Skip Navigation


Human Molecular Genetics Advance Access originally published online on March 17, 2004
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
13/10/1057    most recent
ddh116v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (21)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Toyo-oka, K.
Right arrow Articles by Wynshaw-Boris, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Toyo-oka, K.
Right arrow Articles by Wynshaw-Boris, A.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2004, Vol. 13, No. 10 1057-1067
DOI: 10.1093/hmg/ddh116
Human Molecular Genetics, Vol. 13, No. 10 © Oxford University Press 2004; all rights reserved

Loss of the Max-interacting protein Mnt in mice results in decreased viability, defective embryonic growth and craniofacial defects: relevance to Miller–Dieker syndrome

Kazuhito Toyo-oka1, Shinji Hirotsune2, Michael J. Gambello1,{dagger}, Zi-Qiang Zhou3, Lorin Olson4, Michael G. Rosenfeld4, Robert Eisenman5, Peter Hurlin3 and Anthony Wynshaw-Boris1,*

1Departments of Pediatrics and Medicine, UCSD Cancer Center, University of California, San Diego School of Medicine, 9500 Gilman Drive, Mailstop 0627, La Jolla, CA 92093-0627, USA, 2Center for Genome Medical Science, Saitama Medical School, PRESTO, Japan Science and Technology Corporation, Saitama, Japan, 3Shriners Hospitals for Children, Department of Cell and Developmental Biology, Oregon Health Sciences University, Portland, OR, USA, 4Department of Medicine, Howard Hughes Medical Institute, University of California, La Jolla, CA, USA and 5Division of Basic Sciences, Fred Hutchinson Cancer Research Center, Seattle, Washington, USA

Received January 20, 2004; Accepted March 9, 2004


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 CONCLUSIONS
 MATERIALS AND METHODS
 REFERENCES
 
The Mnt gene encodes a Mad-family bHLH transcription factor located on human 17p13.3. Mnt is one of 20 genes deleted in a heterozygous fashion in Miller–Dieker syndrome (MDS), a contiguous gene syndrome that consists of severe neuronal migration defects and craniofacial dysmorphic features. Mnt can inhibit Myc-dependent cell transformation and is hypothesized to counterbalance the effects of c-Myc on growth and proliferation in vivo by competing with Myc for binding to Max and by repressing target genes activated by Myc : Max heterodimers. Unlike the related Mad family members, Mnt is expressed ubiquitously and Mnt/Max heterodimers are found in proliferating cells that contain Myc/Max heterodimers, suggesting a unique role for Mnt during proliferation. To examine the role of Mnt in vivo, we produced mice with null (MntKO) and loxP-flanked conditional knock-out (MntCKO) alleles of Mnt. Virtually all MntKO/KO mutants in a mixed (129S6xNIH Black Swiss) or inbred (129S6) genetic background died perinatally. Mnt-deficient embryos exhibited small size throughout development and showed reduced levels of c-Myc and N-Myc. In addition, 37% of the mixed background mutants displayed cleft palate as well as retardation of skull development, a phenotype not observed in the inbred mutants. These results demonstrate an important role for Mnt in embryonic development and survival, and suggest that Mnt may play a role in the craniofacial defects displayed by MDS patients.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 CONCLUSIONS
 MATERIALS AND METHODS
 REFERENCES
 
Isolated lissencephaly sequence (ILS; MIM 607432) and Miller–Dieker syndrome (MDS; MIM 24720) are specific human malformation syndromes that both exhibit classical lissencephaly (‘smooth brain’), a heterogeneous human developmental brain disorder caused by defects in neuronal migration (1). Lissencephaly encompasses varying degrees of agyria (absence) and pachygyria (thickening) of the cerebral cortex. Individuals with ILS have lissencephaly but no other major malformations and the degree of lissencephaly is generally of reduced severity. By contrast, MDS patients display the most severe degree of lissencephaly (complete agyria) as well as a characteristic dysmorphic facial appearance that includes prominent forehead with bitemporal hollowing, short nose with upturned naris, thickened upper lip with a thin vermilion border, widely spaced eyes, low set ears and small jaw, as well as other abnormalities (2). All MDS cases and most cases of ILS (40%) are associated with visible or submicroscopic deletions of chromosome 17p13.3 (2–4) that include LIS1 (5). Point mutations found in non-deletion ILS patients confirmed that haploinsufficiency of LIS1 is required for ILS (6–8). However, for this chromosomal region, the most severe form of lissencephaly (complete agyria) and other major MDS abnormalities are found only with larger (>250 kb) and more telomeric deletions on chromosome 17p13.3, including and extending beyond LIS1 (7).

These findings suggest that MDS is a contiguous gene syndrome where heterozygous deletion of genes distal to LIS1 may be responsible for the facial dysmorphisms and more severe neuronal migration defects seen in MDS patients. A large study of patients with 17p13.3 deletions is consistent with this hypothesis. All MDS patients (with the most severe form of lissencephaly) had deletions that extended from LIS1 to always include at least two genes, CRK and 14-3-3{varepsilon}, with a progressive increase in mild features of MDS in patients with progressively larger deletions between LIS1 and 14-3-3{varepsilon} (9). The contiguous gene syndrome hypothesis is also supported by mouse studies. Mice with heterozygous or homozygous null alleles of 14-3-3{varepsilon} displayed neuronal migration defects, and mice doubly heterozygous for null alleles of Lis1 and 14-3-3{varepsilon} displayed more severe migration defects than either single heterozygote (10). Thus, LIS1 and 14-3-3{varepsilon} contribute to neuronal migration defects of MDS, although other genes within this region may contribute as well.

In contrast to the genes important for neuronal migration, the genes important for the craniofacial features of MDS have not been identified. The facial features of MDS have not been seen without lissencephaly for 17p13.3-linked human diseases. Mouse studies have provided some clues. Mice with homozygous deletion of Hic1, a gene within the MDS region, display a range of developmental defects including cleft palate (11). Although Hic1 may contribute to the craniofacial defects seen in MDS, heterozygous mice have no obvious defects and display normal craniofacial development.

Here, we investigate the role of Mnt, another MDS region gene, during mouse development. Mnt codes for a Myc class basic-helix-loop helix-leucine zipper (bHLHZip) protein that, like Myc, forms heterodimers with the bHLHZip protein Max. Myc family proteins (c-Myc, N-Myc and L-Myc) play fundamental roles in the control of cell growth, proliferation, differentiation and embryonic development (reviewed in 12–15), and it has been proposed that Mnt functions as a Myc cellular antagonist. In addition to Myc and Mnt, Max binds to the four Mad family members Mad1, Mxi1, Mad3 and Mad4, and to Mga (reviewed in 13,14). Mnt and Mad family proteins share not only related bHLHZip domains, but also a small region in their N-termini that interacts with Sin3 corepressor proteins (reviewed in 13,14). The Sin3 interaction domain, or SID, in Mnt and Mad family proteins mediates their ability to repress transcription and to suppress Myc-dependent transformation of cells in culture (13). Mnt : Max, Mad : Max and Myc : Max heterodimers have similar DNA binding specificity and appear to constitute an activation–repression system in which Mnt : Max and Mad : Max antagonize Myc : Max-dependent transcriptional activation through reciprocal effects on histone acetylation and chromatin structure (16–21). Indeed, there is growing evidence that Mad, Mnt and Myc regulate an overlapping set of genes (22–27).

