Human Molecular Genetics Advance Access originally published online on April 21, 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Human Molecular Genetics, 2004, Vol. 13, No. 11 1147-1157
DOI: 10.1093/hmg/ddh133
Human Molecular Genetics, Vol. 13, No. 11 © Oxford University Press 2004; all rights reserved
A series of maturity onset diabetes of the young, type 2 (MODY2) mouse models generated by a large-scale ENU mutagenesis program
1Mouse Functional Genomics Research Group, RIKEN Genomic Sciences Center, 214 Maeda-cho, Totsuka-ku, Yokohama, Kanagawa 244-0804, Japan, 2Population and Quantitative Genomics Team, RIKEN Genomic Sciences Center, 1-7-22 Suehiro-cho, Tsurumi-ku, Yokohama, Kanagawa 230-0045, Japan, 3Department of Metabolic Diseases, Faculty of Medicine, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-3815, Japan, 4Department of Pathobiochemistry, Faculty of Pharmacy, Meijo University, 150 Yagotoyama, Tempaku-ku, Nagoya, Aichi 468-8503, Japan, 5Department of Clinical Molecular Medicine, Division of Diabetes, Digestive and Kidney Diseases, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe, Hyogo 650-0017, Japan, 6Mammalian Genetics Laboratory, National Institute of Genetics, Yata 1111, Mishima, Shizuoka 411-8540, Japan, 7Department of Cell Biology, Japanese Foundation for Cancer Research (JFCR) Cancer Institute, 1-37-1 Kami-Ikebukuro, Toshima-Ku, Tokyo 170-8455, Japan and 8Department of Functional Genomics, Division of Molecular Genetics, Center for Translational and Advanced Animal Research on Human Diseases, Tohoku University, 2-1 Seiryo-cho, Aoba-ku, Sendai, Miyagi 980-8575, Japan
Received February 7, 2004; Accepted March 30, 2004
| ABSTRACT |
|---|
|
|
|---|
Mutant mouse models are indispensable tools for clarifying the functions of genes and for elucidating the underlying pathogenic mechanisms of human diseases. Currently, several large-scale mutagenesis projects that employ the chemical mutagen N-ethyl-N-nitrosourea (ENU) are underway worldwide. One specific aim of our ENU mutagenesis project is to generate diabetic mouse models. We screened 9375 animals for dominant traits using a clinical biochemical test and thereby identified 11 mutations in the glucokinase (Gk) gene that were associated with hyperglycemia. GK is a key regulator of insulin secretion in the pancreatic ß-cell. Approximately 190 heterozygous mutations in the human GK gene have been reported to cause maturity onset diabetes of the young, type 2 (MODY2). In addition, five mutations have been reported to cause permanent neonatal diabetes mellitus (PNDM) when present on both alleles. The mutations in our 11 hyperglycemic mutants are located at different positions in Gk. Four have also been found in human MODY2 patients, and another mutant bears its mutation at the same location that is mutated in a PNDM patient. Thus, ENU mutagenesis is effective for developing mouse models for various human genetic diseases, including diabetes mellitus. Some of our Gk mutant lines displayed impaired glucose-responsive insulin secretion and the mutations had different effects on Gk mRNA levels and/or the stability of the GK protein. This collection of Gk mutants will be valuable for understanding GK gene function, for dissecting the function of the enzyme and as models of human MODY2 and PNDM.
| INTRODUCTION |
|---|
|
|
|---|
The glucokinase (GK) enzyme is a member of a family of hexokinase that phosphorylates glucose into glucose-6-phosphate in the first step in glycolysis (1). GK produces two isoforms, namely, the ß-cell-specific and liver-specific isoforms, each of which is characterized by the presence of an isoform-specific first exon (2,3). In ß-cells, GK plays a critical role in the glucose-responsive insulin secretion of ß-cells by functioning as a glucose sensor on account of its kinetics, which allow ß-cells to change glucose phosphorylation rate over a range of physiological glucose concentrations (4). In the liver, the expression of GK is induced by insulin and it may also participate in regulating glucose uptake and glycogen synthesis (5,6).
Mutations in the human GK gene cause three distinguishable syndromes that are inherited with a high penetrance (reviewed in 4,7): one is persistent hyperinsulinemic hypoglycemia of infancy (PHHI), which is caused by mutations that activate the enzyme (8,9); the second is maturity onset diabetes of the young, type2 (MODY2) (10,11); while the third is permanent neonatal diabetes mellitus (PNDM) (12,13). The last two syndromes are caused by mutations that inactivate GK. PHHI and MODY2 are inherited in an autosomal dominant manner whereas PNDM is inherited in a recessive manner. To date,
190 different mutations that are distributed throughout all the GK exons have been identified in MODY2 patients. These include missense, nonsense and splice consensus site mutations and most are caused by single base-pair substitutions (4,7). To date, several hyperglycemic mouse models have been generated by the targeted disruption of Gk (1417). Studies on these various genetically engineered mice have revealed basic mechanisms that cause diabetes. However, these models may not be entirely suitable for the study of human GK-related diseases, since these are due, in many cases, to various subtle mutations. A variety of in vitro structurefunction relationship analyses using recombinant GK enzymes that bear the mutations found in human patients have been reported (1822). Nevertheless, further studies are necessary to clarify the mechanisms by which the subtly and variously mutated GK genes induce disease in vivo.
N-Ethyl-N-nitrosourea (ENU) is an effective chemical mutagen that mainly introduces single base-pair changes (23,24). The point mutations in the genes that are introduced by ENU treatment can result in a large variety of aberrations that range from complete or partial loss-of-function to gain-of-function. Several large-scale saturation mutagenesis projects using ENU have been established with the aim of generating large numbers of mutants that will allow gene functions to be systematically investigated in vivo (2527). These projects take a phenotype-driven rather than a gene-driven approach by screening mice that harbor mutations located throughout the genome for altered phenotypes. This approach has the advantage that the screens are not biased by pre-conceived ideas about gene function. In our RIKEN mutagenesis project, in order to generate mouse models for common human diseases, including diabetes, hypertension and cancer, we screened the mutant mice generated by ENU mutagenesis for various visible, clinical, biochemical and hematological abnormalities.
