasian populations is 35delG, in which the protein is truncated in the N-terminal region and is effectively a ‘knockout’ (3,4,7). This mutation is recessive and non-syndromic, with deafness as the only phenotype. Individuals homozygous for 35delG may be expected to produce cx30 normally, but have no cx26 in inner ear tissues. We suggest that it is the lack of heteromeric junctions that results in the impaired auditory function when this mutation is present.

The two mutations examined that are consistently associated with skin diseases, as well as hearing loss, G59A and D66H, both show impaired trafficking. Mutations in the cx31 gene that are associated with skin disorders have also been found to produce proteins that are not trafficked to the membrane (36). The G59A and D66H mutations are both located at the apex of the first extracellular loop of the protein, suggesting that this region may play a role in protein targeting, but it would appear not to be necessary for oligomerization. Both of these mutant proteins are incorporated into gap junction plaques when co-expressed with either wt cx26 or wt cx30 suggesting that the proteins are able to oligomerize to form connexons. However, only one of them, G59A, appears to impede dye transfer when present in gap junction plaques with cx30; the other, D66H, does not. This latter mutation affects only wt cx26, which G59A does not. This suggests that not all mutations in the cx26 gene exert their negative effects in the same way, and that there are properties of these mutant proteins that cannot be detected by our system but which are essential within the skin.

The demonstration of functional interaction between cx26 and cx30 opens a new line of investigation for aiding the understanding of the leading genetic cause for hearing impairment as this oligomeric complex may play a unique and critical role in the inner ear. Future work is needed to determine the precise role of the different connexin isotypes within the skin and inner ear.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Preparation of cDNA constructs
Wt cx26 and wt cx26-GFP containing full length rat cx26 cDNA cloned into pCR3 (Invitrogen) and pEGFP-N1 (Clontech) plasmids respectively were a gift of H. Evans and P. Martin (20). Point mutations were generated using the QuikChange (Stratagene) site-directed mutagenesis method. Oligonucleotides were synthesized with one mutated base and 15 flanking bases on each side. The mutated bases were: W44S, G->C at nucleotide 131 resulting in Trp->Ser at codon 44; G59A, C->G at nucleotide 176 resulting in Glu->Arg at codon 59; D66H, G->C at nucleotide 196 resulting in Asp->His at codon 66; R75W, C->T at nucleotide 223 resulting in Arg->Trp at codon 75. Numbering refers to Genbank clone X51615. All mutations were checked by sequencing. Wt cx30 was generated by RT–PCR amplification of mouse heart mRNA using forward primer CGTAGAAGCTTGAATAAGCCTGCACGATGGAC and reverse primer CGTAGTCTAGAGCTCACCTACACTTGACCTTG containing flanking Hind III and Xba I restriction sites for directional cloning into pCR3. The sequence was confirmed to be identical to Genbank clone Z70023. Mouse and rat cx26 and cx30 coding sequences are highly conserved including all the sites of the point mutations analysed in this work.

Microinjection of plasmids
Plasmids (300 µg/ml in 0.3 mM EDTA and 3 mM Tris, pH 7.4) were microinjected into HeLa cells (Ohio strain 84121901; www.ecacc.org) as previously described (18) using an Eppendorf microinjection system set at 100 h Pa for 0.2 s. Cells were cultured for a further 24 h and either utilized for dye injection studies or fixed with 4% paraformaldehyde and immunostained. The combinations of plasmids micro-injected were: (a) P-lantern GFP plasmid (Promega) with a plasmid containing either wt-cx26, W44S, G59A or D66H; (b) either G59A-GFP, D66H-GFP, R75W-GFP or wt cx30 alone; (c) wt-Cx26 with either wtG59A-GFP, D66H-GFP, R75W-GFP or W44S; (d) wt-Cx30 with either wt-cx26-GFP, W44S, G59A-GFP, D66H-GFP or R75W-GFP.

Immunohistochemistry
Fixed HeLa cells were rinsed briefly with phosphate-buffered saline (PBS, pH 7.4) and then immersed in blocking solution (0.1 M phosphate buffer, 100 mM L-lysine, 1% dried skimmed milk) together with 0.15% Triton X-100 for 1 h at room temperature. Cells were then incubated with primary rabbit antibodies against cx26 (a gift from H. Evans; 1:100) or cx30 (Zymed; 1:200) in blocking solution overnight at 4°C. Following 6x10 min washes with PBS, cells were incubated with rhodamine-conjugated swine anti-rabbit IgG (Dako; 1:150) for 1 h at room temperature. Preparations were examined on either a Leica SP laser scanning confocal microscope or a Nikon fluorescence microscope and images stored digitally. Images were processed using Adobe Photoshop 6TM.

