Skip Navigation


Human Molecular Genetics Advance Access originally published online on May 5, 2004
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
13/13/1291    most recent
ddh150v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (14)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Mientjes, E. J.
Right arrow Articles by Nelson, D. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mientjes, E. J.
Right arrow Articles by Nelson, D. L.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2004, Vol. 13, No. 13 1291-1302
DOI: 10.1093/hmg/ddh150
Human Molecular Genetics, Vol. 13, No. 13 © Oxford University Press 2004; all rights reserved

Fxr1 knockout mice show a striated muscle phenotype: implications for Fxr1p function in vivo

Edwin J. Mientjes1, Rob Willemsen1, Laura L. Kirkpatrick3,{dagger}, Ingeborg M. Nieuwenhuizen1, Marianne Hoogeveen-Westerveld1, Marcel Verweij2, Surya Reis1, Barbara Bardoni4, Andre T. Hoogeveen1, Ben A. Oostra1 and David L. Nelson3,*

1Department of Clinical Genetics and 2Department of Pathology, Erasmus University, Rotterdam, The Netherlands, 3Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX, USA and 4Institut de Genetique et de Biologie Moleculaire et Cellulaire, CNRS/INSERM/ULP, Illkirch, France

Received January 23, 2004; Accepted April 25, 2004


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
FXR1 is one of the two known homologues of FMR1. FXR1 shares a high degree of sequence homology with FMR1 and also encodes two KH domains and an RGG domain, conferring RNA-binding capabilities. In comparison with FMRP, very little is known about the function of FXR1P in vivo. Mouse knockout (KO) models exist for both Fmr1 and Fxr2. To study the function of Fxr1 in vivo, we generated an Fxr1 KO mouse model. Homozygous Fxr1 KO neonates die shortly after birth most likely due to cardiac or respiratory failure. Histochemical analyses carried out on both skeletal and cardiac muscles show a disruption of cellular architecture and structure in E19 Fxr1 neonates compared with wild-type (WT) littermates. In WT E19 skeletal and cardiac muscles, Fxr1p is localized to the costameric regions within the muscles. In E19 Fxr1 KO littermates, in addition to the absence of Fxr1p, costameric proteins vinculin, dystrophin and {alpha}-actinin were found to be delocalized. A second mouse model (Fxr1+neo), which expresses strongly reduced levels of Fxr1p relative to WT littermates, does not display the neonatal lethal phenotype seen in the Fxr1 KOs but does display a strongly reduced limb musculature and has a reduced life span of ~18 weeks. The results presented here point towards a role for Fxr1p in muscle mRNA transport/translation control similar to that seen for Fmrp in neuronal cells.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
FXR1 and FXR2 are the two known vertebrate autosomal homologues of the X-linked FMR1 gene (1,2). Mutations in the FMR1 gene cause the most common hereditary form of mental retardation in humans, the fragile X syndrome (3) (reviewed in 4). FXR1 was isolated initially from a Xenopus laevis cDNA library and found to share ~60% identity at the amino acid level with the protein encoded for by FMR1, FMRP (1). Members of the FMR1 gene family exhibit two highly conserved KH domains and an RGG region that are found in many RNA-binding proteins. FMR1P and its homologues have been found to bind a variety of RNAs (5,6). Given the high degree of protein similarity among members of the FMR1 gene family, it is possible that these genes have overlapping functions. In fragile X syndrome, expression of the FXR1 gene is not altered, and clearly does not compensate for the FMR1 functions that are lacking in these patients (1,7). Mice mutated for the Fxr2 gene show some phenotypic similarities to Fmr1 knockouts (KOs), suggesting that the functions of these genes overlap (8), and double KOs further support this notion (D.L. Nelson, manuscript in preparation). In order to further understand the functional relationships among these genes, we sought to create a KO model for Fxr1.

One of the important functions assigned to FMRP is its ability to bind RNA. A number of studies have clearly demonstrated FMRP to interact with RNA in vivo to ~4% of brain mRNA, including its own mRNA, and with structure specificity (915). Recombinant FMRP and FMRP immunoprecipitated from brain homogenates have revealed that a large proportion of FMRP-bound mRNAs harbours a purine (G) quartet structure (12,16,17). FMRP binds to RNA as part of an mRNP complex (16) containing in addition to mRNA molecules, proteins including FXR1P, FXR2P, NuFip, CYFIP, Nucleolin, YB-1 and staufen (15,1823). Staufen is believed to be involved in transport of RNA granules in dendrites (24,25). In line with this finding, PC12 cells stably expressing a GFP–FMRP fusion protein have enabled the visualization of the trafficking of GFP–FMRP-containing granules into the neurites of these cells (26). In addition to transport, FMRP has also been found to affect transcription, which was first demonstrated by its ability to non-specifically repress transcription in vitro in reticulocyte lysates and Xenopus oocytes (27,28) and in co-transfection experiments (29). More recently, translational modulation in vivo has been shown for elongation factor 1A mRNA (30), type-1 metabotropic glutamate receptor (31) and modulation via the BC1 RNA (32) and phosphorylation (33).

Relatively little is known currently about the functions of FXR1P and FXR2P, compared with FMRP. Fxr1p is expressed ubiquitously during early mouse embryogenesis, and primarily in the ganglia and neurons in the brain, the gonads and in skeletal and cardiac muscles towards the end of the gestation period (34), in agreement with mRNA expression levels as determined by in situ hybridization (35). FMRP is highly expressed in adult neurons and especially in Purkinje cells, where both FXR1P and FXR2P are also expressed in high levels. In testes FMRP, FXR1P and FXR2P are all expressed but at various levels and in different cell types (7). In murine skeletal muscles, Fxr1p is expressed in high levels and is localized within the muscle contractile bands (36,37) with only very weak signals visible for Fmrp and Fxr2p (36). Fxr1 exhibits significant alternative splicing, and generates isoforms that vary from tissue to tissue (37). In contrast, no alternative splicing has been reported for Fxr2, and the several isoforms produced by Fmr1 do not appear to be altered in relative abundance when comparing tissues (38,39).

Mice with loss-of-function mutations in Fmr1 and Fxr2 are currently available (8,40). These mouse strains are a valuable tool in the study of both genes (reviewed in 41). No such model has been described for Fxr1. In our approach to study the function of FXR1P in vivo, we utilized embryonic stem cell technology to create a conditional knockout allele for Fxr1 by flanking the promoter and first exon of FXR1 with bacteriophage P1-derived loxP sites. Here we present data obtained from a detailed study of Fxr1 KO mice focused on pathology and biochemistry.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Generation of Fxr1 mouse lines
In the targeting construct, a ‘floxed’ neo cassette (Fig. 1) was introduced into the first intron of Fxr1, to allow selection with G418 for the ES cells that had incorporated the construct by homologous recombination. After electroporation of the targeting plasmid into E14 ES cells, the DNA isolated from the 480 clones was subjected to PCR and Southern analyses yielding four homologous recombinants. Two clones (498 and 515) were used for further experiments. The neo cassette was removed in the ES cells by introduction of a plasmid expressing Cre-recombinase. ES clones that lost G418 resistance were isolated and tested for the presence of exon 1 flanked by loxP sites. Two different ES cell lines that still contained the neo cassette in intron 1 and two lines (clones 83 and 90) that lacked the neo cassette were injected into mouse blastocysts. Chimeric animals were crossed with C57BL/6 mice and the offspring tested for the presence of two or three loxP sites. Two independent mouse lines were created containing the neo cassette (Fxr1+neo) and two lacking the neo cassette but having a floxed exon 1 (Fxr1 conditional KO). Heterozygous Fxr1 KO mice were obtained through the mating of Fxr1 conditional KO mice with mice expressing Cre-recombinase under the control of the cytomegalovirus immediate early enhancer–chicken ß-actin hybrid (CAG) promoter (T. de Wit and F. Grosveld, unpublished data). Maternally derived cre mRNA and protein have been found to be present in mature oocytes of CAG-cre mice ensuring a very early recombination of sequences flanked by loxP sites (42).