In this study, we report 11 ENU-induced Gk mutations that were recovered in a screen for dominant mutants. These 11 mutations were scattered throughout the mouse Gk gene and included six missense mutations, two nonsense mutations and three mutations in splice donor or acceptor sites. Four of the lines carried mutations that were identical to those found in human MODY2 patients (4,7). All of our mutant lines had mildly but consistently hyperglycemic progeny with a similar phenotype to that of human MODY2 patients (2830), while the homozygotes suffered severe hyperglycemia soon after birth, as has also been reported for human PNDM patients (12,13). These observations indicate that these Gk mutant mice are likely to be highly useful as mouse models for human MODY2 and PNDM.
| RESULTS |
|---|
|
|
|---|
Generation and identification of Gk mutant mouse lines
To generate various medically relevant mutants in the mouse and to identify their mutations, we performed a genome-wide mutagenesis screen. Male C57BL/6J mice were treated with ENU, then mated with DBA/2J females. By October, 2003, 9375 F1 progeny derived from 670 ENU-treated males had been screened with a clinical biochemical test that examines 32 parameters (http://www.gsc.riken.go.jp/Mouse/) to identify dominant mutants. The F1 outliers were assigned M-numbers after the confirmation of their phenotypes by retesting. To detect hyperglycemic mutants, we sought animals that had free-fed serum glucose levels of 200 mg/dl or more. On this basis, 87 hyperglycemic phenodeviants were detected. The hyperglycemic phenodeviants corresponded to 22% of all the phenodeviants detected in our clinical biochemical screening. The next most commonly occurring phenotypic aberrations were hypercholesterolemia (17.5%), low-alkaline phosphatase (12%) and hypocholesterolemia (10%). Some of these phenodeviants were subjected to inheritance testing, and mapping analyses were performed in the hereditary mutant lines. We obtained 20 dominant hereditary diabetic mutants from the 43 hyperglycemic lines that had been subjected to the inheritance tests.
Of these hereditary diabetic mutant lines, seven mutations were mapped to the proximal region of chromosome 11, where Gk is located, and direct sequencing of all the exons of the Gk gene in these seven lines demonstrated various point mutations in the Gk gene. Further investigation by direct sequencing of unmapped hyperglycemic mutant lines detected four additional Gk mutations (Table 1). All of these 11 Gk mutations were single base-pair substitutions. As shown in Table 1, in our 11 Gk mutant lines, G/C
A/T transitions were induced in four lines (M-341, M-392, M-702 and M-735), and G/C
T/A transversions were found in four lines (M-210, M-475, M-149 and M-552). Thus, eight of the 11 mutations (73%) were induced at a G/C base pair while the remaining three (M-272, M-236 and M-553; 27%) were induced at an A/T base pair (Table 1).
|
Our 11 mutations resulted in various types of mutations, namely, six missense mutations (M-272, M-341, M-392, M-236, M-552 and M-735), two nonsense mutations (M-475 and M-702) and three mutations in splice donor or acceptor sites (M-210, M-149 and M-553) (Table 1). Gk produces a ß-cell-specific isoform and a liver-specific isoform that are distinguished by isoform-specific first exons (2,3). The Gk mutant M-210 had a point mutation in the splicing donor site of the ß-cell-specific exon1, which suggests that M-210 is a ß-cell-specific Gk mutant. Importantly, the mutations in four of our mutants, M-210 [ß-cell-specific splice donor site, intervening sequence 1A (IVS1A)+1G
T], M-392 (Val182Met), M-236 (Thr228Ala) and M-735 (Thr206Met), are identical to mutations identified in human MODY2 patients (4,7).
Effects of the mutations
To elucidate the effect of these mutations on Gk expression in vivo, we investigated the levels of Gk mRNA and protein expression as well as the glucokinase activity from six of the mutant lines in the liver. Two of these lines had nonsense mutations (M-475 and M-702), three had missense mutations (M-272, M-341 and M-392), and one had a splicing donor site mutation in the ß-cell-specific exon1 (M-210).
M-475 and M-702 have nonsense mutations in exons 7 and 9, respectively, and real-time PCR revealed significantly decreased amounts of Gk mRNA in these mutants (49.9 and 59.0%, respectively) when compared with wild-type (WT) animals (Fig. 1B). It is possible that the nonsense-mediated mRNA decay (NMD) pathway may destroy the premature Gk mRNA that is produced by the M-475 and M-702 mutants. This is likely to reduce the GK activity in these mutants. Immunoblotting analysis also revealed that the GK protein signals in these two mutants were significantly less intense (78.1% for M-475 and 68.7% for M-702), which indicates reduced GK protein levels (Fig. 1C). Not unexpectedly, the GK activities of both nonsense mutants were indeed significantly reduced (Fig. 1A).
|
In the missense mutant lines (M-272, M-341 and M-392), real-time PCR revealed no aberration in their mRNA levels (Fig. 1B). However, the GK activity in all three mutants was significantly or relatively decreased to
6569% of the WT GK activity (Fig. 1A). The GK protein levels in the M-272 and M-341 mutants were also significantly lower (67.9 and 66.4% of the WT levels, respectively). However, M-392 had WT levels of GK protein (Fig. 1C). These results suggest that the mutant GK protein of M-392 is functionally impaired and that the mutant GK products of M-272 and M-341 may be unstable in vivo. Therefore, the effects of these three missense mutations could be categorized into at least two types, namely, as mutations that affect the kinase function of GK or as mutations that alter the stability of the GK protein. The M-210 line, which has a point mutation in the splicing donor site of the ß-cell-specific exon1, showed near-normal levels of liver GK activity (96.8% of the WT) (Fig. 1A). Its Gk mRNA and protein levels were also normal (Fig. 1B and C).