Injection of tracer dyes
Dye injection studies were carried out as previously described (30). In brief, HeLa cells expressing GFP were visualized on a Leica fixed stage epifluorescence microscope. Pairs or groups of GFP positive cells were selected and a single cell iontophoretically injected with either Cascade Blue or Lucifer Yellow (Sigma) alone, or together with 2% Neurobiotin (Vector). Passage of Lucifer Yellow or Cascade Blue was monitored visually for two minutes and recorded digitally with a Leica DC200 camera. To reveal the distribution of Neurobiotin, preparations were fixed with 4% paraformaldehyde, permeabilised and stained with Avidin-CY3 (Zymed). Fluorescent signals were examined on a confocal microscope and images stored digitally. In some cases injected preparations were further immunostained for connexins, in which case contrasting fluorphores of Alexa350 (Molecular Probes) and CY5 (Zymed) were used as secondaries.

Statistical analyses
The chi-squared test was used for all statistics. Statistical significance was assigned to P-values of <0.05.


    ACKNOWLEDGEMENTS
 
We are grateful to Professor Howard Evans and Dr Patricia Martin for gifts of plasmids and polyclonal cx26 antibody, and to Jane Pendjiky for preparing the figures. The work was supported by the Wellcome Trust.


    FOOTNOTES
 
* To whom correspondence should be addressed. Tel: +44 2079151469; Fax: +44 2078379279; Email: a.forge{at}ucl.ac.uk Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Bitner-Glindzicz, M. (2002) Hereditary deafness and phenotyping in humans. Br. Med. Bull., 63, 73–94.[Abstract/Free Full Text]

  2. Rabionet, R., Gasparini, P. and Estivill, X. (2002) Connexins and deafness homepage. www.crg.es/deafness/

  3. Denoyelle, F., Weil, D., Maw, M.A., Wilcox, S.A., Lench, N.J., Allen-Powell, D.R., Osborn, A.H., Dahl, H.H., Middleton, A., Houseman, M.J. et al. (1997) Prelingual deafness: high prevalence of a 30delG mutation in the connexin 26 gene. Hum. Mol. Genet., 6, 2173–2177.[Abstract/Free Full Text]

  4. Estivill, X., Fortina, P., Surrey, S., Rabionet, R., Melchionda, S., D'Agruma, L., Mansfield, E., Rappaport, E., Govea, N., Mila, M. et al. (1998) Connexin-26 mutations in sporadic and inherited sensorineural deafness. Lancet, 351, 394–398.[CrossRef][ISI][Medline]

  5. Kelsell, D.P., Dunlop, J., Stevens, H.P., Lench, N.J., Liang, J.N., Parry, G., Mueller, R.F. and Leigh, I.M. (1997) Connexin 26 mutations in hereditary non-syndromic sensorineural deafness. Nature, 387, 80–83.[CrossRef][Medline]

  6. Kelsell, D.P., Di, W.L. and Houseman, M.J. (2001) Connexin mutations in skin disease and hearing loss. Am. J. Hum. Genet., 68, 559–568.[CrossRef][ISI][Medline]

  7. Zelante, L., Gasparini, P., Estivill, X., Melchionda, S., D'Agruma,L., Govea, N., Mila, M., Monica, M.D., Lutfi, J., Shohat, M. et al. (1997) Connexin26 mutations associated with the most common form of non-syndromic neurosensory autosomal recessive deafness (DFNB1) in Mediterraneans. Hum. Mol. Genet., 6, 1605–1609.[Abstract/Free Full Text]

  8. Kumar, N.M. and Gilula, N.B. (1996) The gap junction communication channel. Cell, 84, 381–388.[CrossRef][ISI][Medline]

  9. Willecke, K., Eiberger, J., Degen, J., Eckardt, D., Romualdi, A., Guldenagel, M., Deutsch, U. and Sohl, G. (2002) Structural and functional diversity of connexin genes in the mouse and human genome. Biol. Chem., 383, 725–737.[CrossRef][ISI][Medline]

  10. Falk, M.M. (2000) Connexin-specific distribution within gap junctions revealed in living cells. J. Cell Sci., 113, 4109–4120.[Abstract]

  11. Forge, A., Becker, D., Casalotti, S., Edwards, J., Evans, W.H., Lench, N. and Souter, M. (1999) Gap junctions and connexin expression in the inner ear. Novartis Found. Symp., 219, 134–150.[ISI][Medline]