View larger version (18K):
[in this window]
[in a new window]
 
Figure 1. Schematic representation of Fxr1 alleles obtained after homologous recombination events in the ES cells. The lower two alleles are the result of transient Cre-induced recombination.

 
Fxr1+neo mice
Homozygous Fxr1+neo neonates are indistinguishable at birth from their wild-type (WT) and heterozygous littermates, but their growth lags behind that of both WT and heterozygous pups, resulting in markedly smaller animals only a few days after birth. The mice continue to grow after birth, albeit at a slower rate than their WT littermates, and reach their maximum weight after ~8 weeks (Fig. 2). Thereafter, the condition of the Fxr1+neo mice slowly deteriorates resulting in a strikingly shortened life span averaging between 10 and 18 weeks.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 2. Fxr1+neo mice experience growth retardation. A depiction of body weight over time for WT, heterozygous Fxr1+neo (het Fxr1+neo) and homozygous Fxr1+neo littermates.

 
Fxr1 KO mice
Fxr1 conditional KO mice do not appear to be different from WT mice. They were mated with CAG-Cre-expressing mice to obtain heterozygous Fxr1 KO offspring. Inbreeding of heterozygous Fxr1 KO mice produced homozygous Fxr1 KO pups. These pups are carried to term but die within a few hours after birth, confirming prior unpublished reports by Siomi et al. suggesting that Fxr1 KO leads to neonatal lethality. The litters obtained thus far exhibit no deviation from Mendelian expectations, suggesting all conceptions of homozygotes are viable. The size and weight of the KO pups at birth are not significantly different from either the heterozygous Fxr1 KO or the WT littermates.

Fxr1p distribution and western blotting
As a first screen for the absence of Fxr1p in cells from Fxr1 KO mice, we carried out immunocytochemical localization using monoclonal antibody 3FX on brain sections from both neonatal Fxr1 KO and adult Fxr1+neo mice (Fig. 3). Fxr1p was highly expressed in cortical neurons from WT neonatal mice (Fig. 3A), whereas Fxr1p was totally absent in cortical neurons from Fxr1 KO mice (Fig. 3B). Fxr1p expression in cortical neurons from adult WT (Fig. 3C) and adult Fxr1+neo (Fig. 3D) mice showed a less obvious difference in level of expression; however, neurons from Fxr1+neo mice appear to stain less intensely for Fxr1p. Since immunocytochemical tests have a semi-quantitative character, and thus do not allow clear statements about exact levels of expression, the relative amounts of Fxr1p were determined quantitatively by detection on a western blot with rabbit antibody 830. Figure 4 shows the presence of reduced levels of the 82 and 84 kDa Fxr1p isoforms in the cardiac and skeletal muscles and smaller isoforms in brains of Fxr1+neo mice relative to the WT littermates. None of the Fxr1p isoforms visible in the WT extracts could be visualized in those derived from Fxr1 KO mice. These studies suggest that the Fxr1 KO mice do not produce significant levels of Fxr1p, while the Fxr1+neo mice have reduced levels along with possible alterations in the pattern of alternative splicing of the transcript. Fxr1+neo mice are likely hypomorphic mutants for Fxr1p. To control for differences in the amount of protein loaded onto the gel, the western blot was stripped and immunolabelled with antibody directed against proliferating cell nuclear antigen (PCNA). PCNA is a marker for cell cycle and is involved in DNA repair.



View larger version (134K):
[in this window]
[in a new window]
 
Figure 3. Immunocytochemical localization of Fxr1p in brain sections. WT (A) cortical neurons neurons at the interface between the cortical plate and intermediate zone stain positive for Fxr1p while no signal is obtained in E18 Fxr1 KO (B) material. Relative to 6-week-old WT cortical neurons (C), much lower levels were observed in Fxr1+neo littermates. The neurons in (C) and (D) represent neurons from both the external granular layer (II) and the external pyramidal layer (III).

 


View larger version (74K):
[in this window]
[in a new window]
 
Figure 4. Western blot with antibody 830 showing Fxr1p expression levels in wild-type (WT), Fxr1-knockout (KO) and Fxr1+neo (NEO) mice. (A) Cardiac muscle, skeletal muscle and brain lysates from E18 embryos. (B) Cardiac, muscle and brain samples obtained from 6-week-old WT and Fxr1+neo littermates. Immunostaining with antibodies against PCNA was performed as a control for gel loading.

 
Macroscopic examination, pathology, immunohistochemistry and western analyses
To further detail the phenotypes observed in our mouse strains, the different organs from the mice were subjected to macroscopic examination. Analyses carried out on 6-week-old Fxr1+neo mice showed that their limb musculature is clearly less well-developed relative to WT offspring (Fig. 5A). A number of organs such as the heart, lung, spleen and testes were reduced in size relative to the same organs in WT mice (data not shown). In Fxr1 KO neonates many of the internal organs including the heart, lung and brain appeared paler in colour than in WT neonates. In line with this observation, a number of large blood vessels visible under the skin and on the surfaces of several organs such as the brain in both WT and heterozygous KO neonates, are not clearly visible in KO neonates (Fig. 5B). Hematocrit analysis carried out on blood samples from both WT and KO neonates showed no significant differences, indicating a normal red blood cell count. Importantly, the KO neonates also displayed limb musculature that is less well-developed than in the WT or heterozygous siblings, as described above for adult Fxr1+neo mice.



View larger version (83K):
[in this window]
[in a new window]
 
Figure 5. (A) Front limbs taken from WT and Fxr1+neo littermates at 6 weeks of age clearly demonstrating the difference in musculature. (B) Fxr1 KO and WT neonates observed from above after peeling away the skin. Note the absence of vasculature on the Fxr1 KO neonate that is visible on the head of the WT neonate (arrow).

 
Since at the macroscopic level abnormalities in both Fxr1+neo and Fxr1 KO mice point to the limb musculature and cardiac tissue combined with the fact that Fxr1p is highly expressed in striated muscle tissue prompted us to focus on these tissues in greater detail. Microscopic analysis of haematoxylin and eosin (H&E) stained sections (Fig. 6) from both skeletal muscle and cardiac tissues revealed a distinct difference in the general architecture of both tissues. In neonatal Fxr1 KO mice the muscle cells from the cardiac tissue (Fig. 6B) have a more transparent appearance and the total cytoplasmic volume appears reduced compared with cardiac tissue from WT littermates (Fig. 6A). Also, in skeletal muscles the cytoplasm of muscle cells is reduced in the neonatal Fxr1 KO mice (Fig. 6D) and more nuclei are seen compared with WT littermates (Fig. 6C). Longitudinal sections from skeletal muscles from the adult Fxr1+neo mouse showed a significant reduction in the presence of the characteristic organization of the contractile filaments (Fig. 6F) compared with adult WT littermates (Fig. 6E).



View larger version (195K):
[in this window]
[in a new window]
 
Figure 6. H&E-stained striated muscle sections. (A, B) Heart of WT (A) and Fxr1 KO (B) E19 embryos. (C, D) E19-derived skeletal muscles from WT (C) and Fxr1 KO (D). (E, F) Skeletal muscle sections from 6-week-old WT (E) and Fxr1+neo (F) mice.