Using mice with complete loss-of-function and conditional knock-out mutations in Mnt, we have attempted to understand the in vivo functions of this gene. We recently found that Mnt–/– mouse embryonic fibroblasts (MEFs) display a phenotype highly similar to that caused by overexpression of Myc (27). Mnt–/– MEFs prematurely entered S-phase of the cell cycle and proliferated more rapidly than wild-type MEFs. Mnt–/– MEFs were sensitized to apoptosis with an upregulation of Cdk4 and Cyclin E, and Cdk4 appeared to be a direct target of Mnt/Myc antagonism. Furthermore, Mnt–/– MEFs efficiently escaped senescence and could be transformed with oncogenic Ras alone. The Mnt–/– phenotype correlated with elevated levels of Cdk4 and Cyclin E, and the Cdk4 gene appeared to be a direct target of Mnt/Myc transcriptional antagonism. Consistent with a tumor suppressor function for Mnt, inactivation of the Mnt gene in breast epithelium using conditional knock-out mice led to adenocarinomas. These results demonstrated a unique negative regulatory role for Mnt in governing key Myc functions associated with cell proliferation and tumorigenesis. Recently, RNAi was used to knock down Mnt in mammalian cell lines (28), resulting in similar cellular phenotypes as our Mnt–/– MEFs.

In this report we show that Mnt plays an essential role in embryonic development and survival. Complete loss of Mnt results in perinatal lethality and growth retardation. Furthermore, Mnt–/– mice also display cleft palate and retardation of skull development dependent on genetic background, suggesting that Mnt may play a role in the craniofacial defects displayed by MDS patients.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 CONCLUSIONS
 MATERIALS AND METHODS
 REFERENCES
 
Targeted disruption of Mnt
The targeting vector was designed so that a loxP-flanked hygro resistance gene and a third loxP were inserted into introns 3 and 6, respectively (Fig. 1A), resulting in the introduction of a conditional knock-out mutation (Mnt-CKO allele) in the germline of mice. Mnt+/CKO mice in a 129/S6 inbred background were produced. Two germline deleter strains were used to produce a null allele for Mnt (Mnt-KO allele) from Mnt+/CKO mice, with the deletion of 357 amino acid residues of Mnt and also the elimination of hygro. EIIa-Cre transgenic mice (29) were used to generate the Mnt-KO allele in mixed background (129/S6xFVB/n) mice in vivo. Inbred 129/S6 background Prion-Cre mice (30) were mated with inbred Mnt+/CKO mice to generate the Mnt-KO allele in an inbred (129/S6) background in vivo. Genotypes were determined by Southern blot and PCR analysis (Fig. 1B and C). Heterozygotes were fertile and healthy. Protein lysates were prepared from embryos of each of the three genotypes, and used for western blot analysis. Using an antibody recognizing the N-terminal 55 amino acids of Mnt, there was no detectable Mnt protein in Mnt–/– embryos, while embryos from Mnt+/– mice had approximately half the amount of Mnt protein (Fig. 1D). These studies confirmed that the Mnt-KO allele is a protein null.



View larger version (28K):
[in this window]
[in a new window]
  		Figure 1. Generation and analysis of Mnt mutant mice. (A) Targeting strategy of Mnt gene locus. Exons are represented by shadowed boxes. Arrows indicate primers used for genotyping with PCR. The black box shows the probe used for Southern blot analysis. H, HindIII; Xb, XbaI; B, BamHI; E, EcoRI; EV, EcoRV; X, newly generated XbaI site; VDE, a 34 bp rare cutting enzyme; loxP, site for Cre recombinase; Hygro, hygromycin resistance gene; Hsv-tk, herpes simplex virus thymidine kinase gene. (B) Southern blot analysis with tail DNA from Mnt+/+ mice (+/+), Mnt+/– mice (+/–) and Mnt–/– mice (–/–). Fragment sizes (kb) derived from the wild-type and targeted Mnt alleles are 1.7 and 1.3 kb. (C) PCR genotyping of Mnt deficient mice. PCR was performed on tail DNA isolated from progeny of Mnt+/– intercrosses. This PCR reaction results in 147 bp fragment from wild-type allele and 386 bp fragment from mutant allele. (D) Western blot analysis with lysates prepared from embryos of indicated genotypes. Lysates were immunoblotted with an anti-Mnt polyclonal antibody raised against the N-terminus of Mnt.

 
Mnt requirement for neonatal survival
Genotypic analysis derived from the intercross of mixed background Mnt+/– mice revealed that <2% homozygous null mutant mice survived to adulthood (Table 1). Moreover, most Mnt–/– mice survived until birth (Table 1), and if they did survive to birth, virtually all mice died within 4 days of birth (Table 2). To confirm this, timed pregnancies were used to produce mice at various embryonic ages and genotype recovery at all stages correlated with expected Mendelian ratios (data not shown). In an inbred 129/S6 background, slightly more (~3.5%) Mnt–/– mice survived into adulthood (Table 1). Although many mice died at birth, a number of inbred Mnt–/– mice died later than Mnt–/– mice in a mixed background (10 days to 3 weeks after birth). Thus, loss of Mnt results in lethality between birth and weaning in >95% of mice, and points to a critical role for Mnt in survival. It should be noted that in the mixed background, there appear to be fewer Mnt+/– mice than expected, although the difference is not statistically significant. The expected ratios of Mnt+/+ to Mnt+/– mice were observed in the 129S6 background, so it is unclear if the differences observed in the mixed background have any biological significance.


View this table:
[in this window]
[in a new window]
  		Table 1. Genotype ratios in inbred and mixed background of Mnt+/+, Mnt+/– and Mnt–/– mice in neonatal pups, at birth, and in adult
 

View this table:
[in this window]
[in a new window]
  		Table 2. Quantification of timing of death of Mnt–/– mice, where mice were observed from pregnant day 18.5 to day 5 after birth every morning and evening
 
Mnt requirement for embryonic, neonatal and postnatal growth
In addition to its important role in neonatal survival, Mnt is important for growth throughout development. Mnt–/– mice in the mixed background were smaller than wild-type mice at E14.5 (Fig. 2A and B), E18.5 (Fig. 2E) and at birth (Fig. 2C and D). In addition, the size of Mnt+/– mice was intermediate between wild-type and Mnt–/– mice at birth (Fig. 2D). Mnt–/– inbred mice also displayed smaller size than wild-type mice at birth and heterozygotes were intermediate between wild-type and Mnt–/– mice (Fig. 2F). However, surviving mutant mice (caged as mixed genotypes) in either background caught up to the same size as wild-type mice by adulthood (data not shown). Surviving adult Mnt–/– mice were fertile and made the expected number of Mnt+/– and Mnt–/– mice by mating with Mnt+/– mice (data not shown), demonstrating that Mnt is not required for fertility.