MODY2-like diabetic phenotypes of the Gk mutant mice
When the six lines were mated, the hyperglycemic phenotype was detected in the mutant progeny (Table 2). To further analyze the phenotype of these mutants, we performed the oral glucose tolerance test (OGTT) and the insulin tolerance test (ITT). The blood glucose levels of the mutants were significantly higher than those of the WT and N2 controls for all six lines (Fig. 2A and B). The lower insulinogenic indices of the mutants of all the six lines indicate that these mutant mice have impaired glucose sensing and/or insulin secretion (Fig. 2C). Their fasting and free-fed plasma insulin levels did not differ significantly (data not shown). The glucose-lowering effect of insulin was similar or slightly lower in all the mutants when compared with the WT and N2 controls (Fig. 3). As reported previously, GK regulates glucose-stimulated insulin secretion and acts as a glucose sensor in ß-cells (4) and it is known that the mutations in the GK gene in human MODY2 patients impair their insulin secretory response to the glucose load (2830). Our data suggest that the Gk mutant mice, like the human patients, suffer from impaired glucose-responsive insulin secretion that causes hyperglycemia.
|
|
|
The hyperglycemic phenotype of the ß-cell-isoform-specific mutant M-210 is similar to that of the missense and nonsense mutants. As shown by the study on the ß-cell-specific knockout mice (14,17), this can be explained by the fact that the mutation in the ß-cell isoform of Gk is sufficient to impair the regulation of glucose levels.
Analysis of the phenotypes of homozygous mutant animals
Unlike MODY2, which is caused by heterozygous mutations in GK (10,11), PNDM is caused by homozygous mutations or compound heterozygous mutations of GK (12,13). To establish a model for PNDM and to elucidate the effect of homozygous Gk point mutations on GK function, we investigated the phenotype of mice that are homozygous for the mutations seen in the M-210 (mutation at splicing donor of ß-cell-specific exon1), M-702 (Arg345Stop) and M-392 (Val182Met) mice. The mice that were homozygous for the M-210 mutation were normal in size, appearance and body weight at birth. At postnatal day 2 (P2), however, they revealed marked hyperglycemia with blood glucose levels of
380 mg/dl. By P4, their glucose levels had increased to 600 mg/dl (the upper detection limit of the glucose sensor) or more (Fig. 4B). They also showed marked glucosuria at P12. Such profound hyperglycemia and glucosuria were also observed in the M-702 homozygous pups (data not shown). Obvious growth retardation was observed in the M-210 homozygous pups at P2 and they died within the first week of birth (Fig. 4A). The livers of the M-210 homozygous mutants were markedly steatotic (Fig. 4C). Histological analysis of these livers revealed markedly reduced levels of glycogen, and abnormally enlarged fat droplets in the hepatocytes were frequently observed (Fig. 4D). The M-702 homozygous pups also showed this severe growth retardation, histological abnormalities in the liver and early death within a week after birth (data not shown).
|
In contrast, the M-392 homozygous pups, which bore the Val182Met missense mutation, survived for
5 weeks. Marked hyperglycemia was detected at P2 and blood glucose levels of
500 mg/dl were maintained for at least 3 weeks after birth (data not shown). However, the degree of growth retardation observed was less than that exhibited by the M-210 and M-702 homozygotes (data not shown). Macroscopic observation of the M-392 homozygote livers revealed that they did not differ from those of the M-392 heterozygous mutants or WT animals (data not shown), although histological analysis did reveal increased numbers of fat droplets and lower glycogen levels (data not shown). | DISCUSSION |
|---|
|
|
|---|
Various types of mutations result in different effects
ENU-induced random point mutations can result in a large variety of aberrant effects. Phenotype-driven screening of mice mutagenized in this manner could help us to identify novel models of human diseases. When we obtained 20 dominant hereditary diabetic mutants, they frequently exhibited mutations in the Gk gene. This high frequency may be due to the phenotype monogenically associated with Gk mutations, the high penetrance of Gk gene defects or a greater sensitivity of GK kinase activity to amino acid changes, or it may be due to the possibility that haploinsufficiency leads to the phenotypes caused by Gk mutations. In the 9375 mice that were screened 11 Gk mutants were detected. This result indicates that the mutation frequency is 1.17x103/locus, which is comparable to the results reported by the specific-locus test (0.961.59x103/locus) (31).
All of the 11 Gk mutations were single base-pair substitutions. G/C
A/T transitions and G/C
T/A transversions were observed in eight lines (73%). Several ENU-induced mutations at G/C base pairs also have been reported recently (3235). However, a previous report reviewing 62 ENU-induced mutations has shown that ENU predominantly modifies A/T base pairs, since A/T
T/A transversions were induced in 27 mutants, A/T
G/C transitions were found in 24 mutants while A/T
C/G transversions were observed in three mutants. Thus, 87% of the mutations were induced at A/T base pairs. The remaining 13% of mutations were G/C
A/T transitions (five mutants), G/C
T/A transversions (one mutant) and G/C
C/G transversions (two mutants) (25). The reason for the discrepancy between this study and our own is currently unclear. Further analysis of the spectrum of mutations that are induced by ENU in vivo is warranted.