 
In the past, Fxr1p localization studies in striated muscle cells focused mainly on adult tissues; therefore, we started to study Fxr1p localization on neonatal skeletal muscle tissues using muscle-specific antibodies against Fxr1p. Figure 7A and B illustrates Fxr1p distribution in skeletal muscle tissue from WT and Fxr1 KO neonatal mice, respectively. Fxr1p is present in costameres in WT muscle cells from both skeletal muscles (Fig. 7A) and cardiac tissue (data not shown), whereas Fxr1 KO cells are totally devoid of Fxr1p (skeletal muscle; Fig. 7B). Costameres are components of the cortical cytoskeleton, and this observation, combined with the observed pathology in Fxr1+neo mice with respect to changes in the characteristic organization of the contractile filaments, prompted us to focus further studies on the costameric protein network to unravel the cause of death of our Fxr1 KO mice.



View larger version (134K):
[in this window]
[in a new window]
 
Figure 7. Immunocytochemical analysis of cardiac and skeletal muscles. WT (A, C, G, K, O) and KO (B, D, H, L, P) E19 skeletal muscle sections in addition to WT (E, I, M, Q) and Fxr1 KO (F, J, N, R) cardiac muscle sections were stained with antibodies against costameric proteins Fxr1p (A, B), {alpha}-actinin (C–F), vinculin (G–J), dystrophin (K–N) and pan-actin (O–R).

 
Antibodies against costameric components {alpha}-actinin, vinculin, dystrophin and actin
Skeletal muscles (limb) from both neonatal WT (Fig. 7C, G, K and O) and Fxr1 KO (Fig. 7D, H, L and P) were studied for these markers using specific antibodies. In addition, similar studies were performed for neonatal cardiac tissues from WT (Fig. 7E, I, M and O) and Fxr1 KO (Fig. 7F, J, N and R) mice. Alpha-actinin distribution (Fig. 7C–F) was significantly altered in both skeletal (compare Fig. 7C and D) and cardiac muscles (compare Fig. 7E and F). However, the difference was more striking in cardiac muscles. For vinculin distribution (Fig. 7G–J) the difference was less obvious; but also more prominent for cardiac muscles. Dystrophin distribution (Fig. 7K–N) was significantly reduced in skeletal muscles from Fxr1 KO mice compared with WT littermates (compare Fig. 7K and L) and even absent in cardiac muscles (compare Fig. 7M and N). Finally, actin distribution (Fig. 7O–R) was not dramatically altered in skeletal muscles from Fxr1 KO mice compared with WT littermates (compare Fig. 7O and P), whereas for cardiac muscles, differences in distribution were more obvious (compare Fig. 7O and R). A quantitative western was carried out on both WT and Fxr1 KO skeletal and cardiac muscles for {alpha}-actinin, vinculin and actin to determine whether there was a reduction in total cellular level of the respective proteins. Results shown in Figure 8 indicate no significant reduction in any of the three tested costameric proteins in the Fxr1 KO mice relative to the WT mice in both muscle types studied.



View larger version (46K):
[in this window]
[in a new window]
 
Figure 8. Western blot analysis carried out on cardiac and skeletal muscles from WT and Fxr1 KO E19 embryos. Antibodies against {alpha}-actinin, vinculin and actin were used. PCNA staining served as a loading control.

 
Hanging wire, grip and foot printing analyses
As a functional test for skeletal muscles, Fxr1+neo mice and WT littermates were subjected to a number of simple muscle strength/coordination tests. During the ‘hanging wire’ experiments Fxr1+neo mice were unable to grasp the metal wire with sufficient strength to support their own body weight and let go immediately whereas their WT and heterozygous littermates could hang on to the horizontal wire for extended periods of time (data not shown). The grip test corroborated the data obtained from the hanging wire experiments showing that the combined strength of the four limbs of the Fxr1+neo mice was severely reduced (data not shown). Data obtained from the walking track analyses show an altered foot print pattern produced by the Fxr1+neo mice compared with WT littermates (Fig. 9). Relative to their littermates, Fxr1+neo mice not only have a shorter stride length, they also display signs of gait abnormalities.



View larger version (11K):
[in this window]
[in a new window]
 
Figure 9. Foot print analysis carried out on WT and Fxr1+neo mice. The front paws of each mouse were smeared with white non-toxic paint and the hind paws with orange paint.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Knowledge about the function of FXR1P in vivo remains limited. To begin to tackle this shortfall we set out to generate an animal model that would enable us to study the effect of the absence of Fxr1p in mice. An Fxr1 conditional KO mouse line harbouring a floxed promoter and first exon of Fxr1 was obtained. Crosses between heterozygous Fxr1 KO mice resulted in ~25% Fxr1 KO neonates that died within a few hours after birth. Immunocytochemistry in addition to western analyses carried out on brain, skeletal and cardiac muscle tissues obtained from these mice show a total absence of detectable Fxr1p (Figs 3 and 4).

In addition to the Fxr1 KO mouse, a second mouse model was generated, the Fxr1+neo strain, in which a floxed anti-sense neomycin cassette was inserted just downstream of the first exon, in intron 1 of Fxr1. Interestingly homozygous Fxr1+neo pups obtained from crosses between heterozygous Fxr1+neo mice did not display neonatal lethality and were found to express Fxr1p (Figs 3 and 4) but at a strongly reduced level compared with that seen in WT littermates. These data indicate that the presence of Fxr1p is essential for normal embryogenesis and birth to occur and that apparently even very small levels are enough to overcome the lethality observed in Fxr1 KO animals just after birth. An explanation for why the neomycin induced a hypomorphic phenotype could lie in the negative stearic hindering effect exerted by the high level of transcription from the PGK promoter driving the neomycin cassette relative to the endogenous Fxr1 promoter oriented in the opposite direction. Northern analysis showed the presence of Fxr1 transcripts of the expected lengths in 6-week-old WT mice; but it was undetectable in RNA isolates from Fxr1+neo littermates (data not shown). Examples of neo cassette-induced interference have been described earlier (43). Another possibility may be the low abundance of correctly spliced messenger RNAs due to cryptic splice acceptor/donor sites present in the neomycin cassette. However, the presence of aberrantly spliced mRNA was investigated but not found (data not shown). The Fxr1+neo mouse does, however, offer the ability to study the role of Fxr1p during embryogenesis and beyond, which would otherwise not be possible in the full Fxr1 KO.

Macroscopically, Fxr1 KO neonates and their WT littermates do not differ much from each other, with the exception of a lack of large blood vessels otherwise clearly visible on the surface of the brain and other tissues in WT mice (Fig. 5B) and a paler appearance of organs such as the heart, lung and brain. Closer microscopic examination of various tissue sections did not point to a gross reduction in the number of blood vessels (data not shown). Also no differences were found in the red blood cell count between the WT and KO neonates (data not shown). Fxr1+neo pups, on the other hand, displayed a severely reduced limb musculature only a few days after birth in addition to weight loss (Fig. 5A). The fact that a muscle phenotype is observed as a result of very low expression of Fxr1p in a tissue where it is normally highly expressed in WT mice made the striated muscles an obvious candidate for a more closer study. We also determined the extent to which the macroscopic alterations in both the cardiac and skeletal muscles could be seen at the microscopic level. By means of a general H&E stain, Fxr1 KO E19 cardiac sections showed a clear loss of architectural structure that is otherwise present in WT samples. Such disarray was not that obvious in skeletal muscle samples obtained from Fxr1 KO embryos that displayed thinner muscle fibres with an increase in the number of nuclei relative to WT-derived material. Using immunocytochemistry, Fxr1p was found to localize along the Z-lines and costameres in a punctated pattern in WT muscle sections as was previously also suggested by Dube et al. (37).