View larger version (57K):
[in this window]
[in a new window]
  		Figure 2. Decreased weight of Mnt+/– mice and Mnt–/– mice. (A) Growth retardation at E14.5 embryonic stage. (B) Statistical analysis of growth retardation at E14.5 embryonic stage. (C) Neonatal littermates illustrate that Mnt–/– mice are smaller than Mnt+/+ mice. (D–F) Statistical analysis of growth retardation of Mnt deficient mice with mixed background at E18.5 (E), at birth (D) and inbred Mnt deficient mice at birth (F). *P<0.001, **P<0.01 and ***P<0.05. There are statistically significant differences at birth between Mnt+/+ mice and Mnt+/– mice, and at E14.5, E18.5 and at birth between Mnt+/– mice and Mnt–/– mice, and between Mnt+/+ mice and Mnt–/– mice (B, D, E). As for mixed background mice, there are statistically significant differences at birth between inbred Mnt+/– mice and Mnt–/– mice and between Mnt+/+ mice and Mnt–/– mice (F).

 
In MEFs derived from Mnt–/– mice, we found that c-Myc decreased to very low levels soon after being established in culture, while Cyclin E and Cdk4 levels were found to be consistently higher in Mnt–/– MEFs (27). Similar to these results in MEFs, c-Myc was expressed at reduced levels in Mnt–/– embryos compared to wild-type and Mnt+/– embryos displayed intermediate levels of c-Myc (Fig. 3). Although N-Myc is not normally expressed in MEFs, it is expressed in embryos, so we examined the expression of N-Myc in embryos of all three genotypes. Similar to c-Myc, N-Myc was expressed at reduced levels in Mnt–/– embryos compared to wild-type and Mnt+/– embryos displayed intermediate levels of N-Myc (Fig. 3). Cyclin E1 and Cdk4 were expressed at moderately elevated levels in Mnt–/– whole embryos at embryonic day 18.5 (Fig. 3), while the levels of Cdk2 were unaffected. Mnt+/– embryos displayed little or no changes in the levels of these proteins. These results, together with results from Mnt–/– MEFs (27), suggest that downregulation of c-Myc as well as N-Myc, and upregulation of CyclinE1 and Cdk4 are signature events linked to loss of Mnt.



View larger version (74K):
[in this window]
[in a new window]
  		Figure 3. Reduced c-Myc and N-Myc as well as increased Cyclin E1 and Cdk4 in Mnt–/– embryos. Western blots were performed using E18.5 whole embryo lysates of the indicated Mnt genotypes (+/+, +/– and –/–) and the indicated antibodies (left). Cdk2 was used as a loading control.

 
Cleft palate in mixed background Mnt mutants
Other than smaller size, there were no obvious histological defects in any of the organs or tissues of Mnt–/– mice compared to wild-type mice, such as brain, lung, heart, kidney, liver, gonads, gastrointestinal tract and muscle (data not shown). To determine potential causes for the severe neonatal mortality in Mnt null mutant mice that died at birth, we examined litters from mixed background Mnt+/– crosses at birth. We found that Mnt–/– mice had reduced amounts of milk in their stomachs and displayed small jaws compared to wild-type littermates. Upon further examination, it was apparent that some Mnt–/– newborn mice displayed clefting of both the hard and soft palate compared to normal palate closure in Mnt+/+ and Mnt+/– mice (Fig. 4A and D). At E14.5, normal palate closure occurred in Mnt+/+ mice (Fig. 4B), whereas many Mnt–/– mice have cleft palate at this stage (Fig. 4E). From these and similar sections, it appears that the tongue prevented the elevation of palate shelves in Mnt–/– mice and was a possible consequence of the small jaw. Bone staining revealed that in Mnt–/– mice with cleft palate, the palantine bone was completely absent in contrast to the normal development of the palantine bone in Mnt+/+ mice (Fig. 4C and F).



View larger version (65K):
[in this window]
[in a new window]
  		Figure 4. Mnt–/– mice have cleft palate. (A, D) Complete cleft palate was observed in more than 30% of Mnt–/– mice (D) in contrast to Mnt+/+ mice (A). (B, E) Morphology of palatal shelves in Mnt+/+ mice and Mnt–/– mice. Closure of palatal shelves in Mnt–/– mice was prevented by the tongue (E) compared to normal closure of the palatal shelves in Mnt+/+ mice (B) at E14.5. P, palatal shelve; T, tongue. (C, F) Alzarin red and Alcian blue staining shows complete absence of the palatine bone in Mnt–/– mice (F, arrows and dotted circles) in contrast to Mnt+/+ mice (C, arrows). P, palantine bone.

 
Palate closure phenotypes were documented at birth for litters from heterozygous mixed background crosses. None of the wild-type and Mnt+/– mice displayed any palate defects. By contrast, 37% of Mnt–/– mice displayed varying degrees of cleft palate (Table 3). Most of these (18/20) displayed complete soft and hard clefting of the palate. One embryo displayed only a cleft soft palate and another had a small hole in the palate. Although more than 30% of these mice had palate defects, the remaining 63% of Mnt–/– mice had no palate abnormalities. In addition, when similar experiments were performed in inbred mice, none of the Mnt–/– mice displayed any palate abnormalities (Table 3). Since nearly all Mnt–/– mice of mixed and inbred background died as neonates, these data indicate that although cleft palate may be one cause of death of Mnt–/– mice, there must be other causes.


View this table:
[in this window]
[in a new window]
  		Table 3. Incidence of cleft palate in Mnt–/– mice, dissected at birth to quantitate cleft palate
 
To further examine whether Mnt was required for primary palate closure, we made Pitx1-Cre+/MntCKO/CKO mice. The Pitx1-Cre transgene was characterized by crossing to ROSA26-flox/LacZ reporter mice. At E9.5 and E10.5, Cre-recombinase activity produced strong staining in Rathke's pouch and throughout the ectoderm of the oral cavity and the mandibular and maxillary processes. At E14.5 the epithelial components of all oral structures were stained: tongue, primary palate and palatal shelves, lips, teeth and outer surface of the lower jaw. Mesenchymal components of these structures were not stained, suggesting that the transgene is only active in first branchial arch and oral ectoderm and not in neural crest. Based on this analysis, recombinase activity begins before E9.5, with maximum recombination reached between E9.5 and E10.5. These mice (FVB/n background) were mated to Mnt conditional mice. There were no significant defects with normal palate closure in Pitx1-Cre+/MntCKO/CKO mice at birth and these mice lived to adulthood (data not shown).