  12. Kikuchi, T., Kimura, R.S., Paul, D.L. and Adams, J.C. (1995) Gap junctions in the rat cochlea: immunohistochemical and ultrastructural analysis. Anat. Embryol., 191, 101–118.[Medline]

  13. Lautermann, J., ten Cate, W.J., Altenhoff, P., Grummer, R., Traub, O., Frank, H., Jahnke, K. and Winterhager, E. (1998) Expression of the gap-junction connexins 26 and 30 in the rat cochlea. Cell Tissue Res., 294, 415–420.[CrossRef][ISI][Medline]

  14. Forge, A., Becker, D., Casalotti, S., Edwards, J., Marziano, N. and Nickel, R. (2002) Connexins and gap junctions in the inner ear. Audiol. Neurootol., 7, 141–145.[CrossRef][Medline]

  15. Heathcote, K., Syrris, P., Carter, N.D. and Patton, M.A. (2000) A connexin 26 mutation causes a syndrome of sensorineural hearing loss and palmoplantar hyperkeratosis (MIM 148350). J. Med. Genet., 37, 50–51.[Abstract/Free Full Text]

  16. Kelsell, D.P., Wilgoss, A.L., Richard, G., Stevens, H.P., Munro, C.S. and Leigh, I.M. (2000) Connexin mutations associated with palmoplantar keratoderma and profound deafness in a single family. Eur. J. Hum. Genet., 8, 468.

  17. Janecke, A.R., Nekahm, D., Loffler, J., Hirst-Stadlmann, A., Muller, T. and Utermann, G. (2001) De novo mutation of the connexin 26 gene associated with dominant non-syndromic sensorineural hearing loss. Hum. Genet., 108, 269–270.[CrossRef][ISI][Medline]

  18. Maestrini, E., Korge, B.P., Ocana-Sierra, J., Calzolari, E., Cambiaghi, S., Scudder, P.M., Hovnanian, A., Monaco, A.P. and Munro, C.S. (1999) A missense mutation in connexin26, D66H, causes mutilating keratoderma with sensorineural deafness (Vohwinkel's syndrome) in three unrelated families. Hum. Mol. Genet., 8, 1237–1243.[Abstract/Free Full Text]

  19. Richard, G., White, T.W., Smith, L.E., Bailey, R.A., Compton, J.G., Paul, D.L. and Bale, S.J. (1998) Functional defects of Cx26 resulting from a heterozygous missense mutation in a family with dominant deaf-mutism and palmoplantar keratoderma. Hum. Genet., 103, 393–399.[CrossRef][ISI][Medline]

  20. Richard, G., Rouan, F., Willoughby, C.E., Brown, N., Chung, P., Ryynanen, M., Jabs, E.W., Bale, S.J., DiGiovanna, J.J., Uitto, J. et al. (2002) Missense mutations in GJB2 encoding connexin-26 cause the ectodermal dysplasia keratitis-ichthyosis-deafness syndrome. Am. J. Hum. Genet., 70, 1341–1348.[CrossRef][ISI][Medline]

  21. van Steensel, M.A., van Geel, M., Nahuys, M., Smitt, J.H. and Steijlen, P.M. (2002) A novel connexin 26 mutation in a patient diagnosed with keratitis-ichthyosis-deafness syndrome. J. Invest. Dermatol., 118, 724–727.[CrossRef][ISI][Medline]

  22. George, C.H., Martin, P.E. and Evans, W.H. (1998) Rapid determination of gap junction formation using HeLa cells microinjected with cDNAs encoding wild-type and chimeric connexins. Biochem. Biophys. Res. Commun., 247, 785–789.[CrossRef][ISI][Medline]

  23. Elfgang, C., Eckert, R., Lichtenberg-Frate, H., Butterweck, A., Traub, O., Klein, R.A., Hulser, D.F. and Willecke, K. (1995) Specific permeability and selective formation of gap junction channels in connexin-transfected HeLa cells. J. Cell Biol., 129, 805–817.[Abstract/Free Full Text]

  24. Martin, P.E., Coleman, S.L., Casalotti, S.O., Forge, A. and Evans, W.H. (1999) Properties of connexin26 gap junctional proteins derived from mutations associated with non-syndromal heriditary deafness. Hum. Mol. Genet., 8, 2369–2376.[Abstract/Free Full Text]

  25. Paemeleire, K., Martin, P.E., Coleman, S.L., Fogarty, K.E., Carrington, W.A., Leybaert, L., Tuft, R.A., Evans, W.H. and Sanderson, M.J. (2000) Intercellular calcium waves in HeLa cells expressing GFP-labeled connexin 43, 32, or 26. Mol. Biol. Cell, 11, 1815–1827.[Abstract/Free Full Text]