Of the 11 single base-pair substitutions in the Gk gene that were observed, two (M-475 and M-702) resulted in nonsense mutations. Both of these heterozygous mutants showed significantly lower levels of Gk mRNA (
50% of WT levels). The degradation of mRNAs that contain mutations that introduce premature termination codons (PTCs) is often observed in many diseases (36). Such mRNAs are degraded by the nonsense-mediated mRNA decay (NMD) pathway, which is an important quality-control mechanism that eliminates those mRNAs that would produce truncated proteins that may have harmful gain-of-function and other dominant-negative effects (36). The NMD pathway is conserved throughout the eukaryotic lineage ranging from yeasts to humans. At present, it is not clear whether the NMD pathway operates in a tissue- or gene-specific manner, although some tissue and gene specificity has been shown in vitro (37,38). The PTC in the M-475 mutant is generated at Tyr273 in exon 7 and in M-702 at Arg345 in exon 9. Our data suggest that MODY2 caused by a nonsense mutation reduces the production of GK by 50%. Further investigation into the NMD pathway that operates in the pancreas of the heterozygous and homozygous M-475 and M-702 mutants may shed more light on the pathogenic mechanisms behind the development of MODY2. Six of the Gk mutants bore missense mutations. Structurefunction relationship analyses have shown that missense mutations in the GK gene of MODY2 patients have two main consequences, namely, either they impair the kinase function of the enzyme or they impair its stability (2022). The mutations that impair kinase function can be further categorized into two groups: they either cripple the catalytic domain of GK, which drastically reduces the kinase activity of the protein, or they reduce the ability of GK to bind to glucose, which reduces the activity of the protein to a less-profound extent (1822). Three of the missense mutations, namely, Met224Arg (M-272), Cys220Tyr (M-341) and Phe419Leu (M-552), have not been reported previously in human patients, nor has any analysis of their structurefunction relationship been conducted up until now. In this report, we clearly showed that Met224Arg (M-272) and Cys220Tyr (M-341) mutations may impair the stability of their mutant products (Fig. 1) and that the Phe419Leu (M-552) mutant is worthy of further analysis. The other three missense mutations bear the same mutations as those found in MODY2 patients, namely, Val182Met (M-392), Thr228Ala (M-236) and Thr206Met (M-735). No structurefunction study of the last two mutations has been reported so far (7). However, residue Thr228 is located in the substrate-binding site (13,19), and a mutation, Thr228Met, which is identical to that found in human MODY2 and PNDM patients, has been reported to result in drastically reduced kinase activity (20,21). The remaining mutant, M-392 (Val182Met), showed impaired GK activity but normal Gk mRNA and protein levels (Fig. 1), indicating that hyperglycemia in this mouse was due to impaired kinase function rather than degradation of the GK product. This result is consistent with the previous observation that this mutation probably interferes with the substrate-induced conformational change of GK, and that this results in reduced binding affinity for glucose (20,21).
Homozygotes show different phenotypes
Unlike the similar phenotypes detected in the heterozygous mutants, we detected two distinctly different phenotypes in the homozygous animals. With regard to the ß-cell-specific splicing donor site mutant M-210 and the nonsense mutant M-702, the homozygous pups died within the first week after birth, possibly because of severe hyperglycemia and/or growth retardation (Fig. 4A and B). Furthermore, they displayed marked hepatic steatosis (Fig. 4C). Similar observations were detected in Gk knockout mice (14,16,17). These severe phenotypes may be caused by the drastic effects of the mutations, namely, exon skipping or intron retention in M-210, and NMD of the Gk mRNA in M-702, which eliminate or severely damage the GK product and/or GK function in the homozygous pups.
In contrast, the homozygotes with the M-392 missense mutation survived for
5 weeks without insulin treatment and their livers were not as severely affected, although they did exhibit persistent and marked hyperglycemia. As mentioned earlier, the missense mutation Val182Met in M-392 is predicted to interfere with the binding of GK to glucose (19,20). This is a different type of mutation compared to mutations that fall in the catalytic domain of GK and that drastically reduce the kinase activity. The milder phenotype of the M-392 homozygotes that survived for >5 weeks without insulin treatment may thus be due to the residual GK activity that these mice still have.
Recently, five cases of GK-related PNDM that resulted from a complete deficiency of GK activity were reported (12,13). Three probands were homozygous for the missense mutations Met210Lys, Thr228Met or Ala378Val. One was homozygous for a mutation in the splice donor site of exon 8 [intervening sequence 8 (IVS8)+2T
G], and the last patient was a compound heterozygote with the splice-site mutation IVS8+2T
G and the missense mutation Gly264Ser (12,13). Kinetic studies and theoretical structural analyses have revealed that three of the GK missense mutations found in human PNDM patients, namely, Met210Lys, Thr228Met and Ala378Val, are likely to drastically reduce GK catalytic function (12,13). The splicing donor site mutation IVS8+2T
G would result in an in-frame stop codon that has also been predicted to have a dramatic effect on GK function (12,13). These patients exhibited moderate or severe intrauterine growth retardation (birth weight 15001900 g) and severe hyperglycemia shortly after birth (12,13). Some of the phenotypes detected in the Gk knockout mice and our M-210 and M-702 mutants, namely, hepatic steatosis and reduced stores of hepatic glycogen, were not examined in the human PNDM patients (12,13). Nevertheless, the severe diabetic phenotypes displayed by the human patients are similar to those of the Gk knockout mouse model (14,16,17) and our M-210 and M-702 mutants, which were generated by ENU mutagenesis. This reveals the suitability of our mutant mice to model PNDM as well as MODY2.
That the homozygote bearing the M-392 missense mutation (which is found in MODY2 patients) showed a different phenotype to that of the M-210 and M-702 homozygotes and the knockout animals suggests that variations of human GK-related PNDM phenotypes may exist. One of the human PNDM patients was a compound heterozygote with the splice-site mutation IVS8+2T
G and the missense mutation Gly264Ser. Kinetic analysis of the recombinant GK protein with this mutation showed that the Gly264Ser mutation had only a modest effect on enzyme activity in vitro (13). Although no obvious differences have been reported in the phenotypes of human PNDM patients, possibly because of insulin treatment, this compound heterozygous patient would be expected to have milder phenotypes than those of other PNDM patients. Our M-392 mutant may provide a useful model for the study of such a milder type phenotype in PNDM patients.
Many structurefunction studies have suggested that the various mutations found in MODY2 patients would have different effects on GK function and/or stability (1822). Nevertheless, these patients are all basically characterized by mild hyperglycemia. As a result, there was no real clear correlation between the in vitro effects of the mutations and the phenotype of the MODY2 patients that bear these mutations. Our results show that mutations that affect GK function with varying degrees of severity may induce quite markedly different phenotypes in vivo when they are present on both alleles.
Although neonatal diabetes is a rare disorder with an estimated incidence of one in 400 000 live births (39), the frequency of GK mutations appears to be relatively common or underdiagnosed in some populations because of the mild phenotype (40). Therefore, homozygous and compound heterozygous mutations of GK could be the cause of a substantial proportion of PNDM cases. Our Gk mutant mice afford novel and appropriate tools for the study of the pathogenic mechanisms that lead to PNDM.
Novel models for human GK-related diseases
Our study indicates the effectiveness of ENU mutagenesis in generating human disease models. The mutant mice reported here can be used to study the mechanisms that regulate the function of the Gk gene in the MODY2 and GK-related PNDM models. Four of our mutants, M-210 (ß-cell-specific splice donor site, IVS1A+1G
T), M-392 (Val182Met), M-236 (Thr228Ala) and M-735 (Thr206Met), had mutations that are identical to those found in human MODY2 patients (4,7) (Fig. 5). In addition, M-553 bears its mutation at the splice donor site of exon 8, which is the same position of the mutations found in two of the five GK-related PNMD patients reported recently (13). These five mutant lines represent excellent tools that may enable us to elucidate more precisely the molecular basis of the relationship between a mutation and its physiological consequences.
|
| MATERIALS AND METHODS |
|---|
|
|
|---|
Animals
We carried out the animal studies under the guidance issued by the RIKEN Bioscience Technology Center in Outline for conducting animal experiments (issued August 1999, revised October 2001). We obtained the stock mice from CLEA Japan, Inc. We injected male C57BL/6J mice intraperitoneally (i.p.) at 810 weeks of age with 85 or 100 mg/kg B.W. ENU (Sigma). The injections were carried out twice at weekly intervals. The injected males were mated with DBA/2J females after a sterile period (
1011 weeks). Phenotypic screens were routinely carried out on the F1 progeny. Clinical biochemical tests were performed at 11 weeks and the hyperglycemic outliers were assigned M-numbers. For inheritance testing and mapping, we backcrossed the F1 outliers to the DBA/2J animals and recovered the N2 progeny. For further details, see http://www.gsc.riken.go.jp/Mouse/.
Clinical biochemical test
We obtained blood samples (200 µl) from 11-week-old free-fed mice. To separate the serum from the blood, the sample was centrifuged in the presence of a coagulant. The serum was analyzed using the automatic clinical biochemistry analyzer JCA-BM2250 (JEOL). The cut-off value for normal blood glucose levels was set at 200 mg/dl in our screening and inheritance testing.
Mapping and genotyping
For mapping, we analyzed the genomic DNA from N2 progeny using single nucleotide polymorphism (SNP) markers and microsatellite markers. We carried out genotype analysis of the Gk mutations by direct sequencing of the genomic DNAs from N2 animals that were affected or not affected using the ABI3700 and ABI3100 sequencers (Applied Biosystems).
Assays of liver GK activity
We prepared liver extracts as described previously (41) with slight modifications. Liver tissues were homogenized on ice using a Polytron homogenizer in three volumes of ice-cold 100 mM HEPES, pH 7.4, containing 100 mM KCl, 2 mM MgCl2, 1 mM EDTA, 1 mM dithiothreitol, leupeptin (2 µg/ml) and aprotinin (2 µg/ml). This homogenate was used for immunoblotting (see what follows). The supernatant was collected after centrifugation at 20 000 g for 90 min at 4°C and GK enzyme activity was measured by a fluorometric assay according to the method reported previously (41).
Immunoblotting
The liver homogenate prepared as described earlier was separated by SDSPAGE. Protein was assayed by the Lowry method (BioRad). Separated protein was transferred to a nitrocellulose membrane and the GK protein was detected by the affinity-purified antiserum raised against rat liver GK (42) and the ECL chemiluminescent method (Amersham Bioscience). GK protein levels were analyzed by measuring the intensity of the chemiluminescent signals using NIH Image.
Quantitative real-time RTPCR
Total liver RNAs of Gk mutant mice were extracted using TRIzol (GIBCO BRL). Reverse transcription (RT) and real-time PCR reactions were performed using the QuantiTect SYBR Green RTPCR system according to the manufacturer's instructions (Qiagen). Real-time monitoring of PCR products was performed using ABI7700 (Applied Biosystems). For each sample, Gk mRNA levels were determined using a calibration curve. The amount of ß-actin mRNA was used as an endogenous control for each sample. Separate calibration (standard) curves for ß-actin and Gk were constructed using serial dilutions of mRNA from a non-mutagenized animal liver tissue. The primer sets for mouse glucokinase were as follows: for M-210, M-272, M-341, M-475, M-702, forward primer TCCCTGTAAGGCACGAAGACAT, reverse primer TGCCACCACATCCATCTCAA; for M-392, forward primer TGTGAGGTCGGCATGATTGT, reverse primer TCCGCCAATGATCTTTTCG. The primer sets for mouse ß-actin were as follows: forward primer AGATTACTGCTCTGGCTCCTAGCA, reverse primer CTCAGGAGGAGCAATGATCTTGAT.
Glucose and insulin tolerance tests
Before OGTTs, mice were fasted for 1618 h, then glucose (1.5 mg/g body weight) was administered orally. Blood glucose and insulin levels were measured at different time points using the glucose test meter GLUCOCARD (Arkray, Inc.) and an ELISA kit (Shibayagi), respectively. We carried out ITTs on free-fed animals. Mice were injected i.p. with human insulin (0.75 U/kg body weight), and blood glucose levels were measured at different time points using the test meter.