Abnormal development of skull
Because Mnt–/– mice in a mixed background have small jaws and skulls at birth, we examined skeletal development by skeletal staining. Mnt–/– mixed background mice displayed normal staining patterns in rib, limbs and long bones (data not shown), whereas all mutants displayed defects in the skull (Fig. 5A and B). The overall size of the mutant skulls was smaller, with apparent symmetrical reduction in length and width. In wild type and Mnt+/– mice, the interparietal and supraoccipital bones occupied almost all of the area of the rostral skull (Fig. 5A). By contrast, these bones were obviously reduced in size in Mnt–/– mice (Fig. 5A). The mandible was also smaller in Mnt–/– mice compared to wild-type (Fig. 5C). Mnt–/– mice displayed reductions in both mandible (Fig. 5D and E) and skull (Fig. 5F and G) size. There was perhaps an even greater relative reduction in mandible length and width, suggesting that the cleft palate phenotype may be secondary to mandible growth defects. However, in spite of these marked differences in mixed background mice, 129/S6 inbred Mnt–/– mice displayed normal skull development with no defects in mandible or head dimensions (data not shown). These data suggest that Mnt is important for the normal development of interparietal and supraoccipital bones in the skull as well as the mandible in a strain-dependent fashion. These findings also suggest that Mnt may not be essential for primary palate closure, and support the hypothesis that the cleft palate phenotype displayed by Mnt–/– mice was secondary to defects in bone growth and development.



View larger version (39K):
[in this window]
[in a new window]
  		Figure 5. (A, B) Alzarin red and Alcian blue staining illustrate that Mnt–/– mice display growth retardation of the skull, especially interparietal and supraoccipital bones (A, arrows) compared to that of Mnt+/+ mice. IP, interparietal bone; S, supraoccipital bone. (C) Morphology of head of Mnt+/+ mice and Mnt–/– mice. Mandible size of Mnt–/– mice is smaller than that of Mnt+/+ mice. (D–G) Comparision of mandible length (D), width between mandibles (E), skull length (F), and skull width (G) between Mnt+/+ mice and Mnt–/– mice. *P<0.001, **P<0.01. There are significant differences in mandible and skull sizes. Note that greater apparent differences were observed in mandible than in the skull.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
CONCLUSIONS
 MATERIALS AND METHODS
 REFERENCES
 
In this study, we characterized mice containing a null mutation in the Mnt gene, encoding a putative Myc antagonist, that is contained within the mouse chromosome 11 region syntenic to the MDS region on human chromosome 17p13.3. We demonstrate that Mnt is required for proper embryonic growth and development as nearly all Mnt–/– mice died in the neonatal period, and Mnt–/– mice displayed embryonic, neonatal and growth retardation. Furthermore, Mnt–/– mice displayed strain dependent craniofacial abnormalities, characterized by cleft palate and retardation of skull development suggesting possible involvement in MDS.

Mnt and craniofacial defects in Miller–Dieker syndrome
Human 17p13.3 contains the critical region for two related syndromes with neuronal migration defects: ILS and MDS. Patients with ILS display lissencephaly without other major defects (2), while MDS patients display a more severe grade of lissencephaly, as well as characteristic craniofacial dysmorphic features, including a prominent forehead, microcephaly, small jaw, small nose, thin vermilion border and micrognathia (2,31). Cleft palate is not commonly observed in MDS patients. ILS linked to 17p13.3 is caused by heterozygous deletion or mutation of the LIS1 gene (6,32). The more severe clinical phenotype of MDS is always associated with deletions of LIS1 and more telomeric deletion and haploinsufficiency of 17p13.3, up to and including the gene for 14-3-3{varepsilon} (9,10). These results suggest that LIS1 is the primary gene responsible for the neuronal migration defects displayed by patients with ILS and MDS, and that other genes in 17p13.3 when deleted cause the more severe migration defects and craniofacial phenotypes seen in MDS (9,10,33).

The cleft palate and skull developmental defects displayed by Mnt mutant mice suggest that Mnt may be a gene involved in the craniofacial defects displayed by MDS patients. Although cleft palate was detected in Mnt–/– mice with mixed background, Mnt–/– mice with 129/S6 genetic background did not have cleft palate, suggesting that cleft palate results from genetic interactions between strain-specific genetic modifiers. Our data also suggest that the cleft palate phenotype may be secondary to the small jaw of Mnt–/– mice. Due to a small mandible in the mutants, the tongue was displaced backward in the oral cavity, preventing the elevation and fusion of palatal shelves in Mnt–/– mice. In humans, cleft palate secondary to an underdeveloped mandible is well recognized and is termed Robin sequence (34,35). In addition, Pitx1-Cre+/MntCKO/CKO mice, where Mnt was inactivated in the developing palate, did not display cleft palate. Although this experiment alone is not conclusive, it supports the hypothesis that the cleft palate phenotype displayed by these mice is secondary to the bone growth defects. Because correct neural crest migration is crucial for normal craniofacial development, including skull development, conditional deletion of Mnt in developing neural crest may help resolve this issue. It will also be important to determine whether Pitx1-Cre+/MntCKO/CKO mice eventually develop tumors, as was seen in MMTV-CreMntCKO/CKO mice (27).

Genes responsible for the craniofacial defects displayed by MDS patients remain to be identified in humans. It is uncertain whether the MDS facial dysmorphisms are the result of a single gene or haploinsufficiency of multiple genes important for craniofacial development. In mice, loss of Hic1 or Mnt results in craniofacial defects. Hic1 knock-out mice die perinatally and exhibit a range of gross developmental defects, such as acrania, exencephaly, cleft palate, limb abnormalities and omphalocele (11). Heterozygous mutants have no developmental phenotype, similar to Mnt heterozygotes, but are predisposed to malignant tumors (36). HIC1 (hypermethylated in cancer) is a transcription factor and candidate tumor suppressor (37,38). As noted above, MDS patients do not display cleft palate, although both Mnt and Hic1 heterozygotes do. Cleft palate may be a manifestation of loss of MDS craniofacial genes in mice even though it is not commonly seen in human MDS. Since neither Mnt nor Hic1 heterozygotes display any craniofacial defects, it is possible that combined haploinsufficiency of MNT, HIC1 and perhaps other genes in the MDS critical region are necessary for the full MDS craniofacial phenotype (33).