Costameres are periodically placed sites along the sarcolemma that connect the extracellular matrix to the Z-disks in the muscle (reviewed in 44). The dystrophin/glycoprotein complex (DGC) together with the integrin receptor complex anchored in the sarcolemma, link the extracellular basal lamina via costameric proteins including gamma-actin, talin, vinculin, alpha-actinin, desmin and vimentin to the Z-disk. Together, these proteins form a structure that is believed to serve the function of transferring the force generated by myofibrils during muscle contraction to the sarcolemma and subsequently to the extracellular matrix (4548). In addition, costameres have been suggested to play a role in converting mechanical stimuli to alterations in cell signalling or gene expression. In the current study, experiments with antibodies directed against costameric proteins {alpha}-actinin, vinculin, dystrophin and actin in WT muscle sections showed that the costameric architecture was altered and suggests a function for Fxr1p in normal costamere architecture. Very intriguing was the finding that E19 Fxr1 KO skeletal and cardiac muscles displayed a loss of the typical striated banding pattern seen for {alpha}-actinin and vinculin and a strong reduction in the intensity of the dystrophin signal normally seen on the sarcolemma of myofibrils. Western analysis using antibodies directed against {alpha}-actinin, vinculin and actin did not show a significant difference between WT and Fxr1 KO in the total cellular level of {alpha}-actinin, vinculin and actin in both striated and cardiac muscles. This would suggest that the costameric proteins are delocalized and that transcription and expression may not be affected.

Dystrophin is a large membrane-associated protein found in muscle and brain cells and is located on the inner face of the cell membrane together with sarcoglycan and dystroglycan to form the DGC (reviewed in 49). Mutations in the dystrophin gene lead to Duchenne muscular dystrophy (DMD), which manifests as a severe wasting of skeletal muscle resulting in premature death usually due to cardiomyopathy. A mouse model for this disease, the mdx mouse, lacks any discernable dystrophin protein due to a single point mutation resulting in a truncated protein (50,51). Mdx mice rarely display cardiac abnormalities often encountered in human DMD patients but do suffer from dystrophic changes in heavily used muscles such as the diaphragm (52). Double KO mice for both dystrophin and its homologue utrophin also do not develop the strong cardiomyopathy seen in human DMD patients but they do exhibit a shortened lifespan of ~15 weeks (53,54). In light of these findings it is unlikely that the Fxr1 KO lethality is due to the loss in dystrophin expression. Vinculin is a 117 kDa protein that acts as a bridge between the extracellular matrix, binding talin at its amino-terminal end and the actin cytoskeleton (55). With the aid of a mouse vinculin KO model, vinculin deficiency has been found to result in an embryonic lethal phenotype attributed to severe heart and brain defects, leading to the reabsorption of the embryos between days E8 and E10 of gestation (56). Although we cannot, with absolute certainty, ascribe the cause of the Fxr1 KO neonatal lethality to the loss of cellular architecture and/or tissue organization, the severe phenotype manifested in the vinculin KO mouse makes it plausible that the severe loss of the normal striated expression pattern for vinculin seen in Fxr1 KO neonates may contribute to their lethality. This, further compounded with the delocalization of dystrophin and {alpha}-actinin, in addition to other as yet untested structural proteins, is likely to result in either cardiac or respiratory failure within the first few hours of life. On the other hand, a general delay in muscle development with consequent late occurrence of the characteristic striated appearance as a result of unknown cause cannot be excluded.

Costameric proteins vinculin and vimentin are normally found at the costameres and Z-disks in skeletal muscles. In situ hybridizations carried out with specific probes directed against vinculin and vimentin mRNA reveal a co-localization of the messenger and the protein (57,58). This indicates the existence of a specific mechanism for translational control of mRNA at the costameres. Interestingly, Raver1, a protein that contains RNA-binding motifs, has been shown to co-localize and bind vinculin and {alpha}-actinin mRNA in costameres of skeletal muscles. Raver 1 has been hypothesized to play a role in translational regulation of vinculin and {alpha}-actinin (59). FXR1P interacts with CYFIP2 (19), which was found (in turn) to be a component of the WAVE1 complex, which is involved in actin polymerization (60). The question that remains then is how the lack of Fxr1p results in the misdirected expression of proteins dystrophin, vinculin and {alpha}-actinin? The answer may be found in the structural similarities that FXR1P shares with its paralogue FMRP. In neurons FMRP is known to bind to specific target mRNAs and as part of an mRNP complex transport these mRNA molecules to the neurites where RNP particles are believed to be docked at this particular site using the F-actin cytoskeleton followed by translation upon specific stimuli (26,32). FXR1P also has been shown to bind RNA and although its preference for specific mRNA is yet to be determined, it has been found to be one of the components of the mRNP complex (26). Even in the absence of Fmrp, Fxr1p is still able to associate with the mRNP complex (data not shown). Since FXR1P is the only fragile X protein family member significantly present in muscle cells, and based on the data presented here, we would like to propose that FXR1P fulfils an analogous function in muscle cells as that seen for FMRP in neurons, and that FXR1P may be responsible for the transport of dystrophin, vinculin, {alpha}-actinin and other structural costameric mRNAs from the nucleus to the costameric protein network of the muscle cells and may even play a role in local translational control. Proof for this will come from future experiments that identify the mRNA species that FXR1P interacts with and determine whether FXR1P influences their translation. An alternative explanation for the altered protein distribution found, which at present cannot be ruled out, may be the consequence of unhealthy or dying muscle tissue. This will also be looked into in future experiments.

The generation of a conditional Fxr1 KO mouse line has left open a number of avenues that are yet to be explored. In the brain of Fxr1 KO neonates, no effects at the macroscopic level could be detected. Owing to the neonatal lethality, the effects of Fxr1p deficiency during brain development could not be studied as this involves behavioural tests. The use of (inducible) brain-specific Cre-recombinase-expressing mouse strains will enable the generation of mice that are lacking Fxr1p only in the brain and will thus likely be viable. Similarly, the use of inducible muscle-specific Cre expressers will enable one to study the effects of Fxr1p in muscle tissues in a temporal fashion during embryogenesis or thereafter. Limiting expression to the testis is another possibility employing a testis-specific Cre expresser. With the availability of mouse KO models for the other two paralogues Fmr1 and Fxr2, the role of each gene can now be studied separately with crosses to obtain the various double KO strains and ultimately the (inducible) triple KOs. These studies should allow the opportunity to determine the role of the Fxr1 and Fxr2 genes in compensating for the loss of Fmr1, and help to fully delineate the function(s) of Fmr1. Another mouse strain that is currently being set up in our laboratory is very similar to the Fxr1+neo mouse with the exception of the absence of one of the loxP sites situated upstream of the Fxr1 promoter. Upon crossing the new mouse strain with an appropriate Cre expresser, Fxr1p expression will increase from that seen in the Fxr1+neo mice to WT levels, in essence enabling the ability to rescue the hypomorphic phenotype.