Histological analyses
To detect glycogen, the livers were fixed in 70% ethanol overnight and embedded in OCT compound for cryostat sectioning. The sections were stained with the periodic acidSchiff (PAS) technique. To detect neutral lipids, the livers were fixed in ice-cold 4% paraformaldehyde in phosphate-buffered saline (PBS), pH 7.4, overnight, washed in PBS overnight then immersed in 30% sucrose/PBS overnight. Tissues were embedded in OCT compound for cryostat sectioning and the sections were stained with the Oil Red-O technique.
| FOOTNOTES |
|---|
* To whom correspondence should be addressed at: Mouse Functional Genomics Research Group, RIKEN Genomic Sciences Center, 214 Maeda-cho, Totsuka-ku, Yokohama, Kanagawa 244-0804, Japan. Tel: +81 355673571; Fax: +81 353943953; Email: tnoda{at}ims.u-tokyo.ac.jp
| REFERENCES |
|---|
|
|
|---|
- Printz, R.L., Magnuson, M.A. and Granner, D.K. (1993) Mammalian glucokinase. Annu. Rev. Nutr., 13, 463496.[CrossRef][Web of Science][Medline]
-
Iynedjian, P.B., Pilot, P.R., Nouspikel, T., Milburn, J.L., Quaade, C., Hughes, S., Ucla, C. and Newgard, C.B. (1989) Differential expression and regulation of the glucokinase gene in liver and islets of Langerhans. Proc. Natl Acad. Sci. USA, 86, 78387842.
[Abstract/Free Full Text] - Magnuson, M.A. (1990) Glucokinase gene structure. Functional implications of molecular genetic studies. Diabetes, 39, 523527.[Abstract]
-
Matschinsky, F.M. (2002) Regulation of pancreatic ß-cell glucokinase: From basics to therapeutics. Diabetes, 51 (Suppl. 3), S394404.
[Abstract/Free Full Text] - Velho, G., Petersen, K.F., Perseghin, G., Hwang, J.H., Rothman, D.L., Pueyo, M.E., Cline, G.W., Froguel, P. and Shulman, G.I. (1996) Impaired hepatic glycogen synthesis in glucokinase-deficient (MODY-2) subjects. J. Clin. Invest., 98, 17551761.[Web of Science][Medline]
-
Magnuson, M.A., Andreone, T.L., Printz, R.L., Koch, S. and Granner, D.K. (1989) Rat glucokinase gene: structure and regulation by insulin. Proc. Natl Acad. Sci. USA, 86, 48384842.
[Abstract/Free Full Text] - Gloyn, A.L. (2003) Glucokinase (GCK) mutations in hyper- and hypoglycemia: maturity-onset diabetes of the young, permanent neonatal diabetes, and hyperinsulinemia of infancy. Hum. Mutat., 22, 353362.[CrossRef][Web of Science][Medline]
-
Glaser, B., Kesavan, P., Heyman, M., Davis, E., Cuesta, A., Buchs, A., Stanley, C.A., Thornton, P.S., Permutt, M.A., Matschinsky, F.M. et al. (1998) Familial hyperinsulinism caused by an activating glucokinase mutation. N. Engl. J. Med., 338, 226230.
[Free Full Text] -
Christesen, H.B., Jacobsen, B.B., Odili, S., Buettger, C., Cuesta-Munoz, A., Hansen, T., Brusgaard, K., Massa, O., Magnuson, M.A., Shiota, C. et al. (2002) The second activating glucokinase mutation (A456V): implications for glucose homeostasis and diabetes therapy. Diabetes, 51, 12401246.
[Abstract/Free Full Text] - Vionnet, N., Stoffel, M., Takeda, J., Yasuda, K., Bell, G.I., Zouali, H., Lesage, S., Velho, G., Iris, F., Passa, Ph. et al. (1992) Nonsense mutation in the glucokinase gene causes early-onset non-insulin-dependent diabetes mellitus. Nature, 356, 721722.[CrossRef][Medline]
-
Froguel, P., Zouali, H., Vionnet, N., Velho, G., Vaxillaire, M., Sun, F., Lesage, S., Stoffel, M., Takeda, J., Passa, P. et al. (1993) Familial hyperglycemia due to mutations in glucokinase. Definition of a subtype of diabetes mellitus. N. Engl. J. Med., 328, 697702.
[Abstract/Free Full Text] -
Njolstad, P.R., Sovik, O., Cuesta-Munoz, A., Bjorkhaug, L., Massa, O., Barbetti, F., Undlien, D.E., Shiota, C., Magnuson, M.A., Molven, A. et al. (2001) Neonatal diabetes mellitus due to complete glucokinase deficiency. N. Engl. J. Med., 344, 15881592.
[Free Full Text] -
Njolstad, P.R., Sagen, J.V., Bjorkhaug, L., Odili, S., Shehadeh, N., Bakry, D., Sarici, S.U., Alpay, F., Molnes, J., Molven A. et al. (2003) Permanent neonatal diabetes caused by glucokinase deficiency: inborn error of the glucose-insulin signaling pathway. Diabetes, 52, 28542860.
[Abstract/Free Full Text] -
Terauchi, Y., Sakura, H., Yasuda, K., Iwamoto, K., Takahashi, N., Ito, K., Kasai, H., Suzuki, H., Ueda, O., Kamada, N. et al. (1995) Pancreatic beta-cell-specific targeted disruption of glucokinase gene. Diabetes mellitus due to defective insulin secretion to glucose. J. Biol. Chem., 270, 3025330256.
[Abstract/Free Full Text] -
Bali, D., Svetlanov, A., Lee, H.W., Fusco-DeMane, D., Leiser, M., Li, B., Barzilai, N., Surana, M., Hou, H., Fleischer, N. et al. (1995) Animal model for maturity-onset diabetes of the young generated by disruption of the mouse glucokinase gene. J. Biol. Chem., 270, 2146421467.
[Abstract/Free Full Text] - Grupe, A., Hultgren, B., Ryan, A., Ma, Y.H., Bauer, M. and Stewart, T.A. (1995) Transgenic knockouts reveal a critical requirement for pancreatic beta cell glucokinase in maintaining glucose homeostasis. Cell, 83, 6978.[CrossRef][Web of Science][Medline]
-
Postic, C., Shiota, M., Niswender, K.D., Jetton, T.L., Chen, Y., Moates, J.M., Shelton, K.D., Lindner, J., Cherrington, A.D. and Magnuson, M.A. (1999) Dual roles for glucokinase in glucose homeostasis as determined by liver and pancreatic beta cell-specific gene knock-outs using Cre recombinase. J. Biol. Chem., 274, 305315.
[Abstract/Free Full Text] -
Takeda, J., Gidh-Jain, M., Xu, L.Z., Froguel, P., Velho, G., Vaxillaire, M., Cohen, D., Shimada, F., Makino, H., Nishi, S. et al. (1993) Structure/function studies of human beta-cell glucokinase. Enzymatic properties of a sequence polymorphism, mutations associated with diabetes, and other site-directed mutants. J. Biol. Chem., 268, 1520015204.
[Abstract/Free Full Text] -
Gidh-Jain, M., Takeda, J., Xu, L.Z., Lange, A.J., Vionnet, N., Stoffel, M., Froguel, P., Velho, G., Sun, F., Cohen, D. et al. (1993) Glucokinase mutations associated with non-insulin-dependent (type 2) diabetes mellitus have decreased enzymatic activity: implications for structure/function relationships. Proc. Natl Acad. Sci. USA, 90, 19321936.
[Abstract/Free Full Text] - Liang, Y., Kesavan, P., Wang, L.Q., Niswender, K., Tanizawa, Y., Permutt, M.A., Magnuson, M.A. and Matschinsky, F.M. (1995) Variable effects of maturity-onset-diabetes-of-youth (MODY)-associated glucokinase mutations on substrate interactions and stability of the enzyme. Biochem. J., 309, 167173.
- Davis, E.A., Cuesta-Munoz, A., Raoul, M., Buettger, C., Sweet, I., Moates, M., Magnuson, M.A. and Matschinsky, F.M. (1999) Mutants of glucokinase cause hypoglycaemia- and hyperglycaemia syndromes and their analysis illuminates fundamental quantitative concepts of glucose homeostasis. Diabetologia, 42, 11751186.[CrossRef][Web of Science][Medline]
- Miller, S.P, Anand, G.R., Karschnia, E.J., Bell, G.I., LaPorte, D.C. and Lange, A.J. (1999) Characterization of glucokinase mutations associated with maturity-onset diabetes of the young type 2 (MODY-2): different glucokinase defects lead to a common phenotype. Diabetes, 48, 16451651.[Abstract]
-
Kohler, S.W., Provost, G.S., Fieck, A., Kretz, P.L., Bullock, W.O., Sorge, J.A., Putman, D.L. and Short, J.M. (1991) Spectra of spontaneous and mutagen-induced mutations in the lacI gene in transgenic mice. Proc. Natl Acad. Sci. USA, 88, 79587962.
[Abstract/Free Full Text] -
Provost, G.S. and Short, J.M. (1994) Characterization of mutations induced by ethylnitrosourea in seminiferous tubule germ cells of transgenic B6C3F1 mice. Proc. Natl Acad. Sci. USA, 91, 65646568.
[Abstract/Free Full Text] -
Justice, M.J., Noveroske, J.K., Weber, J.S., Zheng, B. and Bradley, A. (1999) Mouse ENU mutagenesis. Hum. Mol. Genet., 8, 19551963.
[Abstract/Free Full Text] - Nolan, P.M., Peters, J., Strivens, M., Rogers, D., Hagan, J., Spurr, N., Gray, I.C., Vizor, L., Brooker, D., Whitehill, E. et al. (2000) A systematic, genome-wide, phenotype-driven mutagenesis programme for gene function studies in the mouse. Nat. Gent., 25, 440443.[CrossRef][Web of Science][Medline]
- Hrabe de Angelis, M.H., Flaswinkel, H., Fuchs, H., Rathkolb, B., Soewarto, D., Marschall, S., Heffner, S., Pargent, W., Wuensch, K., Jung, M. et al. (2000) Genome-wide, large-scale production of mutant mice by ENU mutagenesis. Nat. Genet., 25, 444447.[CrossRef][Web of Science][Medline]
- Velho, G., Froguel, P., Clement, K., Pueyo, M.E., Rakotoambinina, B., Zouali, H., Passa, P., Cohen, D. and Robert, J.J. (1992) Primary pancreatic beta-cell secretory defect caused by mutations in glucokinase gene in kindreds of maturity onset diabetes of the young. Lancet, 340, 444448.[CrossRef][Web of Science][Medline]
- Byrne, M.M., Sturis, J., Clement, K., Vionnet, N., Pueyo, M.E., Stoffel, M., Takeda, J., Passa, P., Cohen, D., Bell, G.I. et al. (1994) Insulin secretory abnormalities in subjects with hyperglycemia due to glucokinase mutations. J. Clin. Invest., 93, 11201130.[Web of Science][Medline]
- Owen, K. and Hattersley, A.T. (2001) Maturity-onset diabetes of the young: from clinical description to molecular genetic characterization. Best. Pract. Res. Clin. Endocrinol. Metab., 15, 309323.[CrossRef][Medline]
-
Hitotsumachi, S., Carpenter, D.A. and Russell, W.L. (1985) Dose-repetition increases the mutagenic effectiveness of N-ethyl-N-nitrosourea in mouse spermatogonia. Proc. Natl Acad. Sci. USA, 82, 66196621.
[Abstract/Free Full Text] -
Hurle, B., Ignatova, E., Massironi, S.M., Mashimo, T., Rios, X., Thalmann, I., Thalmann, R. and Ornitz, D.M. (2003) Non-syndromic vestibular disorder with otoconial agenesis in tilted/mergulhador mice caused by mutations in otopetrin 1. Hum. Mol. Genet., 12, 777789.
[Abstract/Free Full Text] -
Thaung, C., West, K., Clark, B.J., McKie, L., Morgan, J.E., Arnold, K., Nolan, P.M., Peters, J., Hunter, A.J., Brown, S.D. et al. (2002) Novel ENU-induced eye mutations in the mouse: models for human eye disease. Hum. Mol. Genet., 11, 755767.
[Abstract/Free Full Text] -
Isaacs, A.M., Davies, K.E., Hunter, A.J., Nolan, P.M., Vizor, L., Peters, J., Gale, D.G., Kelsell, D.P., Latham, I.D., Chase, J.M. et al. (2000) Identification of two new Pmp22 mouse mutants using large-scale mutagenesis and a novel rapid mapping strategy. Hum. Mol. Genet., 9, 18651871.
[Abstract/Free Full Text] -
Rajaraman, S., Davis, W.S., Mahakali-Zama, A., Evans, H.K., Russell, L.B. and Bedell, M.A. (2002) An allelic series of mutations in the Kit ligand gene of mice. I. Identification of point mutations in seven ethylnitrosourea-induced Kitsteel alleles. Genetics, 162, 331340.
[Abstract/Free Full Text] -
Frischmeyer, P.A. and Dietz, H.C. (1999) Nonsense-mediated mRNA decay in health and disease. Hum. Mol. Genet., 8, 18931900.
[Abstract/Free Full Text] -
Sun, X., Li, X., Moriarty, P.M., Henics, T., LaDuca, J.P. and Maquat, L.E. (2001) Nonsense-mediated decay of mRNA for the selenoprotein phospholipid hydroperoxide glutathione peroxidase is detectable in cultured cells but masked or inhibited in rat tissues. Mol. Biol. Cell, 12, 10091017.
[Abstract/Free Full Text] -
Bateman, J.F., Freddi, S., Nattrass, G.. and Savarirayan, R. (2003) Tissue-specific RNA surveillance? Nonsense-mediated mRNA decay causes collagen X haploinsufficiency in Schmid metaphyseal chondrodysplasia cartilage. Hum. Mol. Genet., 12, 217225.
[Abstract/Free Full Text] - Shield, J.P. (2000) Neonatal diabetes: new insights into aetiology and implications. Horm. Res., 53 (Suppl. 1), 711.
- Velho, G. and Robert, J.J. (2000) Maturity-onset diabetes of the young (MODY): genetic and clinical characteristics. Horm. Res., 57 (Suppl. 1), 2933.
- Hara, H., Miwa, I., and Okuda, J. (1986) Inhibition of rat liver glucokinase by alloxan and ninhydrin. Chem. Pharm. Bull., 34, 47314737.
-
Toyoda, Y., Miwa, I., Kamiya, M., Ogiso, S., Okuda, J., and Nonogaki, T. (1995) Changes in subcellular and zonal distribution of glucokinase in rat liver during postnatal development. FEBS Lett., 359, 8184.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:
![]() |
K. Kakugawa, T. Yasuda, I. Miura, A. Kobayashi, H. Fukiage, R. Satoh, M. Matsuda, H. Koseki, S. Wakana, H. Kawamoto, et al. A Novel Gene Essential for the Development of Single Positive Thymocytes Mol. Cell. Biol., September 15, 2009; 29(18): 5128 - 5135. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. CHATZIGEORGIOU, A. HALAPAS, K. KALAFATAKIS, and E. KAMPER The Use of Animal Models in the Study of Diabetes Mellitus In Vivo, March 1, 2009; 23(2): 245 - 258. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Svenson, N. Ahituv, R. S. Durgin, H. Savage, P. A. Magnani, O. Foreman, B. Paigen, and L. L. Peters A new mouse mutant for the LDL receptor identified using ENU mutagenesis J. Lipid Res., November 1, 2008; 49(11): 2452 - 2462. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Goldsworthy, A. Hugill, H. Freeman, E. Horner, K. Shimomura, D. Bogani, G. Pieles, V. Mijat, R. Arkell, S. Bhattacharya, et al. Role of the Transcription Factor Sox4 in Insulin Secretion and Impaired Glucose Tolerance Diabetes, August 1, 2008; 57(8): 2234 - 2244. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Aigner, B. Rathkolb, N. Herbach, M. H. de Angelis, R. Wanke, and E. Wolf Diabetes models by screen for hyperglycemia in phenotype-driven ENU mouse mutagenesis projects Am J Physiol Endocrinol Metab, February 1, 2008; 294(2): E232 - E240. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Masuya, K. Nishida, T. Furuichi, H. Toki, G. Nishimura, H. Kawabata, H. Yokoyama, A. Yoshida, S. Tominaga, J. Nagano, et al. A novel dominant-negative mutation in Gdf5 generated by ENU mutagenesis impairs joint formation and causes osteoarthritis in mice Hum. Mol. Genet., October 1, 2007; 16(19): 2366 - 2375. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.L. Kennedy and M.K. O'Bryan N-ethyl-N-nitrosourea (ENU) mutagenesis and male fertility research Hum. Reprod. Update, May 1, 2006; 12(3): 293 - 301. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. M. Matschinsky, M. A. Magnuson, D. Zelent, T. L. Jetton, N. Doliba, Y. Han, R. Taub, and J. Grimsby The Network of Glucokinase-Expressing Cells in Glucose Homeostasis and the Potential of Glucokinase Activators for Diabetes Therapy Diabetes, January 1, 2006; 55(1): 1 - 12. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Printz and D. K. Granner Tweaking the Glucose Sensor: Adjusting Glucokinase Activity with Activator Compounds Endocrinology, September 1, 2005; 146(9): 3693 - 3695. [Full Text] [PDF] |
||||
![]() |
H. Masuya, K. Shimizu, H. Sezutsu, Y. Sakuraba, J. Nagano, A. Shimizu, N. Fujimoto, A. Kawai, I. Miura, H. Kaneda, et al. Enamelin (Enam) is essential for amelogenesis: ENU-induced mouse mutants as models for different clinical subtypes of human amelogenesis imperfecta (AI) Hum. Mol. Genet., March 1, 2005; 14(5): 575 - 583. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||