Mnt is important for normal growth and survival
Virtually all Mnt–/– mutants in a mixed or inbred (129/S6) genetic background died perinatally. As noted above, 37% of the mixed background mutants displayed cleft palate as well as retardation of skull development, a phenotype not observed in the inbred mutants. Since nearly all Mnt–/– mice of either background die as neonates, these data indicate that although cleft palate may be one cause of death of Mnt–/– mice, there must be other causes. No histological defects were evident in other tissues examined. Although the molecular mechanisms responsible for growth retardation and neonatal lethality of Mnt–/– mutants remain unknown, one possibility is that the reduced c-Myc levels in Mnt–/– embryos are involved (27). Both c-Myc–/– and N-Myc–/– mice display early embryonic lethality (39–44). Moreover, embryonic development appears exquisitely sensitive to c-Myc and N-Myc levels, with decreasing levels of c-Myc causing increasingly severe growth retardation and null mutations causing embryonic lethality at mid-gestation (39,43,45). Thus, the decreased levels of c-Myc and N-Myc in Mnt–/– mice may be equivalent to hypomorphic alleles of both c-Myc and N-Myc. Indeed, the decreased c- and N-Myc levels in Mnt–/– embryos (Fig. 3) might be expected to cause a more severe phenotype or embryonic lethality. However, MEFs lacking Mnt, which also show downregulation of c-Myc levels, proliferate at a rate at least comparable to wild type MEFs (27), raising the possibility that loss of Mnt may counter, to some degree, the affects of decreased Myc levels during embryonic development. Consistent with this idea, Cyclin E1 and Cdk4 upregulation, signature events caused by ectopic Myc expression (46–48), are elevated in Mnt–/– embryos (Fig. 3), as well as in Mnt–/– MEFs (27) despite reduced Myc levels. The upregulation of these important Myc effectors caused by loss of Mnt-dependent repression would theoretically confer reduced dependency on Myc for proliferation and embryonic growth and development. This idea and the general notion that Mnt is a Myc antagonist will be best-addressed using genetic model systems. For example, it will be important to determine whether loss of Mnt can rescue, or partially rescue, the mid-gestation lethality of Myc-deficient mice and/or rescue the proliferative arrest of MEFs lacking c-Myc (49,50).


   CONCLUSIONS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 CONCLUSIONS
MATERIALS AND METHODS
 REFERENCES
 
In this study, we have provided evidence that the Max-interacting protein Mnt, a putative antagonist of Myc, is an important gene for neonatal survival and essential for embryonic growth. We also demonstrate a strain-specific function for Mnt in craniofacial development. Since MNT lies within the MDS critical region, these findings are consistent with the notion that MNT may play some role in the craniofacial defects displayed by MDS patients. However, it is unlikely that MNT is the only gene responsible for these phenotypes, based on human deletion studies (9) as well as the lack of phenotype in Mnt+/– mice. Instead, we favor the model that the craniofacial phenotypes displayed by MDS patients result from combined haploinsufficiency of more than one gene in this region. If MDS is a contiguous gene syndrome, it is likely that Mnt and Hic1 are two contributing genes, based on the phenotypes of homozygous mutants for these genes.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 CONCLUSIONS
 MATERIALS AND METHODS
REFERENCES
 
Generation of Mnt mutant mice
The Mnt targeting construct was generated from a murine genomic Mnt clone obtained from a {lambda} phage genomic library by screening with a fragment of a human genomic clone (L132) known to contain MNT. To make a backbone of a targeting vector, we constructed a Hygro-VDE/loxP vector. Briefly, the blunt-ended XhoI-PmeI fragment of pPNT Neo VDE/loxP (51) was replaced with the blunt-ended BamHI–BamHI fragment of pMCI-HPH (hygroR gene). The XbaI–XbaI fragment of Mnt genomic clone was cloned into XbaI site of a Hygro-VDE/loxP vector. The blunt-ended XbaI–XhoI fragment which was obtained by XhoI partial digestion was cloned into blunt ended XhoI site of a Hygro-VDE/loxP vector. A third loxP site was generated by the cloning of an oligo DNA fragment containing loxP sequence into an AscI site. Finally, the blunt-ended XhoI–XbaI fragment was cloned into blunt-ended AscI site. This triple-loxP Mnt targeting vector was transfected into TC1 ES cells (52) and targeted cells were identified by Southern blotting using a 800 bp probe from intron 3. Targeted ES cells were introduced into C57BL/6 blastocysts and germline chimeric mice were produced. These germline chimeras were mated to inbred 129/S6 mice to introduce the targeted allele (MntCKO) into the germline as an inbred 129/S6 line. Heterozygous mutant mice (Mnt+/CKO) and FVB/n EIIa-Cre mice (29) were mated to produce heterozygous knock-out mice (Mnt+/–) in a mixed genetic background. To produce inbred (129/S6) Mnt deficient mice, Mnt+/CKO 129/S6 mice were mated with Prion-Cre 129/S6 mice and screened by PCR using tail DNA. Prion-Cre 12/S6 inbred mice express Cre recombinase in all tissues during embryogenesis and act as an inbred germline deleter strain (30).

Genotype analysis
Embryos and adult mice were genotyped by PCR analysis by using tail DNA or yolk sac. The sequences of the primers for wild-type, conditional or deleted alleles are as follows. For wild-type allele detection, MntWT-sense (5'-cagtccctgaagaggaagga-3') and MntWT-Rev2 (5'-ccggagcacacgatctatct-3') were employed. For deleted allele detection, MntKO3 (5'-caggtcctccaaaagagcag-3') and MntKO4 (5'-ggagcaatgtggagagaagc-3') were used. The conditions of amplification were 35 cycles at 94°C for 30 s, 68°C for 60 s and 72°C for 120 s. This PCR generate 386 bp fragment from mutant allele and 147 bp from wild-type allele. To distinguish wild-type and conditional mutant alleles, a single pair of primers (sense, 5'-cagattcagtgtcccctgct-3'; antisense, 5'-gtctcaagtcgtgggcattg-3') was used to amplify a 178 bp product from wild-type allele and 1.9 kb product from conditional allele. As amplification from conditional allele was somewhat difficult because of its large size, a second PCR reaction was always performed to confirm the presence of the conditional allele. In this reaction, a pair of primers from hygro (sense, 5'-gatgtaggagggcgtggata-3'; antisense, 5'-gatgttggcgacctcgtatt-3') were used. This PCR reaction amplified a 579 bp product from the conditional null allele. For the presence of the Cre allele, two primers were used (CREA1: ccgggctgccacgaccaa and CREA2: ggcgcggcaacaccattttt). For Southern blot analysis, tail DNA was digested with EcoRV, separated with 1% agarose and transferred into Hybond N+ (Amersham Pharmacia Biotech, Piscataway, NJ). The transferred membrane was probed with a 800 bp EcoRV/XbaI fragment from intron 3, and detected a 1.7 kb wild-type allele and/or a 1.3 kb mutant allele.

Growth, histological, immunohistochemical and western blot analysis
Embryos were dissected at various developmental stages and weighed. Dissected tissues were fixed in 4% paraformaldehyde/PBS solution for 15 h at 4°C. Fixed embryos were decalcified with 22.5% formic acid/10% sodium citrate as described (53). Decalcified samples were embedded in paraffin, sectioned at 5 µm, and stained with hematoxylin and eosin. For western blots, protein lysates were prepared from embryonic fibroblast cells prepared from Mnt+/+, Mnt+/– and Mnt–/– mice. Anti-Mnt polyclonal antibody used in western blots was described previously (17,27).

Skeletal staining
Skeletal staining was performed as described in (54). Briefly, skin, viscera and adipose tissue of E18.5 embryos or newborn pups were removed and fixed in 95% ethanol for 5 days. Fixed samples were placed in acetone for 2–5 days and stained with 0.015% alcian blue/0.005% alizalin red S solution for 3 days at 37°C. After brief washes with dH2O, samples were cleared in 1% KOH solution for 24 h and through 20, 50 and 80% glycerol/1% KOH solutions. Cleared samples were stored in 100% glycerol until photography.


   ACKNOWLEDGEMENTS
 
The authors wish to thank Denise Larson, Amy Chen, Lisa Garrett and Patricia LaPorte for excellent technical assistance. This work was supported in part by NIH Grant NS39404 to A.W.-B., CA87788 to P.H., CA20525 to R.E. and DK18477 to M.G.R.


   FOOTNOTES
 
* To whom correspondence should be addressed. Tel: +1 8588223400; Fax: +1 8588223409; Email: awynshawboris{at}ucsd.edu

{dagger} Present address: Department of Pediatrics, Division of Medical Genetics, University of Texas Health Science Center at Houston Medical School, Houston, TX 77030, USA. Back


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 CONCLUSIONS
 MATERIALS AND METHODS
 REFERENCES
 

  1. Dobyns, W.B., Stratton, R.F., Parke, J.T., Greenberg, F., Nussbaum, R.L. and Ledbetter, D.H. (1983) Miller–Dieker syndrome: lissencephaly and monosomy 17p. J. Pediatr., 102, 552–558.[CrossRef][Web of Science][Medline]

  2. Dobyns, W.B., Curry, C.J., Hoyme, H.E., Turlington, L. and Ledbetter, D.H. (1991) Clinical and molecular diagnosis of Miller–Dieker syndrome. Am. J. Hum. Genet., 48, 584–594.[Web of Science][Medline]

  3. Schwartz, C.E., Johnson, J.P., Holycross, B., Mandeville, T.M., Sears, T.S., Graul, E.A., Carey, J.C., Schroer, R.J., Phelan, M.C., Szollar, J. et al. (1988) Detection of submicroscopic deletions in band 17p13 in patients with the Miller–Dieker syndrome. Am. J. Hum. Genet., 43, 597–604.[Web of Science][Medline]

  4. Ledbetter, S.A., Kuwano, A., Dobyns, W.B. and Ledbetter, D.H. (1992) Microdeletions of chromosome 17p13 as a cause of isolated lissencephaly. Am. J. Hum. Genet., 50, 182–189.[Web of Science][Medline]

  5. Reiner, O., Carrozzo, R., Shen, Y., Wehnert, M., Faustinella, F., Dobyns, W.B., Caskey, C.T. and Ledbetter, D.H. (1993) Isolation of a Miller–Dieker lissencephaly gene containing G protein beta-subunit-like repeats. Nature, 364, 717–721.[CrossRef][Medline]

  6. Lo Nigro, C., Chong, C.S., Smith, A.C., Dobyns, W.B., Carrozzo, R. and Ledbetter, D.H. (1997) Point mutations and an intragenic deletion in LIS1, the lissencephaly causative gene in isolated lissencephaly sequence and Miller-Dieker syndrome. Hum. Mol. Genet., 6, 157–164.[Abstract/Free Full Text]

  7. Chong, S.S., Pack, S.D., Roschke, A.V., Tanigami, A., Carrozzo, R., Smith, A.C., Dobyns, W.B. and Ledbetter, D.H. (1997) A revision of the lissencephaly and Miller–Dieker syndrome critical regions in chromosome 17p13.3. Hum. Mol. Genet., 6, 147–155.[Abstract/Free Full Text]

  8. Cardoso, C., Leventer, R.J., Matsumoto, N., Kuc, J.A., Ramocki, M.B., Mewborn, S.K., Dudlicek, L.L., May, L.F., Mills, P.L., Das, S. et al. (2000) The location and type of mutation predict malformation severity in isolated lissencephaly caused by abnormalities within the LIS1 gene. Hum. Mol. Genet., 9, 3019–3028.[Abstract/Free Full Text]

  9. Cardoso, C., Leventer, R.J., Ward, H.L., Toyo-Oka, K., Chung, J., Gross, A., Martin, C.L., Allanson, J., Pilz, D.T., Olney, A.H. et al. (2003) Refinement of a 400-kb critical region allows genotypic differentiation between isolated lissencephaly, Miller–Dieker syndrome, and other phenotypes secondary to deletions of 17p13.3. Am. J. Hum. Genet., 72, 918–930.[CrossRef][Web of Science][Medline]

  10. Toyo-oka, K., Shionoya, A., Gambello, M.J., Cardoso, C., Leventer, R., Ward, H.L., Ayala, R., Tsai, L.H., Dobyns, W., Ledbetter, D. et al. (2003) 14-3-3{varepsilon} is important for neuronal migration by binding to NUDEL: a molecular explanation for Miller–Dieker syndrome. Nat. Genet., 34, 274–285.[CrossRef][Web of Science][Medline]

  11. Carter, M.G., Johns, M.A., Zeng, X., Zhou, L., Zink, M.C., Mankowski, J.L., Donovan, D.M. and Baylin, S.B. (2000) Mice deficient in the candidate tumor suppressor gene Hic1 exhibit developmental defects of structures affected in the Miller–Dieker syndrome. Hum. Mol. Genet., 9, 413–419.[Abstract/Free Full Text]

  12. Baudino, T.A. and Cleveland, J.L. (2001) The Max network gone mad. Mol. Cell. Biol., 21, 691–702.[Free Full Text]

  13. Grandori, C., Cowley, S.M., James, L.P. and Eisenman, R.N. (2000) The Myc/Max/Mad network and the transcriptional control of cell behavior. Annu. Rev. Cell Dev. Biol., 16, 653–699.[CrossRef][Web of Science][Medline]

  14. Luscher, B. (2001) Function and regulation of the transcription factors of the Myc/Max/Mad network. Gene, 277, 1–14.[CrossRef][Web of Science][Medline]

  15. Fuhrmann, G., Rosenberger, G., Grusch, M., Klein, N., Hofmann, J. and Krupitza, G. (1999) The MYC dualism in growth and death. Mutat. Res., 437, 205–217.[CrossRef][Web of Science][Medline]

  16. Hurlin, P.J., Queva, C. and Eisenman, R.N. (1997) Mnt, a novel Max-interacting protein is coexpressed with Myc in proliferating cells and mediates repression at Myc binding sites. Genes Dev., 11, 44–58.[Abstract/Free Full Text]

  17. Hurlin, P.J., Queva, C. and Eisenman, R.N. (1997) Mnt: a novel Max-interacting protein and Myc antagonist. Curr. Top. Microbiol. Immunol., 224, 115–121.[Web of Science][Medline]

  18. Hurlin, P.J., Steingrimsson, E., Copeland, N.G., Jenkins, N.A. and Eisenman, R.N. (1999) Mga, a dual-specificity transcription factor that interacts with Max and contains a T-domain DNA-binding motif. EMBO J., 18, 7019–7028.[CrossRef][Web of Science][Medline]

  19. Meroni, G., Reymond, A., Alcalay, M., Borsani, G., Tanigami, A., Tonlorenzi, R., Nigro, C.L., Messali, S., Zollo, M., Ledbetter, D.H. et al. (1997) Rox, a novel bHLHZip protein expressed in quiescent cells that heterodimerizes with Max, binds a non-canonical E box and acts as a transcriptional repressor. EMBO J., 16, 2892–2906.[CrossRef][Web of Science][Medline]

  20. Ayer, D.E., Kretzner, L. and Eisenman, R.N. (1993) Mad: a heterodimeric partner for Max that antagonizes Myc transcriptional activity. Cell, 72, 211–222.[CrossRef][Web of Science][Medline]

  21. Zervos, A.S., Gyuris, J. and Brent, R. (1993) Mxi1, a protein that specifically interacts with Max to bind Myc-Max recognition sites. Cell, 72, 223–232.[CrossRef][Web of Science][Medline]

  22. Ma, A., Moroy, T., Collum, R., Weintraub, H., Alt, F.W. and Blackwell, T.K. (1993) DNA binding by N- and L-Myc proteins. Oncogene, 8, 1093–1098.[Web of Science][Medline]

  23. Blackwell, T.K., Kretzner, L., Blackwood, E.M., Eisenman, R.N. and Weintraub, H. (1990) Sequence-specific DNA binding by the c-Myc protein. Science, 250, 1149–1151.[Abstract/Free Full Text]

  24. Orian, A., van Steensel, B., Delrow, J., Bussemaker, H.J., Li, L., Sawado, T., Williams, E., Loo, L.W., Cowley, S.M., Yost, C. et al. (2003) Genomic binding by the Drosophila Myc, Max, Mad/Mnt transcription factor network. Genes Dev., 17, 1101–1114.[Abstract/Free Full Text]

  25. Bouchard, C., Dittrich, O., Kiermaier, A., Dohmann, K., Menkel, A., Eilers, M. and Luscher, B. (2001) Regulation of cyclin D2 gene expression by the Myc/Max/Mad network: Myc-dependent TRRAP recruitment and histone acetylation at the cyclin D2 promoter. Genes Dev. 15, 2042–2047.[Abstract/Free Full Text]

  26. Wu, S., Pena, A., Korcz, A., Soprano, D.R. and Soprano, K.J. (1996) Overexpression of Mxi1 inhibits the induction of the human ornithine decarboxylase gene by the Myc/Max protein complex. Oncogene, 12, 621–629.[Web of Science][Medline]

  27. Hurlin, P.J., Zhou, Z.-Q., Toyo-oka, K., Ota, S., Walker, W.L., Hirotsune, S. and Wynshaw-Boris, A. (2003) Deletion of Mnt leads to disrupted cell cycle control and tumorigenesis. EMBO J., 22, 1–13.[CrossRef][Web of Science][Medline]

  28. Nilsson, J.A., Maclean, K.H., Keller, U.B., Pendeville, H., Baudino, T.A. and Cleveland, J.L. (2004) Mnt loss triggers Myc transcription targets, proliferation, apoptosis, and transformation. Mol. Cell. Biol., 24,1560–1569.[Abstract/Free Full Text]

  29. Lakso, M., Pichel, J.G., Gorman, J.R., Sauer, B., Okamoto, Y., Lee, E., Alt, F.W. and Westphal, H. (1996) Efficient in vivo manipulation of mouse genomic sequences at the zygote stage. Proc. Natl Acad. Sci. USA, 93, 5860–5865.[Abstract/Free Full Text]

  30. Scheel, J.R., Garrett, L.J., Allen, D.M., Carter, T.A., Randolph Moore, L., Gambello, M.J., Gage, F.H., Wynshaw Boris, A. and Barlow, C. (2003) An inbred 129SvEv GFPCre transgenic mouse that deletes loxP-flanked genes in all tissues. Nucl. Acids Res., 31, e57.[Abstract/Free Full Text]

  31. Dobyns, W.B., Elias, E.R., Newlin, A.C., Pagon, R.A. and Ledbetter, D.H. (1992) Causal heterogeneity in isolated lissencephaly. Neurology, 42, 1375–1388.[Abstract/Free Full Text]

  32. Dobyns, W.B., Reiner, O., Carrozzo, R. and Ledbetter, D.H. (1993) Lissencephaly. A human brain malformation associated with deletion of the LIS1 gene located at chromosome 17p13. J. Am. Med. Assoc., 270, 2838–2842.[Abstract/Free Full Text]

  33. Yingling, J., Toyo-oka, K. and Wynshaw-Boris, A. (2003) Miller–Dieker syndrome: analysis of a human contiguous gene syndrome in the mouse. Am. J. Hum. Genet., 73, 475–488.[CrossRef][Web of Science][Medline]

  34. Shprintzen, R.J. (1988) Pierre Robin, micrognathia, and airway obstruction: the dependency of treatment on accurate diagnosis. Int. Anesthesiol. Clin., 26, 64–71.[Web of Science][Medline]

  35. Sheffield, L.J., Reiss, J.A., Strohm, K. and Gilding, M. (1987) A genetic follow-up study of 64 patients with the Pierre Robin complex. Am. J. Med. Genet., 28, 25–36.[CrossRef][Web of Science][Medline]

  36. Chen, W.Y., Zeng, X., Carter, M.G., Morrell, C.N., Chiu Yen, R.W., Esteller, M., Watkins, D.N., Herman, J.G., Mankowski, J.L. and Baylin, S.B. (2003) Heterozygous disruption of Hic1 predisposes mice to a gender-dependent spectrum of malignant tumors. Nat. Genet., 33, 197–202.[CrossRef][Web of Science][Medline]

  37. Giroux, S. and Charron, J. (1998) Defective development of the embryonic liver in N-myc-deficient mice. Dev. Biol., 195, 16–28.[CrossRef][Web of Science][Medline]

  38. Foley, K.P., McArthur, G.A., Queva, C., Hurlin, P.J., Soriano, P. and Eisenman, R.N. (1998) Targeted disruption of the MYC antagonist MAD1 inhibits cell cycle exit during granulocyte differentiation. EMBO J., 17, 774–785.[CrossRef][Web of Science][Medline]

  39. Moens, C.B., Auerbach, A.B., Conlon, R.A., Joyner, A.L. and Rossant, J. (1992) A targeted mutation reveals a role for N-myc in branching morphogenesis in the embryonic mouse lung. Genes Dev., 6, 691–704.[Abstract/Free Full Text]

  40. Sawai, S., Shimono, A., Hanaoka, K. and Kondoh, H. (1991) Embryonic lethality resulting from disruption of both N-myc alleles in mouse zygotes. New Biol., 3, 861–869.[Web of Science][Medline]

  41. Charron, J., Malynn, B.A., Fisher, P., Stewart, V., Jeannotte, L., Goff, S.P., Robertson, E.J. and Alt, F.W. (1992) Embryonic lethality in mice homozygous for a targeted disruption of the N-myc gene. Genes Dev., 6, 2248–2257.[Abstract/Free Full Text]

  42. Sawai, S., Shimono, A., Wakamatsu, Y., Palmes, C., Hanaoka, K. and Kondoh, H. (1993) Defects of embryonic organogenesis resulting from targeted disruption of the N-myc gene in the mouse. Development, 117, 1445–1455.[Abstract]

  43. Stanton, B.R., Perkins, A.S., Tessarollo, L., Sassoon, D.A. and Parada, L.F. (1992) Loss of N-myc function results in embryonic lethality and failure of the epithelial component of the embryo to develop. Genes Dev., 6, 2235–2247.[Abstract/Free Full Text]

  44. Davis, A.C., Wims, M., Spotts, G.D., Hann, S.R. and Bradley, A. (1993) A null c-myc mutation causes lethality before 10.5 days of gestation in homozygotes and reduced fertility in heterozygous female mice. Genes Dev., 7, 671–682.[Abstract/Free Full Text]

  45. Nagy, A., Moens, C., Ivanyi, E., Pawling, J., Gertsenstein, M., Hadjantonakis, A.K., Pirity, M. and Rossant, J. (1998) Dissecting the role of N-myc in development using a single targeting vector to generate a series of alleles. Curr. Biol., 8, 661–664.[CrossRef][Web of Science][Medline]

  46. Hermeking, H., Rago, C., Schuhmacher, M., Li, Q., Barrett, J.F., Obaya, A.J., O'Connell, B.C., Mateyak, M.K., Tam, W., Kohlhuber, F. et al. (2000) Identification of CDK4 as a target of c-MYC. Proc. Natl Acad. Sci. USA, 97, 2229–2234.[Abstract/Free Full Text]

  47. Perez Roger, I., Solomon, D.L., Sewing, A. and Land, H. (1997) Myc activation of cyclin E/Cdk2 kinase involves induction of cyclin E gene transcription and inhibition of p27(Kip1) binding to newly formed complexes. Oncogene, 14, 2373–2381.[CrossRef][Web of Science][Medline]

  48. Steiner, P., Philipp, A., Lukas, J., Godden Kent, D., Pagano, M., Mittnacht, S., Bartek, J. and Eilers, M. (1995) Identification of a Myc-dependent step during the formation of active G1 cyclin-cdk complexes. EMBO J., 14, 4814–4826.[Web of Science][Medline]

  49. Trumpp, A., Refaeli, Y., Oskarsson, T., Gasser, S., Murphy, M., Martin, G.R. and Bishop, J.M. (2001) c-Myc regulates mammalian body size by controlling cell number but not cell size. Nature, 414, 768–773.[CrossRef][Medline]

  50. de Alboran, I.M., O'Hagan, R.C., Gartner, F., Malynn, B., Davidson, L., Rickert, R., Rajewsky, K., DePinho, R.A. and Alt, F.W. (2001) Analysis of C-MYC function in normal cells via conditional gene-targeted mutation. Immunity, 14, 45–55.[CrossRef][Web of Science][Medline]

  51. Hirotsune, S., Fleck, M.W., Gambello, M.J., Bix, G.J., Chen, A., Clark, G.D., Ledbetter, D.H., McBain, C.J. and Wynshaw Boris, A. (1998) Graded reduction of Pafah1b1 (Lis1) activity results in neuronal migration defects and early embryonic lethality. Nat. Genet., 19, 333–339.[CrossRef][Web of Science][Medline]

  52. Deng, C.X., Wynshaw-Boris, A., Shen, M.M., Daugherty, C., Ornitz, D.M. and Leder, P. (1994) Murine FGFR-1 is required for early postimplantation growth and axial organization. Genes Dev., 8, 3045–3057.[Abstract/Free Full Text]

  53. Filvaroff, E., Erlebacher, A., Ye, J., Gitelman, S.E., Lotz, J., Heillman, M. and Derynck, R. (1999) Inhibition of TGF-beta receptor signaling in osteoblasts leads to decreased bone remodeling and increased trabecular bone mass. Development, 126, 4267–4279.[Abstract]

  54. McLeod, M.J. (1980) Differential staining of cartilage and bone in whole mouse fetuses by Alcian blue and Alizarin red S. Teratology, 22, 299–301.[CrossRef][Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 J. Med. Genet.Home page
S C Sreenath Nagamani, F Zhang, O A Shchelochkov, W Bi, Z Ou, F Scaglia, F J Probst, M Shinawi, C Eng, J V Hunter, et al.
Microdeletions including YWHAE in the Miller-Dieker syndrome region on chromosome 17p13.3 result in facial dysmorphisms, growth restriction, and cognitive impairment
J. Med. Genet., December 1, 2009; 46(12): 825 - 833.
[Abstract] [Full Text] [PDF]

Home page
 JDRHome page
L. Meng, Z. Bian, R. Torensma, and J.W. Von den Hoff
Biological Mechanisms in Palatogenesis and Cleft Palate
Journal of Dental Research, January 1, 2009; 88(1): 22 - 33.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
K. Toyo-oka, T. J. Bowen, S. Hirotsune, Z. Li, S. Jain, S. Ota, L. E. Lozach, I. G. Bassett, J. Lozach, M. G. Rosenfeld, et al.
Mnt-Deficient Mammary Glands Exhibit Impaired Involution and Tumors with Characteristics of Myc Overexpression
Cancer Res., June 1, 2006; 66(11): 5565 - 5573.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
S. Dezfouli, A. Bakke, J. Huang, A. Wynshaw-Boris, and P. J. Hurlin
Inflammatory Disease and Lymphomagenesis Caused by Deletion of the Myc Antagonist Mnt in T Cells
Mol. Cell. Biol., March 15, 2006; 26(6): 2080 - 2092.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
C. W. Hooker and P. J. Hurlin
Of Myc and Mnt
J. Cell Sci., January 15, 2006; 119(2): 208 - 216.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
L. W. M. Loo, J. Secombe, J. T. Little, L.-S. Carlos, C. Yost, P.-F. Cheng, E. M. Flynn, B. A. Edgar, and R. N. Eisenman
The Transcriptional Repressor dMnt Is a Regulator of Growth in Drosophila melanogaster
Mol. Cell. Biol., August 15, 2005; 25(16): 7078 - 7091.
[Abstract] [Full Text] [PDF]

Home page
 JCBHome page
W. Walker, Z.-Q. Zhou, S. Ota, A. Wynshaw-Boris, and P. J. Hurlin
Mnt-Max to Myc-Max complex switching regulates cell cycle entry
J. Cell Biol., May 9, 2005; 169(3): 405 - 413.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
13/10/1057    most recent
ddh116v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (21)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Toyo-oka, K.
Right arrow Articles by Wynshaw-Boris, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Toyo-oka, K.
Right arrow Articles by Wynshaw-Boris, A.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?