  26. Becker, D.L., Evans, W.H., Green, C.R. and Warner, A. (1995) Functional analysis of amino acid sequences in connexin43 involved in intercellular communication through gap junctions. J. Cell Sci., 108, 1455–1467.[Abstract]

  27. Manthey, D., Banach, K., Desplantez, T., Lee, C.G., Kozak, C.A., Traub, O., Weingart, R. and Willecke, K. (2001) Intracellular domains of mouse connexin26 and -30 affect diffusional and electrical properties of gap junction channels. J. Membr. Biol., 181, 137–148.[ISI][Medline]

  28. Cohen-Salmon, M., Ott, T., Michel, V., Hardelin, J.P., Perfettini, I., Eybalin, M., Wu, T., Marcus, D.C., Wangemann, P., Willecke, K. et al. (2002) Targeted ablation of connexin26 in the inner ear epithelial gap junction network causes hearing impairment and cell death. Curr. Biol., 12, 1106–1111.[CrossRef][ISI][Medline]

  29. Xia, J.H., Liu, C.Y., Tang, B.S., Pan, Q., Huang, L., Dai, H.P., Zhang, B.R., Xie, W., Hu, D.X., Zheng, D. et al. (1998) Mutations in the gene encoding gap junction protein beta-3 associated with autosomal dominant hearing impairment. Nat. Genet., 20, 370–373.[CrossRef][ISI][Medline]

  30. Xia, A.P., Ikeda, K., Katori, Y., Oshima, T., Kikuchi, T. and Takasaka, T. (2000) Expression of connexin 31 in the developing mouse cochlea. Neuroreport, 11, 2449–2453.[ISI][Medline]

  31. Liu, X.Z., Xia, X.J., Adams, J., Chen, Z.Y., Welch, K.O., Tekin, M., Ouyang, X.M., Kristiansen, A., Pandya, A., Balkany, T. et al. (2001) Mutations in GJA1 (connexin 43) are associated with non-syndromic autosomal recessive deafness. Hum. Mol. Genet., 10, 2945–2951.[Abstract/Free Full Text]

  32. Di, W.L., Rugg, E.L., Leigh, I.M. and Kelsell, D.P. (2001) Multiple epidermal connexins are expressed in different keratinocyte subpopulations including connexin 31. J. Invest. Dermatol., 117, 958–964.[CrossRef][ISI][Medline]

  33. Di, W.L., Common, J.E. and Kelsell, D.P. (2001) Connexin 26 expression and mutation analysis in epidermal disease. Cell. Adhes. Commun., 8, 415–418.

  34. Santos-Sacchi, J. (1991) Isolated supporting cells from the organ of Corti: some whole cell electrical characteristics and estimates of gap junctional conductance. Hear. Res., 52, 89–98.[CrossRef][ISI][Medline]

  35. Denoyelle, F., Lina-Granade, G., Plauchau, H., Bruzzone, R., Chaib, H., Levi-Acobas, F., Weil, D. and Petit, C. (1998) Connexin 26 gene linked to a dominant deafness. Nature, 393, 319–320.[CrossRef][Medline]