The repercussions of the work presented here on the human population, upon extrapolation of our findings in mice to humans, are yet to be determined. The prevalence of naturally occurring FXR1 mutations in the human population as well as in children born with muscle abnormalities is unknown. The screening of tissue samples for FXR1P expression from babies with a muscle phenotype of unknown aetiology will improve their diagnosis and with further research hopefully their prognosis.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Construction of Fxr1 targeting construct
Subcloned fragments (6-30, 6-31 and 6-26) from PAC clone RPCI-21 316J6 were used to create the targeting vector pFxr1-cre/lox KO78 (37). Briefly, a phosphoglycerate kinase (PGK) promoter-driven neomycin resistance gene (neo) flanked by loxP sites was inserted into an XbaI site in the first intron of Fxr1 in the transcriptional orientation opposite that of Fxr1. A third loxP site was placed into an XbaI site 800 bp upstream of exon 1, introducing a NotI site. The targeting vector provided 3.1 kb of homology with the locus upstream of the 5' loxP site, and 3.4 kb of homology 3' to the floxed neo cassette in intron 1.

Homologous recombination in ES cells
The targeting construct pFxr1-cre/lox KO78 was linearized with SalI to facilitate homologous recombination of the plasmid with the ES cell genome. Electroporation was performed using 107 E14 ES cells in 400 µl phosphate-buffered saline (PBS) with a Progenetor II Gene Pulser (1200 µF and 117 V for 10 ms). Selection of transfectants was performed by selecting for the presence of the neo cassette with G418 (200 µg/ml). After cells were cultured to promote colony formation, individual colonies were picked and cultured. From each clonal colony, half was frozen and half was used for DNA isolation to identify homologous recombination events. Of the 480 clones picked after electroporation of ES cells with the targeting construct, 192 were likely homologous recombinants, as they were found not to produce a PCR product with ampicillin-specific primers (AmpF: CAACATTTCCGTGTCGCCCT; AmpR: TCCCAACGATCAAGGCGAGT). By PCR analysis 44 clones were found to harbour the 5' loxP site (Lox1F: GATAGTGCTGTGTGTAGCTCCG; Lox1R: GCTCCTGGCCCCTAGCAAC). Of these clones, four showed the expected banding pattern in Southern blot analyses with both the 5' (350 bp PCR product on p6-33 with primers: CTGGTTGCTCCAAGATGAG and CTCAACACTAACTAGTGTGGC) and 3' probes (320 bp PCR product from p6-34 GTCTGAAGTTAATAATTAAAACCAGTCATCG and GGGGAGGGAAGCAGCCAATCATG). Clones 498 and 515 were chosen after karyotyping and injected into C57BL/6J blastocysts that were implanted in pseudo-pregnant BCBA females.

In vitro Cre expression
Clones 498 and 515 were each electroporated with pMC-Cre, a plasmid for transient Cre expression, to excise the neomycin cassette creating the conditional KO allele. Again, individual clones were picked, DNA isolated and subjected to both PCR and Southern analysis to determine the conditional KO allele-carrying clone. Resulting ES cell clones 83 and 90 were chosen after karyotype analysis and used for blastocyst injections.

DNA analysis
DNA was obtained from ES cells or mouse tails by incubating with Proteinase K (Sigma) in 335 µl lysis buffer [10 mM Tris–HCl, 400 mM NaCl, 2 mM EDTA, pH 7.3–7.4, 1% sodium dodecyl sulphate (SDS)] overnight at 55°C. An aliquot of 100 µl 6 M NaCl was added, and the suspension centrifuged. DNA was precipitated with 1 ml 96% ethanol and washed in 70% ethanol. DNA was dissolved in 100 µl H2O. Southern blot analysis was performed on all isolated ES cell clones that were initially screened by PCR to identify homologous recombination events.

Western analyses
Tissues were each homogenized in lysis buffer [10 mM HEPES, 300 mM KCl, 5 mM MgCl2, 5 mM CaCl2, 0.45% Trition X-100, 0.05% Tween, pH 7.6; protease inhibitor cocktail mix (Roche)]. Homogenates were spun down, and 200 µg protein from each sample was boiled in SDS-loading buffer and run on a 7.5% SDS-polyacrylamide gel and electro-blotted onto nitrocellulose. Fxr1p was detected using a rabbit antibody 830 (1 : 5000) (39) as the primary antibody. {alpha}-Actinin (Chemicon), vinculin (Sigma), dystrophin (Dys1; Novocastra), actin (AC40; Sigma) and PCNA antibodies were used to detect the respective proteins in quantitative western analyses. Horseradish peroxidase (HRP)-labelled anti-mouse IgG was used as secondary antibody, allowing chemiluminescence detection with ECL (Amersham).

Pathology
The weight of each embryo or neonate was determined in addition to the weight of the individual organs isolated thereafter. In addition, E18 embryos, neonates or 6-week-old mice were fixed in 3% paraformaldehyde. For embryos and neonates whole body fixation was performed for 1 day followed by dissection of the different organs. For microscopic analysis we focused on brain, cardiac and skeletal muscle tissues. For adult mice (6 weeks old), the different organs were first dissected before fixation (1 day). Subsequently, organs were processed for paraffin embedding according to standard protocols. Paraffin sections (5 µm) were stained for routine microscopic analysis using the standard H&E staining protocol. Finally, sections were examined using a Zeiss axioskop at magnification 100x.

Immunocytochemistry
Fxr1p localization in paraffin embedded brain sections from WT, Fxr1 KO and Fxr1+neo was studied using monoclonal antibody 3FX (39) in an indirect immunoperoxidase method (39). Similar localization studies were performed on paraffin sections from WT and Fxr1 KO striated muscle tissue (both skeletal muscle and cardiac tissues) using muscle-specific rabbit antibodies against Fxr1p (37,39). To further characterize abnormalities in the architecture of both skeletal muscle and cardiac tissues, the immunocytochemical distribution of several well-characterized cytoskeletal proteins was studied, with special emphasis to proteins of the costameric network, including {alpha}-actinin (Chemicon), vinculin (Sigma), dystrophin (Dys1; Novocastra) and actin (AC40; Sigma). For all immunocytochemical tests either anti-rabbit or anti-mouse Igs conjugated with HRP were used as secondary step. Microwave treatment was performed for antigen retrieval (36). Antigen–antibody complexes were visualized by incubation in a substrate solution, containing hydrogen peroxide and DAB followed by counterstaining with haematoxylin. Endogenous peroxidase activity was inhibited by a 30 min incubation in PBS–hydrogen peroxide–sodium azide solution prior to incubation with specific antibodies. The specificity of the labelling procedure was tested by omitting the primary antibody substitution of the primary antibody with normal rabbit or mouse serum or using tissues from Fxr1 KO mice (only for Fxr1p distribution). Background staining in these control sections was negligible. Notably, monoclonal antibody 3FX has been reported to cross-react with Fxr2p as well; however, using our conditions for paraffin sections no signal could be detected in brain tissue from the Fxr1p KO mouse, indicating absence of cross-reactivity with Fxr2p.

Hanging wire, grip tests and walking track analyses
Hanging wire.
Mice were allowed to grasp a horizontal wire, after which the wire was elevated 30 cm, and the length of time that the mouse was able to maintain a grip on the wire was recorded.

Grip test.
Mice were held by their tails and were allowed to grip a horizontal metal grid (Bioseb) with all paws. The mouse was slowly moved in the horizontal plane away from the apparatus until it released its grip. The maximum force exerted was recorded.

Walking track.
Foot prints were recorded in a well-lit walking alley with a darkened goal box at the end (61). The anatomical landmarks on the front and hind feet of the mice were smeared with finger paint. The mice were allowed to walk down the track, leaving foot prints on normal paper. Multiple recordings were made for each mouse.


    ACKNOWLEDGEMENTS
 
The authors are grateful to Tom de Vries Lentsch and Ruud Koppenol for excellent photography. Pim French, Anna Akhmanova and Ieke Ginjaar kindly provided antibodies specific to actinin, vinculin and dystrophin, respectively. Ton de Wit generously provided the CAG-Cre mice. The technical assistance from Zhe Fang, An Langeveld, Cathy Bakker, Leontine van Unen, Lies-anne Severijnen and Wendy van Kruysdijk is greatly appreciated. This research was supported by NIH R01 HD38038 (B.A.O. and D.L.N.) and HD29256 (D.L.N.), the FRAXA Research Foundation and by the BCM Mental Retardation Research Center.


    FOOTNOTES
 
* To whom correspondence should be addressed. Tel: +1 7137984787; Fax: +1 7137981116; Email: nelson@bcm.tmc.edu

{dagger} Present address: Lexicon Genetics, The Woodlands, TX, USA. Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Siomi, M.C., Siomi, H., Sauer, W.H., Srinivasan, S., Nussbaum, R.L. and Dreyfuss, G. (1995) FXR1, an autosomal homolog of the fragile X mental retardation gene. EMBO J., 14, 2401–2408.[Web of Science][Medline]

  2. Zhang, Y., Oconnor, J.P., Siomi, M.C., Srinivasan, S., Dutra, A., Nussbaum, R.L. and Dreyfuss, G. (1995) The fragile X mental retardation syndrome protein interacts with novel homologs FXR1 and FXR2. EMBO J., 14, 5358–5366.[Web of Science][Medline]

  3. Verkerk, A.J., Pieretti, M., Sutcliffe, J.S., Fu, Y.H., Kuhl, D.P., Pizzuti, A., Reiner, O., Richards, S., Victoria, M.F., Zhang, F.P. et al. (1991) Identification of a gene (FMR-1) containing a CGG repeat coincident with a breakpoint cluster region exhibiting length variation in fragile X syndrome. Cell, 65, 905–914.[CrossRef][Web of Science][Medline]

  4. Hagerman, R.J. (2002) The physical and behavioural phenotype. In Hagerman, R.J. and Hagerman, P. (eds), Fragile-X Syndrome: Diagnosis, Treatment and Research. The Johns Hopkins University Press, Baltimore, pp. 3–109.

  5. Corbin, F., Bouillon, M., Fortin, A., Morin, S., Rousseau, F. and Khandjian, E.W. (1997) The fragile X mental retardation protein is associated with poly(A)(+) mRNA in actively translating polyribosomes. Hum. Mol. Genet., 6, 1465–1472.[Abstract/Free Full Text]

  6. Feng, Y., Absher, D., Eberhart, D.E., Brown, V., Malter, H.E. and Warren, S.T. (1997) FMRP associates with polyribosomes as an mRNP, and the I304N mutation of severe fragile X syndrome abolishes this association. Mol. Cell, 1, 109–118.[CrossRef][Web of Science][Medline]

  7. Tamanini, F., Willemsen, R., van Unen, L., Bontekoe, C., Galjaard, H., Oostra, B.A. and Hoogeveen, A.T. (1997) Differential expression of FMR1, FXR1 and FXR2 proteins in human brain and testis. Hum. Mol. Genet., 6, 1315–1322.[Abstract/Free Full Text]

  8. Bontekoe, C.J., McIlwain, K.L., Nieuwenhuizen, I.M., Yuva-Paylor, L.A., Nellis, A., Willemsen, R., Fang, Z., Kirkpatrick, L., Bakker, C.E., McAninch, R. et al. (2002) Knockout mouse model for Fxr2: a model for mental retardation. Hum. Mol. Genet., 11, 487–498.[Abstract/Free Full Text]

  9. Ashley, C., Jr, Wilkinson, K.D., Reines, D. and Warren, S.T. (1993) FMR1 protein: conserved RNP family domains and selective RNA binding. Science, 262, 563–568.[Abstract/Free Full Text]

  10. Sung, Y.J., Conti, J., Currie, J.R., Brown, W.T. and Denman, R.B. (2000) RNAs that interact with the fragile X syndrome RNA binding protein FMRP. Biochem. Biophys. Res. Commun., 275, 973–980.[CrossRef][Web of Science][Medline]

  11. Brown, V., Small, K., Lakkis, L., Feng, Y., Gunter, C., Wilkinson, K.D. and Warren, S.T. (1998) Purified recombinant Fmrp exhibits selective RNA binding as an intrinsic property of the fragile X mental retardation protein. J. Biol. Chem., 273, 15521–15527.[Abstract/Free Full Text]

  12. Darnell, J.C., Jensen, K.B., Jin, P., Brown, V., Warren, S.T. and Darnell, R.B. (2001) Fragile X mental retardation protein targets G quartet mRNAs important for neuronal function. Cell, 107, 489–499.[CrossRef][Web of Science][Medline]

  13. D'Agata, V., Warren, S., Zhao, W., Torre, E., Alkon, D. and Cavallaro, S. (2002) Gene expression profiles in a transgenic animal model of fragile X syndrome. Neurobiol. Dis., 10, 211.[CrossRef][Web of Science][Medline]

  14. Miyashiro, K.Y., Beckel-Mitchener, A., Purk, T.P., Becker, K.G., Barret, T., Liu, L., Carbonetto, S., Weiler, I.J., Greenough, W.T. and Eberwine, J. (2003) RNA cargoes associating with FMRP reveal deficits in cellular functioning in Fmr1 null mice. Neuron, 37, 417–431.[CrossRef][Web of Science][Medline]

  15. Jin, P., Zarnescu, D.C., Ceman, S., Nakamoto, M., Mowrey, J., Jongens, T.A., Nelson, D.L., Moses, K. and Warren, S.T. (2004) Biochemical and genetic interaction between the fragile X mental retardation protein and the microRNA pathway. Nat. Neurosci., 7, 113–117.[CrossRef][Web of Science][Medline]

  16. Schaeffer, C., Bardoni, B., Mandel, J.L., Ehresmann, B., Ehresmann, C. and Moine, H. (2001) The fragile X mental retardation protein binds specifically to its mRNA via a purine quartet motif. EMBO J., 20, 4803–4813.[CrossRef][Web of Science][Medline]

  17. Brown, V., Jin, P., Ceman, S., Darnell, J.C., O'Donnell, W.T., Tenenbaum, S.A., Jin, X., Feng, Y., Wilkinson, K.D., Keene, J.D. et al. (2001) Microarray identification of FMRP-associated brain mRNAs and altered mRNA translational profiles in fragile X syndrome. Cell, 107, 477–487.[CrossRef][Web of Science][Medline]

  18. Bardoni, B., Schenck, A. and Mandel, J.L. (1999) A novel RNA-binding nuclear protein that interacts with the fragile X mental retardation (FMR1) protein. Hum. Mol. Genet., 8, 2557–2566.[Abstract/Free Full Text]

  19. Schenck, A., Bardoni, B., Moro, A., Bagni, C. and Mandel, J.L. (2001) A highly conserved protein family interacting with the fragile X mental retardation protein (FMRP) and displaying selective interactions with FMRP-related proteins FXR1P and FXR2P. Proc. Natl Acad. Sci. USA, 98, 8844–8849.[Abstract/Free Full Text]

  20. Ceman, S., Brown, V. and Warren, S.T. (1999) Isolation of an FMRP-associated messenger ribonucleoprotein particle and identification of nucleolin and the fragile X-related proteins as components of the complex. Mol. Cell. Biol., 19, 7925–7932.[Abstract/Free Full Text]

  21. Ceman, S., Nelson, R. and Warren, S.T. (2000) Identification of mouse YB1/p50 as a component of the FMRP-associated mRNP particle. Biochem. Biophys. Res. Commun., 279, 904–908.[CrossRef][Web of Science][Medline]

  22. Ohashi, S., Koike, K., Omori, A., Ichinose, S., Ohara, S., Kobayashi, S., Sato, T.A. and Anzai, K. (2002) Identification of mRNP complexes containing pur alpha, mStaufen, fragile X protein and myosin Va, and their association with rough endoplasmic reticulum equipped with a kinesin motor. J. Biol. Chem., 277, 37804–37810.[Abstract/Free Full Text]

  23. Caudy, A.A., Myers, M., Hannon, G.J. and Hammond, S.M. (2002) Fragile X-related protein and VIG associate with the RNA interference machinery. Genes Dev., 16, 2491–2496.[Abstract/Free Full Text]

  24. Kiebler, M.A., Hemraj, I., Verkade, P., Kohrmann, M., Fortes, P., Marion, R.M., Ortin, J. and Dotti, C.G. (1999) The mammalian staufen protein localizes to the somatodendritic domain of cultured hippocampal neurons: implications for its involvement in mRNA transport. J. Neurosci., 19, 288–297.[Abstract/Free Full Text]

  25. Duchaine, T.F., Hemraj, I., Furic, L., Deitinghoff, A., Kiebler, M.A. and DesGroseillers, L. (2002) Staufen2 isoforms localize to the somatodendritic domain of neurons and interact with different organelles. J. Cell. Sci., 115, 3285–3295.[Abstract/Free Full Text]

  26. De Diego Otero, Y., Severijnen, L.A., Van Cappellen, G., Schrier, M., Oostra, B. and Willemsen, R. (2002) Transport of fragile X mental retardation protein via granules in neurites of PC12 cells. Mol. Cell. Biol., 22, 8332–8341.[Abstract/Free Full Text]

  27. Li, Z., Zhang, Y., Ku, L., Wilkinson, K.D., Warren, S.T. and Feng, Y. (2001) The fragile X mental retardation protein inhibits translation via interacting with mRNA. Nucl. Acids Res., 29, 2276–2283.[Abstract/Free Full Text]

  28. Laggerbauer, B., Ostareck, D., Keidel, E.M., Ostareck-Lederer, A. and Fischer, U. (2001) Evidence that fragile X mental retardation protein is a negative regulator of translation. Hum. Mol. Genet., 10, 329–338.[Abstract/Free Full Text]

  29. Mazroui, R., Huot, M.E., Tremblay, S., Filion, C., Labelle, Y. and Khandjian, E.W. (2002) Trapping of messenger RNA by fragile X mental retardation protein into cytoplasmic granules induces translation repression. Hum. Mol. Genet., 11, 3007–3017.[Abstract/Free Full Text]

  30. Sung, Y.J., Dolzhanskaya, N., Nolin, S.L., Brown, T., Currie, J.R. and Denman, R.B. (2003) The fragile X mental retardation protein FMRP binds elongation factor 1A mRNA and negatively regulates its' translation in vivo. J. Biol. Chem., 278, 15669–15678.[Abstract/Free Full Text]

  31. Todd, P.K., Mack, K.J. and Malter, J.S. (2003) The fragile X mental retardation protein is required for type-I metabotropic glutamate receptor-dependent translation of PSD-95. Proc. Natl Acad. Sci. USA, 24, 14374–14378

  32. Zalfa, F., Giorgi, M., Primerano, B., Moro, A., Di Penta, A., Reis, S., Oostra, B. and Bagni, C. (2003) The fragile X syndrome protein FMRP associates with BC1 RNA and regulates the translation of specific mRNAs at synapses. Cell, 112, 317–327.[CrossRef][Web of Science][Medline]

  33. Ceman, S., O'Donnell, W.T., Reed, M., Patton, S., Pohl, J. and Warren, S.T. (2003) Phosphorylation influences the translation state of FMRP-associated polyribosomes. Hum. Mol. Genet., 12, 3295–3305.[Abstract/Free Full Text]

  34. De Diego Otero, Y., Bakker, C.E., Raghoe, P., Severijnen, L.W.F.M., Hoogeveen, A., Oostra, B.A. and Willemsen, R. (2000) Immunocytochemical characterization of FMRP, FXR1P and FXR2P during embryonic development in the mouse. Gene Funct. Dis., 1, 28–37.[CrossRef]

  35. Coy, J.F., Sedlacek, Z., Bachner, D., Hameister, H., Joos, S., Lichter, P., Delius, H. and Poustka, A. (1995) Highly conserved 3'UTR and expression pattern of FXR1 points to a divergent gene regulation of FXR1 and FMR1. Hum. Mol. Genet., 4, 2209–2218.[Abstract/Free Full Text]

  36. Bakker, C.E., de Diego Otero, Y., Bontekoe, C., Raghoe, P., Luteijn, T., Hoogeveen, A.T., Oostra, B.A. and Willemsen, R. (2000) Immunocytochemical and biochemical characterization of FMRP, FXR1P, and FXR2P in the mouse. Exp. Cell Res., 258, 162–170.[CrossRef][Web of Science][Medline]

  37. Dube, M., Huot, M.E. and Khandjian, E.W. (2000) Muscle specific fragile X related protein 1 isoforms are sequestered in the nucleus of undifferentiated myoblast. BMC Genet., 1, 1–4.[Medline]

  38. Kirkpatrick, L.L., McIlwain, K.A. and Nelson, D.L. (1999) Alternative splicing in the murine and human FXR1 genes. Genomics, 59, 193–202.[CrossRef][Web of Science][Medline]

  39. Khandjian, E.W., Bardoni, B., Corbin, F., Sittler, A., Giroux, S., Heitz, D., Tremblay, S., Pinset, C., Montarras, D., Rousseau, F. et al. (1998) Novel isoforms of the fragile X related protein FXR1P are expressed during myogenesis. Hum. Mol. Genet., 7, 2121–2128.[Abstract/Free Full Text]

  40. Bakker, C.E., Verheij, C., Willemsen, R., Vanderhelm, R., Oerlemans, F., Vermey, M., Bygrave, A., Hoogeveen, A.T., Oostra, B.A., Reyniers, E. et al. (1994) Fmr1 knockout mice: a model to study fragile X mental retardation. Cell, 78, 23–33.[CrossRef][Web of Science][Medline]

  41. Kooy, R.F. (2003) Of mice and the fragile X syndrome. Trends Genet., 19, 148–154.[CrossRef][Web of Science][Medline]

  42. Sakai, K. and Miyazaki, J. (1997) A transgenic mouse line that retains Cre recombinase activity in mature oocytes irrespective of the cre transgene transmission. Biochem. Biophys. Res. Commun., 237, 318–324.[CrossRef][Web of Science][Medline]

  43. Holzenberger, M., Zaoui, R., Leneuve, P., Hamard, G. and Le Bouc, Y. (2000) Ubiquitous postnatal LoxP recombination using a doxycycline auto-inducible Cre transgene (DAI-Cre). Genesis, 26, 157–159.[CrossRef][Web of Science][Medline]

  44. Hagiwara, H. and Fallon, J.R. (2001) Shaping membrane architecture: agrins in and out of the synapse. J. Cell Biol., 153, F39–F42.[Abstract/Free Full Text]

  45. Pardo, J.V., Siliciano, J.D. and Craig, S.W. (1983) A vinculin-containing cortical lattice in skeletal muscle: transverse lattice elements (‘costameres’) mark sites of attachment between myofibrils and sarcolemma. Proc. Natl Acad. Sci. USA, 80, 1008–1012.[Abstract/Free Full Text]

  46. Lazarides, E. (1980) Intermediate filaments as mechanical integrators of cellular space. Nature, 283, 249–256.[CrossRef][Medline]

  47. Anastasi, G., Amato, A., Tarone, G., Vita, G., Monici, M.C., Magaudda, L., Brancaccio, M., Sidoti, A., Trimarchi, F., Favaloro, A. et al. (2003) Distribution and localization of vinculin–talin–integrin system and dystrophin–glycoprotein complex in human skeletal muscle. Immunohistochemical study using confocal laser scanning microscopy. Cells Tissues Organs, 175, 151–164.[CrossRef][Web of Science][Medline]

  48. Craig, S.W. and Pardo, J.V. (1983) Gamma actin, spectrin, and intermediate filament proteins colocalize with vinculin at costameres, myofibril-to-sarcolemma attachment sites. Cell Motil., 3, 449–462.[CrossRef][Web of Science][Medline]

  49. Towbin, J.A. (1998) The role of cytoskeletal proteins in cardiomyopathies. Curr. Opin. Cell. Biol., 10, 131–139.[CrossRef][Web of Science][Medline]

  50. Sicinski, P., Geng, Y., Ryder-Cook, A.S., Barnard, E.A., Darlison, M.G. and Barnard, P.J. (1989) The molecular basis of muscular dystrophy in the mdx mouse: a point mutation. Science, 244(4912), 1578–1580.[Abstract/Free Full Text]

  51. Bulfield, G., Siller, W.G., Wight, P.A. and Moore, K.J. (1984) X chromosome-linked muscular dystrophy (mdx) in the mouse. Proc. Natl Acad. Sci. USA, 81, 1189–1192.[Abstract/Free Full Text]

  52. Coulton, G.R., Morgan, J.E., Partridge, T.A. and Sloper, J.C. (1988) The mdx mouse skeletal muscle myopathy. I. A histological, morphometric and biochemical investigation. Neuropathol. Appl. Neurobiol., 14, 53–70.[Web of Science][Medline]

  53. Grady, R.M., Teng, H., Nichol, M.C., Cunningham, J.C., Wilkinson, R.S. and Sanes, J.R. (1997) Skeletal and cardiac myopathies in mice lacking utrophin and dystrophin: a model for Duchenne muscular dystrophy. Cell, 90, 729–738.[CrossRef][Web of Science][Medline]

  54. Deconinck, A.E., Rafael, J.A., Skinner, J.A., Brown, S.C., Potter, A.C., Metzinger, L., Watt, D.J., Dickson, J.G., Tinsley, J.M. and Davies, K.E. (1997) Utrophin–dystrophin-deficient mice as a model for Duchenne muscular dystrophy. Cell, 90, 717–727.[CrossRef][Web of Science][Medline]

  55. Jones, P., Jackson, P., Price, G.J., Patel, B., Ohanion, V., Lear, A.L. and Critchley, D.R. (1989) Identification of a talin binding site in the cytoskeletal protein vinculin. J. Cell. Biol., 109, 2917–2927.[Abstract/Free Full Text]

  56. Xu, W., Baribault, H. and Adamson, E.D. (1998) Vinculin knockout results in heart and brain defects during embryonic development. Development, 125, 327–337.[Abstract]

  57. Cripe, L., Morris, E. and Fulton, A.B. (1993) Vimentin mRNA location changes during muscle development. Proc. Natl Acad. Sci. USA, 90, 2724–2728.[Abstract/Free Full Text]

  58. Morris, E.J. and Fulton, A.B. (1994) Rearrangement of mRNAs for costamere proteins during costamere development in cultured skeletal muscle from chicken. J. Cell. Sci., 107, 377–386.[Abstract]

  59. Huttelmaier, S., Illenberger, S., Grosheva, I., Rudiger, M., Singer, R.H. and Jockusch, B.M. (2001) Raver1, a dual compartment protein, is a ligand for PTB/hnRNPI and microfilament attachment proteins. J. Cell. Biol., 155, 775–786.[Abstract/Free Full Text]

  60. Eden, S., Rohatgi, R., Podtelejnikov, A.V., Mann, M. and Kirschner, M.W. (2002) Mechanism of regulation of WAVE1-induced actin nucleation by Rac1 and Nck. Nature, 418, 790–793.[CrossRef][Medline]

  61. Dijkstra, J.R., Meek, M.F., Robinson, P.H. and Gramsbergen, A. (2000) Methods to evaluate functional nerve recovery in adult rats: walking track analysis, video analysis and the withdrawal reflex. J. Neurosci. Methods, 96, 89–96 [Erratum: (2000) 98(2), 175].[CrossRef][Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Neurophysiol.Home page
J. Zhang, L. Hou, E. Klann, and D. L. Nelson
Altered Hippocampal Synaptic Plasticity in the Fmr1 Gene Family Knockout Mouse Models
J Neurophysiol, May 1, 2009; 101(5): 2572 - 2580.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
S. B. Christie, M. R. Akins, J. E. Schwob, and J. R. Fallon
The FXG: A Presynaptic Fragile X Granule Expressed in a Subset of Developing Brain Circuits
J. Neurosci., February 4, 2009; 29(5): 1514 - 1524.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
L Davidovic, S Sacconi, E G Bechara, S Delplace, M Allegra, C Desnuelle, and B Bardoni
Alteration of expression of muscle specific isoforms of the fragile X related protein 1 (FXR1P) in facioscapulohumeral muscular dystrophy patients
J. Med. Genet., October 1, 2008; 45(10): 679 - 685.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. P. Orengo, P. Chambon, D. Metzger, D. R. Mosier, G. J. Snipes, and T. A. Cooper
Expanded CTG repeats within the DMPK 3' UTR causes severe skeletal muscle wasting in an inducible mouse model for myotonic dystrophy
PNAS, February 19, 2008; 105(7): 2646 - 2651.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
E. Bechara, L. Davidovic, M. Melko, M. Bensaid, S. Tremblay, J. Grosgeorge, E. W. Khandjian, E. Lalli, and B. Bardoni
Fragile X related protein 1 isoforms differentially modulate the affinity of fragile X mental retardation protein for G-quartet RNA structure
Nucleic Acids Res., January 12, 2007; 35(1): 299 - 306.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
C. M. Spencer, E. Serysheva, L. A. Yuva-Paylor, B. A. Oostra, D. L. Nelson, and R. Paylor
Exaggerated behavioral phenotypes in Fmr1/Fxr2 double knockout mice reveal a functional genetic interaction between Fragile X-related proteins
Hum. Mol. Genet., June 15, 2006; 15(12): 1984 - 1994.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
M.-E. Huot, N. Bisson, L. Davidovic, R. Mazroui, Y. Labelle, T. Moss, and E. W. Khandjian
The RNA-binding Protein Fragile X-related 1 Regulates Somite Formation in Xenopus laevis
Mol. Biol. Cell, September 1, 2005; 16(9): 4350 - 4361.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
B. Engels, S. van 't Padje, L. Blonden, L.-a. Severijnen, B. A. Oostra, and R. Willemsen
Characterization of Fxr1 in Danio rerio; a simple vertebrate model to study costamere development
J. Exp. Biol., September 1, 2004; 207(19): 3329 - 3338.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
13/13/1291    most recent
ddh150v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (14)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Mientjes, E. J.
Right arrow Articles by Nelson, D. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mientjes, E. J.
Right arrow Articles by Nelson, D. L.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?