  36. Gottfried, I., Landau, M., Glaser, F., Di, W.L., Ophir, J., Mevorah, B., Ben-Tal, N., Kelsell, D.P. and Avraham, K.B. (2002) A mutation in GJB3 is associated with recessive erythrokeratodermia variabilis (EKV) and leads to defective trafficking of the connexin 31 protein. Hum. Mol. Genet., 11, 1311–1316.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Med. Genet.Home page
E A de Zwart-Storm, H Hamm, J Stoevesandt, P M Steijlen, P E Martin, M van Geel, and M A M van Steensel
A novel missense mutation in GJB2 disturbs gap junction protein transport and causes focal palmoplantar keratoderma with deafness
J. Med. Genet., March 1, 2008; 45(3): 161 - 166.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
A Arora, P J Minogue, X Liu, P K Addison, I Russel-Eggitt, A R Webster, D M Hunt, L Ebihara, E C Beyer, V M Berthoud, et al.
A novel connexin50 mutation associated with congenital nuclear pulverulent cataracts
J. Med. Genet., March 1, 2008; 45(3): 155 - 160.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
S. W. Yum, J. Zhang, V. Valiunas, G. Kanaporis, P. R. Brink, T. W. White, and S. S. Scherer
Human connexin26 and connexin30 form functional heteromeric and heterotypic channels
Am J Physiol Cell Physiol, September 1, 2007; 293(3): C1032 - C1048.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X.-Q. Gong, Q. Shao, S. Langlois, D. Bai, and D. W. Laird
Differential Potency of Dominant Negative Connexin43 Mutants in Oculodentodigital Dysplasia
J. Biol. Chem., June 29, 2007; 282(26): 19190 - 19202.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
R. Nickel, D. Becker, and A. Forge
Molecular and functional characterization of gap junctions in the avian inner ear.
J. Neurosci., June 7, 2006; 26(23): 6190 - 6199.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
D. J. Jagger and A. Forge
Compartmentalized and Signal-Selective Gap Junctional Coupling in the Hearing Cochlea
J. Neurosci., January 25, 2006; 26(4): 1260 - 1268.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. J. Minogue, X. Liu, L. Ebihara, E. C. Beyer, and V. M. Berthoud
An Aberrant Sequence in a Connexin46 Mutant Underlies Congenital Cataracts
J. Biol. Chem., December 9, 2005; 280(49): 40788 - 40795.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
F. McCulloch, R. Chambrey, D. Eladari, and J. Peti-Peterdi
Localization of connexin 30 in the luminal membrane of cells in the distal nephron
Am J Physiol Renal Physiol, December 1, 2005; 289(6): F1304 - F1312.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Y. Zhang, W. Tang, S. Ahmad, J. A. Sipp, P. Chen, and X. Lin
Gap junction-mediated intercellular biochemical coupling in cochlear supporting cells is required for normal cochlear functions
PNAS, October 18, 2005; 102(42): 15201 - 15206.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
T. Thomas, K. Jordan, J. Simek, Q. Shao, C. Jedeszko, P. Walton, and D. W. Laird
Mechanisms of Cx43 and Cx26 transport to the plasma membrane and gap junction regeneration
J. Cell Sci., October 1, 2005; 118(19): 4451 - 4462.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
Y. Maeda, K. Fukushima, K. Nishizaki, and R. J.H. Smith
In vitro and in vivo suppression of GJB2 expression by RNA interference
Hum. Mol. Genet., June 15, 2005; 14(12): 1641 - 1650.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
W.-L. Di, Y. Gu, J. E. A. Common, T. Aasen, E. A. O'Toole, D. P. Kelsell, and D. Zicha
Connexin interaction patterns in keratinocytes revealed morphologically and by FRET analysis
J. Cell Sci., April 1, 2005; 118(7): 1505 - 1514.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Roscoe, G. I. L. Veitch, X.-Q. Gong, E. Pellegrino, D. Bai, E. McLachlan, Q. Shao, G. M. Kidder, and D. W. Laird
Oculodentodigital Dysplasia-causing Connexin43 Mutants Are Non-functional and Exhibit Dominant Effects on Wild-type Connexin43
J. Biol. Chem., March 25, 2005; 280(12): 11458 - 11466.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
J. Sun, S. Ahmad, S. Chen, W. Tang, Y. Zhang, P. Chen, and X. Lin
Cochlear gap junctions coassembled from Cx26 and 30 show faster intercellular Ca2+ signaling than homomeric counterparts
Am J Physiol Cell Physiol, March 1, 2005; 288(3): C613 - C623.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
G. M. Essenfelder, R. Bruzzone, J. Lamartine, A. Charollais, C. Blanchet-Bardon, M. T. Barbe, P. Meda, and G. Waksman
Connexin30 mutations responsible for hidrotic ectodermal dysplasia cause abnormal hemichannel activity
Hum. Mol. Genet., August 15, 2004; 13(16): 1703 - 1714.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
P. E.M. Martin and W.H. Evans
Incorporation of connexins into plasma membranes and gap junctions
Cardiovasc Res, May 1, 2004; 62(2): 378 - 387.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Thomas, D. Telford, and D. W. Laird
Functional Domain Mapping and Selective Trans-dominant Effects Exhibited by Cx26 Disease-causing Mutations
J. Biol. Chem., April 30, 2004; 279(18): 19157 - 19168.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
L. Plantard, M. Huber, F. Macari, P. Meda, and D. Hohl
Molecular interaction of connexin 30.3 and connexin 31 suggests a dominant-negative mechanism associated with erythrokeratodermia variabilis
Hum. Mol. Genet., December 15, 2003; 12(24): 3287 - 3294.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
G. Bakirtzis, R. Choudhry, T. Aasen, L. Shore, K. Brown, S. Bryson, S. Forrow, L. Tetley, M. Finbow, D. Greenhalgh, et al.
Targeted epidermal expression of mutant Connexin 26(D66H) mimics true Vohwinkel syndrome and provides a model for the pathogenesis of dominant connexin disorders
Hum. Mol. Genet., July 15, 2003; 12(14): 1737 - 1744.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow