Skip Navigation


Human Molecular Genetics Advance Access originally published online on May 26, 2004
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Material
Right arrow All Versions of this Article:
13/14/1525    most recent
ddh165v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (15)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Venables, J. P.
Right arrow Articles by Elliott, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Venables, J. P.
Right arrow Articles by Elliott, D. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2004, Vol. 13, No. 14 1525-1534
DOI: 10.1093/hmg/ddh165
Human Molecular Genetics, Vol. 13, No. 14 © Oxford University Press 2004; all rights reserved

SIAH1 targets the alternative splicing factor T-STAR for degradation by the proteasome

Julian P. Venables1, Caroline Dalgliesh1, Maria Paolo Paronetto3, Lindi Skitt1, Jared K. Thornton1, Philippa T. Saunders4, Claudio Sette3, Keith T. Jones2 and David J. Elliott1,*

1Institute of Human Genetics, International Centre for Life, Central Parkway, Newcastle upon Tyne NE1 3BZ, UK, 2Cell and Developmental Physiology Research Group, School of Cell and Molecular Biosciences, The Medical School, Framlington Place, University of Newcastle, Newcastle NE2 4HH, UK, 3Department of Public Health and Cell Biology, Section of Anatomy, University of Rome ‘Tor Vergata’, Rome, Italy and 4MRC Human Reproductive Sciences Unit, Centre for Reproductive Biology, 49 Little France Crescent, Edinburgh EH16 4SB, UK

Received April 22, 2004; Accepted May 12, 2004


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
T-STAR is one of three members of the SAM68 family of RNA-binding proteins that have been shown to be involved in various gene expression pathways including the control of pre-mRNA splicing. We employed a two-hybrid screen to identify proteins that interact with human T-STAR. The predominant interacting proteins were the E3 ubiquitin ligases SIAH1 and SIAH2. We found that SIAH1 bound to an octapeptide sequence in T-STAR targeting it for proteasome-dependent degradation. Rodent T-STAR orthologues (also known as etoile or SLM2) were not targeted for degradation by SIAH1. However a double amino acid substitution of mouse T-STAR that mimics the human SIAH1-binding site brought mouse T-STAR under in vivo control of SIAH1. Using a minigene transfection assay for alternative splicing activity we showed that human T-STAR, like its rodent orthologues can influence splice site choice and that human, but not mouse, T-STAR-dependent alternative splicing is modulated by SIAH1. Western blots of protein from purified germ cells indicated that SIAH1 protein expression peaks in meiosis. In mouse, T-STAR is co-expressed with SIAH1 during meiosis but, in humans, T-STAR is only strongly expressed after meiosis. Comparative sequence analysis showed SIAH-mediated proteasomal degradation of T-STAR has evolved in the primate lineage. Collectively these data suggest that SIAH-mediated down regulation of alternative splicing may be an important developmental difference between otherwise highly conserved T-STAR proteins.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Up to 60% of human genes are alternatively spliced, often during development, and although relatively little is known about what turns this process on or off, in some cases it has been attributed to expression of cell type- and tissue-specific splicing factors (1,2). Regulation of alternative splicing is thought to respond to extrinsic signals (3), and it is also thought to be important for spermatogenesis, as important gene regulators are frequently alternatively spliced in testis (4). T-STAR was originally discovered as an interacting protein of the testis-specific splicing factors RBM and hnRNP G-T (5) and its rat paralogue has been shown to cause alternative splicing of various minigenes and to interact with Srp30c, hnRNP L and the glutamate and arginine (ER)-rich domains of splicing associated factors YT521B and SAF-B (6). Although these findings implicate T-STAR in the control of alternative splicing, little is yet known about the signals that regulate either it or other proteins with similar function.

T-STAR is one of three members of the SAM68 family (Fig. 1) of proteins, which are a subgroup of the so-called STAR protein family. These have an extended ‘maxi-KH’ (hnRNPK-homology) RNA-binding domain and are particularly implicated in ‘signal transduction and activation of RNA’ in development (3,7,8). Of these, SAM68 has been most investigated. SAM68 is phosphorylated by both CDK1 and the oncoprotein SRC, stimulates cell cycle progression and is involved in a multitude of processes (reviewed in 7). In contrast, T-STAR generally acts as a growth suppressor that is down-regulated upon immortalization of many cell lines (911). However, T-STAR and SAM68 have many features in common including a role as alternative-splicing factors. T-STAR modulates splice site choice at (AG)-rich sequences and SAM68 binds specifically to (AU)-rich sequences (12,13). SAM68 transduces Ras/Raf signalling to cause incorporation of a variable exon in a CD44 minigene which is also incorporated by rat T-STAR (6,14). Incorporation by SAM68 depends on ERK-mediated phosphorylation of its N-terminus, which is lacking in T-STAR and the relatively uncharacterized third family member SLM1 (11,15) (Fig. 1). Other similarities between SAM68 and T-STAR include a co-localization in punctate subnuclear structures and a role in HIV replication by enhancing export or translation of viral transcripts (reviewed in 7). They also both have SH2- and SH3-binding sites, bind signalling molecules such as the 85 kDa subunit of PI3 kinase (7,10) and they may both be involved in apoptosis (16,17).



View larger version (14K):
[in this window]
[in a new window]
 
Figure 1. Primary structures of the SAM68 family members. Cartoon representation of the three common regions of SAM68, T-STAR and SLM1, showing the maxi-KH domain, the RG-rich domain and the tyrosine-rich domain (Y). RG-dipeptides (white) and conserved Y-residues (black), in their respective regions, are depicted by vertical lines.

 
SIAH1 is an E3 ubiquitin ligase that is thought to affect developmental pathways because it targets important molecules for proteasomal degradation. In this study, we show that human T-STAR is targeted for rapid proteasome-mediated degradation by SIAH1 due to a short peptide SIAH1-recognition motif that is only found in primate lineages. We also show that T-STAR and all the other SAM68 family proteins are capable of stimulating inclusion of the CD44V5 exon when co-transfected into cells, but that among a panel of mouse and human paralogues and orthologues SIAH1 uniquely reduces the alternative splicing activity of human T-STAR. In humans, T-STAR protein expression is reduced until after meiosis consistent with it being a meiotic target for SIAH1-mediated degradation in spermatogenesis. In contrast mouse T-STAR is highly expressed in meiosis, which suggests that species-specific mechanisms have evolved to control the stability of this protein in development.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
T-STAR interacts with SIAH1
T-STAR is an alternative splicing factor that is predominantly expressed in testis and developing brain (5,6). In order to investigate the pathways in which it is involved, a two-hybrid screen using human T-STAR as bait was performed on a human testis library. One hundred and three true positive clones included 36 of T-STAR itself, a homodimerization previously reported (5). Fifty-nine of the clones were novel interactors. Twenty contained the ‘seven in absentia homologue’ proteins SIAH1 and SIAH2. These were isolated 18 and two times, respectively. Since human SIAH1 and SIAH2 proteins are 85% identical except in their N-termini, and no differences in their biochemical properties have been reported, we have concentrated our efforts on SIAH1.

To identify the interacting regions of SIAH1 and T-STAR we tested deletion derivatives of them in a directed two-hybrid assay (Fig. 2A and B). SIAH1 is a typical E3 ubiquitin ligase with an N-terminal RING finger domain (1–99), a central zinc finger region (99–153) and a C-terminal 130 amino acid (153–282) ‘substrate binding domain’ which is 100% identical between mouse and man (18,19). Only the complete substrate-binding domain (amino acids 153–282), and none of the other regions (including two partial substrate binding domains 153–220 or 178–282) of SIAH1 specifically interacted with T-STAR (Fig. 2A).



View larger version (16K):
[in this window]
[in a new window]
 
Figure 2. SIAH1 interacts with human T-STAR. The two hybrid constructs used in this study are shown schematically in (A) and (B). The strength of the protein : protein interaction in a LacZ filter-lift assay with SIAH1 is depicted on the right. Turns blue in less than 5 min ++++; strong +++; medium ++; weak +; barely detectable +/–, no interaction–. (A) T-STAR interacts with the ‘substrate binding domain’ of SIAH1. Protein interaction strengths were tested between full length T-STAR and subregions of SIAH1. (B) SIAH1 interacts with the RG-rich domains of T-STAR. T-STAR paralogues and different regions and mutants of T-STAR were tested for interaction with the substrate-binding domain of SIAH1. (C) Detection of protein interactions by in vitro pull down. Glutathione agarose beads were charged with a GST fusion of the RG-rich region of T-STAR or GST alone and then in vitro translation products of SIAH1 or luciferase were added. After binding beads were washed and boiled and samples were separated by SDS–PAGE prior to autoradiography.

 
To identify the region of T-STAR that is recognized by SIAH1, three separate domains of T-STAR were tested for their ability to bind SIAH1 (Fig. 2B). Only the 79-amino acid RG-rich region (176–254) bound SIAH1 in yeast. Since SIAH1 interaction leads to proteasomal destruction of its interacting partners (see below) we reasoned that it would not form a stable complex in mammalian cells. For this reason, and to confirm this was a molecular interaction that did not require any bridging yeast proteins, we expressed the T-STAR RG-rich region as a fusion protein with GST in Escherichia coli, and used this to specifically pull down in vitro translated SIAH1. Under identical conditions, no binding of SIAH1 was detected to GST alone, and the RG-rich region of T-STAR did not interact with the non-specific protein luciferase (Fig. 2C). Next we systematically mapped the precise SIAH1-binding site in T-STAR by stepwise reduction of T-STAR in the yeast two hybrid assay, and identified the residues RPVGVVVP (amino acids 212–219) as a single high-affinity binding site. Further reduction of this sequence by one amino acid at either the N- or C-terminus caused complete loss of protein binding assayed in the yeast two-hybrid system (Fig. 2B). The interaction with this T-STAR octapeptide was extremely strong (colonies turning blue in less than 5 minutes). To our knowledge, this is the shortest peptide known to bind strongly in the yeast two-hybrid system. When these eight residues were removed from the full-length T-STAR sequence (construct T-STAR{Delta}8) binding was greatly reduced, but it was not completely abolished, implying that a further weak SIAH1-binding site exists in T-STAR. A larger deletion, T-STAR{Delta}40, that removed the high-affinity sequence (amino acids 212–219) and 32 adjacent amino acids (220–251) totally prevented SIAH1-binding (Fig. 2B). To investigate the specificity of this interaction, the T-STAR paralogues SAM68 and SLM1 were also tested, as was mouse T-STAR. Surprisingly none of these other proteins bound the substrate-binding domain of SIAH1, which is 100% conserved between mouse and humans (Fig. 2B).

T-STAR is targeted for degradation by its interaction with SIAH1
Although SIAH1 is an E3 ubiquitin ligase that binds and targets substrates for degradation it also binds other molecules without causing their degradation [e.g. inhibitors (20) and adaptors (2123)]. To determine if the interaction with SIAH1 has direct consequences for T-STAR protein stability in vivo we cloned both it, its deletion derivatives ({Delta}8 and {Delta}40) and SAM68 to create C-terminal fusion proteins with GFP, and co-transfected them into 293T cells with an expression vector internal standard expressing GFP alone to show the relative degradation of the GFP-fusion protein. Analysis of these extracts by western blotting and probing with antisera to GFP showed that GFP-T-STAR was completely degraded and T-STAR{Delta}8 was also mostly degraded after 24 h. Consistent with their inability to bind SIAH1, T-STAR{Delta}40 and SAM68 were not degraded in the presence of SIAH1. GFP itself was also stable in this assay (Fig. 3A).



View larger version (46K):
[in this window]
[in a new window]
 
Figure 3. Functional interaction of SIAH1 and T-STAR. (A) and (C) top panels: SIAH1-mediated degradation of T-STAR in a human cell line. Co-transfection experiment showing the effect of presence or absence (+/–) of SIAH1 on the various GFP fusions indicated (upper bands) which were co-transfected with a GFP internal standard (lower bands). Cells were harvested one day after transfection and analysed by western blotting using an anti-GFP antibody. (B) (see also Supplementary Material) SIAH1 targets T-STAR for degradation in mouse oocytes. SAM68 and T-STAR constructs were transcribed in vitro and capped cRNAs were injected into mouse oocytes and allowed to express for 3–4 h. SIAH1 cRNA was then microinjected and normalized GFP fluorescence relative to starting value levels (F/F0) in the subsequent 6 h are presented (mean±standard deviation). (C) bottom panel: SIAH1 modulates T-STAR dependent alternative splicing. The samples from the top panel were subjected to competitive RT–PCR to show the relative inclusion of the CD44V5 exon from a co-transfected minigene. Upper band (208 bp) shows inclusion relative to lower band (91 bp) exclusion. (D) A double amino acid substitution brings mouse T-STAR under in vivo control of SIAH1. Top panel: representative gel of co-transfection assay to monitor protein stability of human and mouse T-STAR and the m2h mutation. The absence – or presence + of SIAH1 is indicated. Bottom panel: percentage of incorporation of exon V5 in the above transfections. Relative incorporation was calculated from RT–PCR products by densitometry compensated for product length. Quantification of splicing samples was performed in quadruplate for each combination of plasmids. Upper (a) band readings and lower (b) densitometric band readings X208 bp/91 bp (i.e. X2.29) were calculated as a percentage of the total [i.e. (a) or (b)/(a+b)x100%] and presented as mean±1 SD.

 
As the deletion of the high affinity 8-residue motif from T-STAR only marginally affected protein stability we reasoned that either its effects might be masked after 24 h, or that it might be relatively unimportant for T-STAR protein stability. To differentiate between these two possibilities we followed the degradation of various T-STAR constructs in real-time over several hours in mouse oocytes. Oocytes were microinjected with cRNAs corresponding to GFP-SAM68, GFP-T-STAR and both of the deletion constructs. The effects of SIAH1 on the stabilities of the GFP fusion protein expressed in oocytes were then determined by monitoring GFP fluorescence levels after the microinjection of unlabelled SIAH1 cRNA (Fig. 3B and Supplementary Material Fig. A1). GFP-T-STAR and GFP-SAM68 were stable in mouse oocytes over the time course of these experiments since no loss of GFP signal was observed following addition of cycloheximide to block protein synthesis (Fig. 3B and Supplementary Material Fig. A1). Similar to the western data in 293T cells we found that in mouse oocytes GFP-T-STAR was rapidly degraded in the presence of SIAH1 with a half-life of about 1 h. However, in comparison GFP-T-STAR{Delta}8 was much more slowly degraded with a half-life of ~6 h. This suggests that the high affinity octapeptide sequence is required for efficient protein degradation. GFP-T-STAR{Delta}40 was completely stable in the presence of SIAH1 over a 6 h period, consistent with all the determinants for SIAH1 recognition being within the 40mer identified by the yeast two-hybrid assay. We next used this in vivo system to test if this degradation was proteasome dependent by adding in the proteasome inhibitor MG132 (20 µM). Consistent with a proteasome dependent mechanism, this stopped SIAH1 mediated degradation of T-STAR (Fig. 3B).

The protein interaction data suggested that SIAH mediated proteasomal degradation might be specific for human T-STAR. To test this, GFP fusions of the T-STAR paralogues SLM1, SAM68, and the mouse and rat T-STAR orthologues were co-transfected into 293T cells with or without SIAH1. We also tested the splicing factor PUF60 (24,25) which was previously reported to be a SIAH1 binding protein (GenBank accession no. U51586). Of the proteins tested, only human T-STAR was significantly degraded in the presence of SIAH1 (Fig. 3C, upper panel).

Since rat T-STAR has been reported to be an alternative-splicing factor which can control the splicing of the CD44V5 exon minigene, we reasoned that human T-STAR might have similar activity and that SIAH1 co-expression might switch splice site usage (6). To test this we investigated human T-STAR-dependent inclusion of the CD44V5 exon in the absence and presence of SIAH1. All the SAM68 family homologues enhanced inclusion of the V5 exon compared to GFP alone or the PUF60 splicing factor, which had no effect on this substrate. Human T-STAR caused inclusion of the V5 exon but SIAH1 reversed this towards the ratio found in the SIAH1+GFP-alone transfection (Fig. 3C, lower panel, lanes 1 and 2 compared to lane 14). SIAH1 consistently reduced stimulation of the V5 exon by human GFP-T-STAR but no reduction in V5 incorporation was observed due to the co-expression of SIAH1 with any other GFP fusions (compare adjacent lanes delineated by dotted lines in Fig. 3C lower panel). This indicates that the human T-STAR alternative splicing function is compromised in vivo by SIAH1 mediated degradation.

A double amino acid substitution in mouse T-STAR renders it susceptible to SIAH1-mediated degradation
To further define the SIAH1-binding site in T-STAR we created two double amino acid substitutions. First, we altered the SIAH1 binding octapeptide RPVGVVVP to IDVGVVVP but surprisingly this retained full SIAH1-binding capability (Fig. 2B) implying that the six amino acids VGVVVP contain the crucial determinants of SIAH mediated degradation, but that eight amino acids are the minimum length that will interact in the yeast two-hybrid system. To prove this, we took the mouse T-STAR sequence and mutated the sequence VAVGVP by a double amino acid substitution into the corresponding human sequence VGVVVP and this conferred strong SIAH1-binding on mouse T-STAR (the m2h mutant, Fig. 2B). The mouse T-STAR (m2h) mutant was also efficiently degraded in the co-transfection assay (Fig. 3D). The m2h mutant was also assayed in the splicing assay. In the presence of GFP alone, exon V5 inclusion was consistently found at about 30% and co-transfection of T-STAR increased inclusion to 40%. Co-transfection of T-STAR and SIAH1 caused a significant reduction in V5 inclusion back to near the 30% level. Mouse T-STAR and the m2h mutant both enhanced V5 inclusion but co-transfection with SIAH1 had opposite effects. In the presence of mouse T-STAR SIAH1 increased V5 inclusion but for mouse T-STAR with a SIAH1-binding site (m2h), exon inclusion was reduced (Fig. 3D, upper and lower panels, respectively).

The T-STAR SIAH1-binding site evolved in the primate lineage
Our data suggested that although human T-STAR was efficiently bound by SIAH1 resulting in proteasomal degradation, mouse T-STAR was neither bound nor degraded. To investigate the nature and timing of the evolution of the SIAH1-binding site, we sequenced the corresponding region of T-STAR in eight primates: chimpanzee, gorilla, black gibbon (apes), macaque, baboon (old world monkeys), spider monkey, white-faced saki (new world monkeys) and slow loris (prosimian). Each of these species had the same sequence as humans (VGVVVP) except the slow loris, which had a single amino acid difference from the human (VGVGVP) similar to the mouse sequence (VAVGVP) (Fig. 4).



View larger version (30K):
[in this window]
[in a new window]
 
Figure 4. The T-STAR SIAH1-binding region in mammals. The amino acid sequence at the position of the human T-STAR SIAH1-binding region from various mammals are aligned with the minimal six residues defined in our experiments in bold. Differences from the human sequence are highlighted by shading. Approximate evolutionary distance in millions of years from humans is indicated.

 
SIAH1 and T-STAR expression patterns in testis are consistent with targeted degradation
In mouse, SIAH proteins are essential for embryogenesis and probably also in many adult tissues. However, because of redundancy between the Siah1a gene and a nearly identical (rodent specific) copy Siah1b on the X-chromosome, which is shut down during meiosis, mice carrying a targeted deletion of the Siah1a gene survive to adulthood with the only gross defect being an arrest in male meiosis. The implication of this is that SIAH1 is expressed in meiosis, but the cellular expression pattern of SIAH1 in germ cells has not been identified (26,27). As the SIAH1 antibodies available to us did not work by immunohistochemistry we performed western blots with SIAH1 antibody on extracts from testis of prepubescent mice going through the first wave of spermatogenesis. Consistent with meiotic expression, SIAH1 expression peaked at 16 days post partum when meiotic cells are predominant (Fig. 5A, top panel). In support of this, western blotting of extracts from different germ cell fractions showed SIAH1 was strongly expressed in spermatocytes but not spermatids (Fig. 5B, top panel).



View larger version (90K):
[in this window]
[in a new window]
 
Figure 5. T-STAR and SIAH1 expression studies. (A–C) Protein extracts from various mouse samples were electrophoresed, western blotted and probed using anti-human T-STAR, anti-SIAH1 or anti-beta actin control antibody. (A) Western blots showing T-STAR and SIAH1 expression in whole testes from mice at the ages (number of days post partum dpp) indicated. (B) Western blots showing T-STAR and SIAH1 expression in the purified mouse germ cell populations indicated. (C) Western blot showing the tissue distribution of T-STAR protein (top panel) and ß-actin (bottom panel) in various mouse tissues. T-STAR expression is shown by a band migrating at 55 kDa in the testis and brain. (DF) Immunohistochemistry of mouse seminiferous tubule with anti human T-STAR antibody (D) Hoechst (DNA) staining (E) and merged image (F). (G and H) Human seminiferous tubule staining with anti-T-STAR (G), with anti-splicing factor SC35 as a positive control (H). Note in (G) two spermatocytes are annotated with arrowheads, one with very weak staining and the other with no visible staining. Spg: spermatogonia; Spc: spermatocyte; rtd: round spermatid; spd: elongating spermatid; spz: spermatozoon.

 
T-STAR transcripts are predominantly found in testis, brain and muscle in humans but are more widespread in rodents (5,10,11,28). To investigate the expression of T-STAR protein in mouse we analysed seven mouse tissues by western blotting with an antibody raised against human T-STAR (Fig. 5C). Due to their high proline content and possibly also due to post-translational modifications (29), T-STAR and SAM68 (which appears to be 68 kDa) always run much slower than their predicted molecular weights which are just 39 kDa and 48 kDa, respectively. Anti-T-STAR antibody recognized a protein migrating at about 55 kDa in testis with weak expression in brain and negligible expression in kidney and no expression in three other mouse tissues (Fig. 5C). This suggests that at the tissue level expression of T-STAR protein is the same in mouse and human.

To compare the cell-specific pattern of expression of mouse and human T-STAR in testis, we used two complementary approaches: western blotting and immunohistochemistry. Western blotting of staged mouse testes showed T-STAR expression started in 16-day-old mice and was maintained at a similar level in adults, indicating that mouse T-STAR expression starts during meiosis when pachytene cells are beginning to appear and then persists into post-meiotic cells (Fig. 5A, lower panel). This was confirmed by western blotting of purified staged mouse germ cells where mouse T-STAR was strongly expressed in both the spermatocyte and spermatid fractions (Fig. 5B, lower panel).

Further investigation of T-STAR expression by immunohistochemistry identified T-STAR expression in spermatocytes and spermatids (Fig. 5D and F). However in humans the expression pattern was strikingly different. Expression of T-STAR was low during meiosis (i.e. in spermatocytes) and T-STAR was only strongly expressed in post-meiotic cells (Fig. 5G). Spermatocytes in this study were competent to be stained as shown by a positive control staining with anti-splicing factor SC35 (Fig. 5H).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
The data described in this paper show that human T-STAR is a substrate for SIAH1 binding and directed proteasomal degradation. Destabilization of T-STAR is likely to have significant impact on its function in vivo. Consistent with this we found that all the SAM68 family proteins have alternative splicing activity (including SLM1 which had not previously been assigned a function) but that human T-STAR activity is unique among these in being sensitive to SIAH1 (Fig. 3C). SIAH proteins are important developmental regulators that are involved in apoptosis and cell cycle control (26,30,31) and have been shown to regulate diverse processes by targeting important developmental molecules for proteolysis, however T-STAR is the first identified splicing factor to be regulated by SIAH1 (Table 1).


View this table:
[in this window]
[in a new window]
 
Table 1. Known mammalian proteins that are destabilized by binding SIAH1 or SIAH2
 
Within T-STAR we identified an octapeptide RPVGVVVP that has a high affinity for SIAH1 in the yeast two-hybrid system and this is the shortest peptide that has been shown to bind to SIAH1 (Fig. 2B). While this work was in progress a 22-residue SIAH1-binding peptide containing a similar motif RPVAMVMP was discovered in the Drosophila-specific protein Phyllopod and a search for Phyllopod-like sequences in known mammalian SIAH1-binding proteins revealed that most known SIAH-binding regions contained a VXP motif (32). The mouse T-STAR sequence (RPVAVGVP) differs from the SIAH1-binding region (RPVGVVVP) in human T-STAR at the two underlined positions. It is therefore consistent with the ability of human but not mouse T-STAR to bind SIAH1 that the human SIAH1-binding region (RPVGVVVP) has a VXP motif but the corresponding position of the mouse (RPVAVGVP) does not. We also found evidence that the determinants of SIAH1-binding were less than these eight amino acids as in the context of the full length T-STAR protein (in the RP to ID mutant in Fig. 2B) the initial RP dipeptide was dispensable, defining a shorter hexapeptide minimal SIAH1-binding region (VGVVVP). By sequencing this region in various primates we found an identical hexapeptide to human in all new world monkeys, old world monkeys and apes (Fig. 4). The slow loris has the intermediate sequence (VGVGVP) differing at only one position from the mouse (VAVGVP). While we cannot unambiguously stage the A to G change, the most parsimonious explanation is that the ability of SIAH1 to bind and be degraded by SIAH1 evolved by a G to V change at the conserved VXP position before the split leading to new world monkeys (40 MY ago).

Our data indicate that a high affinity motif is sufficient but not necessary for SIAH1-binding or subsequent destruction of T-STAR, but it is essential for efficient binding and destruction (Figs 2B, 3A and B and especially visible in Supplementary Material movie). We have employed a novel real-time assay in mouse oocytes that has not previously been used to quantify rates of SIAH-mediated destruction. Using this assay we showed that T-STAR is the most potently degraded substrate of SIAH1 discovered so far. This degradation is much more dramatic than those of the previously reported SIAH1 and SIAH2-substrates, synaptophysin or TRAF2 (33,34). In the absence of the octapeptide RPVGVVVP (i.e. in T-STAR{Delta}8) the half-life of T-STAR in the presence of SIAH1 was 6 h, which is the same as the natural half-life of synaptophysin in the absence of SIAH1.

It is clear that recognition is not sufficient to determine whether a SIAH1-binding molecule is a good substrate for SIAH1-mediated degradation, as PUF60, which binds to SIAH1 in the yeast two-hybrid assay was not degraded in our assay (Fig. 3C). PUF60 may belong to the class of SIAH-binding proteins that act as cofactors, such as Drosophila phyllopod which binds to the original SIAH1-like protein SINA and acts as an adaptor protein to cause its associated protein tramtrack to be degraded rather than itself (23). Similar to this, SIAH1 is known to cause indirect degradation of ß-catenin through an adapter protein (21,22). Despite the importance of the high affinity site for efficient degradation, we found that GFP fused directly to RPVGVVVP could not be degraded in the presence of SIAH1 in either of our assays (data not shown). It is notable that the A and B type cyclins, which are needed at different times during spermatogenesis (35,36), have short destruction boxes that are only functional in some contexts (37). Data from the mouse T-STAR double point mutant m2h (Figs 2B and 3D) indicate that mouse and human T-STAR share the determinants of competence to be degraded by SIAH1 that lie outside of the human SIAH1-binding region.

Ubiquitin and proteasome mediated degradation are known to be important for spermatogenesis (38). Two of the candidate genes involved in these processes are present on the Y-chromosome—UBE1Y encoding an E1 ubiquitin activating enzyme (39) and DFFRY (USP9Y) encoding a deubiquitinating enzyme; the latter has been found to be deleted in three infertile men (40). We have shown that in male germ cells the E3 ubiquitin ligase SIAH1 is expressed mainly in meiosis (Fig. 5A and B), consistent with the phenotype of the knockout mouse (27). We show here that human T-STAR protein is mainly present post-meiosis, consistent with a delay being caused by the presence of SIAH1 in meiosis, while in mouse T-STAR is predominantly expressed during meiosis, consistent with an inability of SIAH1 to degrade it. T-STAR is the first likely target of SIAH ubiquitin ligases in human spermatogenesis.

Our data suggest that despite being 95.9% identical and 99.4% similar, because of their different expression in meiosis, human and mouse T-STAR are likely to regulate distinct species-specific gene expression pathways. Such distinct patterns of protein regulation may be evolutionarily important, particularly given that T-STAR is expressed in the developing brain and the testes. As the brain is the only other significant site of T-STAR expression it is possible that SIAH1-mediated degradation could be responsible for some of the complexity of alternative splicing there (41) and could possibly have been an enabling factor in the evolution of the human brain's complexity. The genetic control of both sex-specific pathways and alternative splicing have also evolved quickly in mammalian species (42,43). It will therefore be illuminating to uncover alternative splices that are regulated by SIAH1 and T-STAR.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Cloning
The regions of open reading frame encoding the amino acids referred to in the text were cloned by PCR into the EcoR1 and Xho1/Sal1 sites of the following plasmids: yeast two-hybrid vectors pGBKT7 and pGADT7 (Clontech, Palo Alto, CA), GST-fusion expression plasmid pGEX 5X-1 (Amersham, Piscataway, NJ) and pGFP3 which is a eukaryotic expression vector encoding a fusion protein with an upstream EGFP which was constructed by cloning EGFP between the BamH1 and EcoR1 sites of pCDNA3.1+ (Invitrogen, Carlsbad, CA).

T-STAR{Delta}8 and T-STAR{Delta}40 were constructed by PCR in two halves such that the two halves overlapped and primed on each other. Oligo 5'GGCTGTAACTCCTCCCCTTC3' was used with 5'GAAGGGGAGGAGTTACAGCCCGAGGGACGCCAACTCCCA3' for {Delta}8 and 5'GAAGGGGAGGAGTTACAGCCACTGGGTACAGACCTCCACCGCCA3' for {Delta}40. The T-STAR RP to ID mutation used 5'GTTGGAGTTGTAGTACCACGAGGGA3' and 5'AAGGGGAGGAGTTACAGCCATCGATGTTGGAGTTGTAGTACCACGAGGGA3'. The mouse T-STAR m2h mutation was cloned by the same strategy with the oligos 5'AGTCACAGCCAGGCCTGTTGGAGTTGTAGTACCACGTGGGACACCGA3' and 5'AACAGGCCTGGCTGTGACT3'.

Constructs were checked by sequencing and where appropriate were also translated in vitro to check the integrity of the reading frames.

Two-hybrid screen
T-STAR in pAS2.1 was used to screen a ‘Matchmaker’ human testis two-hybrid cDNA library (Clontech catalogue no. HL4035AH) as previously described (5). 140 000 colonies were screened. Large colonies were patched on full selection and the standard filter lift assay was performed. Blue strains were grown on again on+tryptophan plates to select for the library plasmids. Crude yeast plasmid preps were then transformed into electro-competent E. coli DH5{alpha}. Clones were sequenced and transformed back into Y190 with either the bait or pGBKT7 vector to test for true positives.

In vitro pull downs
Siah1 (from Siah1 in pGBKT7) and the luciferase control protein were transcribed and translated in TNT-quick T7 reticulocyte lysate (Promega) with 35S methionine. Pull downs were performed as (5) except binding (and washing) was in PBS+1 mM DTT for 1 h at 4°C.

Protein degradation assay in cell culture and alternative splicing assay
293T cells were grown at 37°C in 5% CO2 in Dulbecco's MEM with glutamax-1, 10% foetal bovine serum and 1% penicillin-streptomycin (Invitrogen) to 60% confluence and transfected using 5 µl Genejammer reagent by the 6x35 mm well plate protocol (Stratagene) with or without 500 ng SIAH1-HApCDNA, 500 ng of various clones in pGFP3 to be tested, 100 ng pGFP3 as a loading control and 100 ng CD44V5 minigene for the splicing analysis. After 24 h cells were detached with trypsin, washed in PBS and half was resuspended in Laemmli loading buffer and half in Tri-reagent (Sigma). Samples in loading buffer were then sonicated, boiled, cleared by centrifugation, electrophoresed on a 10% acrylamide gel, blotted onto an Immobilon-P membrane (Millipore), probed with anti-GFP ‘living colours’ antibody (Clontech) (1 in 1000) and sheep anti-mouse secondary (Amersham) (1 in 5000) and visualized by ECL.

For the splicing assay, RNA was extracted from the Tri-reagent samples and resuspended in 50 µl of dH2O. One microlitre of this was then used in a ‘superscript one-step RT–PCR’ reaction (Invitrogen) with the following primers InsF 5'CCTGGTGTGTGGGGAGCGT3' and InsB 5'CCACCCAGCTCCAGTTGTGCCA3' in the following program: 50°C 30 min, 94°C 2 min, (94°C 15 s, 59°C 30 s, 72°C 45 s)x35 cycles, 72°C 10 min. Samples were visualized on a 1.5% agarose gel and quantified by densitometry.

Protein degradation assay in mouse oocytes
Transcription templates were prepared to terminate transcription about 200 nucleotides downstream of the open reading frame by digesting SAM68pGFP3 with SphI, T-STARpGFP3 constructs with PvuII and SIAH1pGBKT7 with HindIII. RNA was transcribed using the ‘mMessage mMachine’ T7 kit (Ambion, Austin, TX) and purified by phenol : chloroform extraction and isopropanol precipitation as recommended, then resuspended in water (1 mg/ml) with 1 U/µl ‘SUPERas-In’ RNAse inhibitor (Ambion). GFP-SAM68 or GFP-T-STAR mRNAs were pressure-microinjected into germinal vesicle (GV) stage mouse oocytes using a negative capacitance facility on an electrometer to aid cell penetration, as described previously (44,45). After 3–4 h, SIAH1 cRNA was microinjected into GFP-expressing oocytes that had undergone GV breakdown, a process that occurs spontaneously in mammalian oocytes released from their follicular environment (46). Imaging was performed using a Nikon inverted microscope fitted for epi-fluorescence as detailed previously (45,47). Image-capture and analysis was performed using MetaMorph software (Universal Imaging Corp., PA). All experiments were repeated at least once, with between six and 12 oocytes per replicate.

Tissue western blotting and testis immunohistochemistry
Mouse tissues for western blotting were dissected and homogenized in 2xSDS loading buffer containing 4 M urea, electrophoresed on a 4–12% NuPAGE bis-tris gradient gel (Invitrogen) and blotted onto an Immobilon-P membrane (Millipore). Western filters were probed with rabbit antiserum generated against T-STAR residues 180–248 (5) affinity-purified and detected as described (63). Goat anti SIAH1 (N-15): sc-5505 was purchased from Santa Cruz. Mouse testes immunological studies (Fig. 5B–F) were performed as described (48). Human testes sections (Fig. 5G and H) were stained with anti-T-STAR and visualized (49).

Evolutionary study of SIAH binding sites
The following primers were used to amplify the SIAH1-binding region from genomic DNA. 5'CCTCTTGCTCTGGGAGTGAGAA3' and the degenerate primer 5'G(G/C)T(C/T)ACAGGGGAAGAGGAGGAGT3'. PCR products were cloned and sequenced and sequences were deposited in GenBank (accession numbers AV601555–62).


    SUPPLEMENTARY MATERIAL
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Supplementary Material is available at HMG Online.


    ACKNOWLEDGEMENTS
 
Thanks to Steve Laval for help with designing and constructing pGFP3 and Faye Chapman for help with cycloheximide studies. Thanks also to Arantza Esnall for performing immunohistochemistry on human testis sections. Thanks to Ralph Tiedt and Patrick Matthias for the SIAH-HApCDNA and to Stefan Stamm for the CD44V5 minigene and GFP-rat T-STAR(rSLM2) plasmids. Thanks to Mike Jackson for primate DNA and thanks also to Mike Jackson, Susan Lindsay, Rachel Davies, Colin Gordon, Nicola Gray and David Morgan for comments on the manuscript. Imaging equipment was funded by the Wellcome Trust to K.T.J. L.S. was supported by a Nuffield Foundation vacation scholarship and J.K.T. by a Luccock studentship from the University of Newcastle upon Tyne. This work was funded by a project grant from the Wellcome Trust to D.J.E.


    FOOTNOTES
 
* To whom correspondence should be addressed. Tel: +44 1912418694; Fax: +44 1912418666; Email: david.elliott{at}ncl.ac.uk


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 

  1. Gooding, C., Kemp, P. and Smith, C.W. (2003) A novel polypyrimidine tract-binding protein paralog expressed in smooth muscle cells. J. Biol. Chem., 278, 15201–15207.[Abstract/Free Full Text]

  2. Maniatis, T. and Tasic, B. (2002) Alternative pre-mRNA splicing and proteome expansion in metazoans. Nature, 418, 236–243.[CrossRef][Medline]

  3. Stamm, S. (2002) Signals and their transduction pathways regulating alternative splicing: a new dimension of the human genome. Hum. Mol. Genet., 11, 2409–2416.[Abstract/Free Full Text]

  4. Venables, J.P. (2002) Alternative splicing in the testes. Curr. Opin. Genet. Dev., 12, 615–619.[CrossRef][Web of Science][Medline]

  5. Venables, J.P., Vernet, C., Chew, S.L., Elliott, D.J., Cowmeadow, R.B., Wu, J., Cooke, H.J., Artzt, K. and Eperon, I.C. (1999) T-STAR/ETOILE: a novel relative of SAM68 that interacts with an RNA-binding protein implicated in spermatogenesis. Hum. Mol. Genet., 8, 959–969.[Abstract/Free Full Text]

  6. Stoss, O., Olbrich, M., Hartmann, A.M., Konig, H., Memmott, J., Andreadis, A. and Stamm, S. (2001) The STAR/GSG family protein rSLM-2 regulates the selection of alternative splice sites. J. Biol. Chem., 276, 8665–8673.[Abstract/Free Full Text]

  7. Lukong, K.E. and Richard, S. (2003) Sam68, the KH domain-containing superSTAR. Biochim. Biophys. Acta, 1653, 73–86.[Medline]

  8. Vernet, C. and Artzt, K. (1997) STAR, a gene family involved in signal transduction and activation of RNA. Trends Genet., 13, 479–484.[CrossRef][Web of Science][Medline]

  9. Kool, J., van Zaane, W., van der Eb, A.J. and Terleth, C. (2001) Down-regulation of T-STAR, a growth inhibitory protein, after SV40-mediated immortalization. Cell Growth Differ., 12, 535–541.[Abstract/Free Full Text]

  10. Lee, J. and Burr, J.G. (1999) Salpalpha and Salpbeta, growth-arresting homologs of Sam68. Gene, 240, 133–147.[CrossRef][Web of Science][Medline]

  11. Di Fruscio, M., Chen, T. and Richard, S. (1999) Characterization of Sam68-like mammalian proteins SLM-1 and SLM-2: SLM-1 is a Src substrate during mitosis. Proc. Natl Acad. Sci. USA, 96, 2710–2715.[Abstract/Free Full Text]

  12. Lin, Q., Taylor, S.J. and Shalloway, D. (1997) Specificity and determinants of Sam68 RNA binding. Implications for the biological function of K homology domains. J. Biol. Chem., 272, 27274–27280.[Abstract/Free Full Text]

  13. Itoh, M., Haga, I., Li, Q.H. and Fujisawa, J. (2002) Identification of cellular mRNA targets for RNA-binding protein Sam68. Nucl. Acids Res., 30, 5452–5464.[Abstract/Free Full Text]

  14. Matter, N., Herrlich, P. and Konig, H. (2002) Signal-dependent regulation of splicing via phosphorylation of Sam68. Nature, 420, 691–695.[CrossRef][Medline]

  15. Wang, L., Xu, J., Zeng, L., Ye, X., Wu, Q., Dai, J., Ji, C., Gu, S., Zhao, C., Xie, Y. et al. (2002) Cloning and characterization of a novel human STAR domain containing cDNA KHDRBS2. Mol. Biol. Rep., 29, 369–375.[CrossRef][Web of Science][Medline]

  16. Taylor, S.J., Resnick, R.J. and Shalloway, D. (2004) Sam68 exerts separable effects on cell cycle progression and apoptosis. BMC Cell Biol., 5, 5.[CrossRef][Medline]

  17. Di Fruscio, M., Styhler, S., Wikholm, E., Boulanger, M.C., Lasko, P. and Richard, S. (2003) Kep1 interacts genetically with dredd/caspase-8, and kep1 mutants alter the balance of dredd isoforms. Proc. Natl Acad. Sci. USA, 100, 1814–1819.[Abstract/Free Full Text]

  18. Hu, G. and Fearon, E.R. (1999) Siah-1 N-terminal RING domain is required for proteolysis function, and C-terminal sequences regulate oligomerization and binding to target proteins. Mol. Cell. Biol., 19, 724–732.[Abstract/Free Full Text]

  19. Polekhina, G., House, C.M., Traficante, N., Mackay, J.P., Relaix, F., Sassoon, D.A., Parker, M.W. and Bowtell, D.D. (2002) Siah ubiquitin ligase is structurally related to TRAF and modulates TNF-alpha signaling. Nat. Struct. Biol., 9, 68–75.[CrossRef][Web of Science][Medline]

  20. Park, T.J., Hamanaka, H., Ohshima, T., Watanabe, N., Mikoshiba, K. and Nukina, N. (2003) Inhibition of ubiquitin ligase Siah-1A by disabled-1. Biochem. Biophys. Res. Commun., 302, 671–678.[CrossRef][Web of Science][Medline]

  21. Matsuzawa, S.I. and Reed, J.C. (2001) Siah-1, SIP, and Ebi collaborate in a novel pathway for beta-catenin degradation linked to p53 responses. Mol. Cell, 7, 915–926.[CrossRef][Web of Science][Medline]

  22. Liu, J., Stevens, J., Rote, C.A., Yost, H.J., Hu, Y., Neufeld, K.L., White, R.L. and Matsunami, N. (2001) Siah-1 mediates a novel beta-catenin degradation pathway linking p53 to the adenomatous polyposis coli protein. Mol. Cell., 7, 927–936.[CrossRef][Web of Science][Medline]

  23. Li, S., Xu, C. and Carthew, R.W. (2002) Phyllopod acts as an adaptor protein to link the sina ubiquitin ligase to the substrate protein tramtrack. Mol. Cell. Biol., 22, 6854–6865.[Abstract/Free Full Text]

  24. Page-McCaw, P.S., Amonlirdviman, K. and Sharp, P.A. (1999) PUF60: a novel U2AF65-related splicing activity. RNA, 5, 1548–1560.[Abstract]

  25. Poleev, A., Hartmann, A. and Stamm, S. (2000) A trans-acting factor, isolated by the three-hybrid system, that influences alternative splicing of the amyloid precursor protein minigene. Eur. J. Biochem., 267, 4002–4010.[Web of Science][Medline]

  26. Frew, I.J., Dickins, R.A., Cuddihy, A.R., Del Rosario, M., Reinhard, C., O'Connell, M.J. and Bowtell, D.D. (2002) Normal p53 function in primary cells deficient for Siah genes. Mol. Cell. Biol., 22, 8155–8164.[Abstract/Free Full Text]

  27. Dickins, R.A., Frew, I.J., House, C.M., O'Bryan, M.K., Holloway, A.J., Haviv, I., Traficante, N., de Kretser, D.M. and Bowtell, D.D. (2002) The ubiquitin ligase component Siah1a is required for completion of meiosis I in male mice. Mol. Cell. Biol., 22, 2294–2303.[Abstract/Free Full Text]

  28. Sugimoto, Y., Morita, R., Amano, K., Shah, P.U., Pascual-Castroviejo, I., Khan, S., Delgado-Escueta, A.V. and Yamakawa, K. (2001) T-STAR gene: fine mapping in the candidate region for childhood absence epilepsy on 8q24 and mutational analysis in patients. Epilepsy Res., 46, 139–144.[CrossRef][Web of Science][Medline]

  29. Cote, J., Boisvert, F.M., Boulanger, M.C., Bedford, M.T. and Richard, S. (2003) Sam68 RNA binding protein is an in vivo substrate for protein arginine N-methyltransferase 1. Mol. Biol. Cell, 14, 274–287.[Abstract/Free Full Text]

  30. Matsuo, K., Satoh, S., Okabe, H., Nomura, A., Maeda, T., Yamaoka, Y. and Ikai, I. (2003) SIAH1 inactivation correlates with tumor progression in hepatocellular carcinomas. Genes Chrom. Cancer, 36, 283–291.[CrossRef][Web of Science][Medline]

  31. Tuynder, M., Susini, L., Prieur, S., Besse, S., Fiucci, G., Amson, R. and Telerman, A. (2002) Biological models and genes of tumor reversion: Cellular reprogramming through tpt1/TCTP and SIAH-1. Proc. Natl Acad. Sci. USA, 99, 14976–14981.[Abstract/Free Full Text]

  32. House, C.M., Frew, I.J., Huang, H., Wiche, G., Traficante, N., Nice, E., Catimel, B. and Bowtell, D.D. (2003) A binding motif for Siah ubiquitin ligase. Proc. Natl Acad. Sci. USA, 100, 3101–3106.[Abstract/Free Full Text]

  33. Habelhah, H., Frew, I.J., Laine, A., Janes, P.W., Relaix, F., Sassoon, D., Bowtell, D.D. and Ronai, Z. (2002) Stress-induced decrease in TRAF2 stability is mediated by Siah2. EMBO J., 21, 5756–5765.[CrossRef][Web of Science][Medline]

  34. Wheeler, T.C., Chin, L.S., Li, Y., Roudabush, F.L. and Li, L. (2002) Regulation of synaptophysin degradation by mammalian homologues of seven in absentia. J. Biol. Chem., 277, 10273–10282.[Abstract/Free Full Text]

  35. Nguyen, T.B., Manova, K., Capodieci, P., Lindon, C., Bottega, S., Wang, X.Y., Refik-Rogers, J., Pines, J., Wolgemuth, D.J. and Koff, A. (2002) Characterization and expression of mammalian cyclin b3, a prepachytene meiotic cyclin. J. Biol. Chem., 277, 41960–41969.[Abstract/Free Full Text]

  36. Liu, D., Liao, C. and Wolgemuth, D.J. (2000) A role for cyclin A1 in the activation of MPF and G2-M transition during meiosis of male germ cells in mice. Dev. Biol., 224, 388–400.[CrossRef][Web of Science][Medline]

  37. Zur, A. and Brandeis, M. (2002) Timing of APC/C substrate degradation is determined by fzy/fzr specificity of destruction boxes. EMBO J., 21, 4500–4510.[CrossRef][Web of Science][Medline]

  38. Baarends, W.M., van der Laan, R. and Grootegoed, J.A. (2000) Specific aspects of the ubiquitin system in spermatogenesis. J. Endocrinol. Invest., 23, 597–604.[Web of Science][Medline]

  39. Odorisio, T., Mahadevaiah, S.K., McCarrey, J.R. and Burgoyne, P.S. (1996) Transcriptional analysis of the candidate spermatogenesis gene Ube1y and of the closely related Ube1x shows that they are coexpressed in spermatogonia and spermatids but are repressed in pachytene spermatocytes. Dev. Biol., 180, 336–343.[CrossRef][Web of Science][Medline]

  40. Brown, G.M., Furlong, R.A., Sargent, C.A., Erickson, R.P., Longepied, G., Mitchell, M., Jones, M.H., Hargreave, T.B., Cooke, H.J. and Affara, N.A. (1998) Characterisation of the coding sequence and fine mapping of the human DFFRY gene and comparative expression analysis and mapping to the Sxrb interval of the mouse Y chromosome of the Dffry gene. Hum. Mol. Genet., 7, 97–107.[Abstract/Free Full Text]

  41. Grabowski, P.J. and Black, D.L. (2001) Alternative RNA splicing in the nervous system. Prog. Neurobiol., 65, 289–308.[CrossRef][Web of Science][Medline]

  42. Modrek, B. and Lee, C.J. (2003) Alternative splicing in the human, mouse and rat genomes is associated with an increased frequency of exon creation and/or loss. Nat. Genet., 34, 177–180.[CrossRef][Web of Science][Medline]

  43. Wyckoff, G.J., Wang, W. and Wu, C.I. (2000) Rapid evolution of male reproductive genes in the descent of man. Nature, 403, 304–309.[CrossRef][Medline]

  44. Jones, K.T., Soeller, C. and Cannell, M.B. (1998) The passage of Ca2+ and fluorescent markers between the sperm and egg after fusion in the mouse. Development, 125, 4627–4635.[Abstract]

  45. Nixon, V.L., Levasseur, M., McDougall, A. and Jones, K.T. (2002) Ca2+ oscillations promote APC/C-dependent cyclin B1 degradation during metaphase arrest and completion of meiosis in fertilizing mouse eggs. Curr. Biol., 12, 746–750.[CrossRef][Web of Science][Medline]

  46. Edwards, R.G. (1965) Maturation in vitro of mouse, sheep, cow, pig, rhesus monkey and human ovarian oocytes. Nature, 208, 349–351.[CrossRef][Medline]

  47. Hyslop, L.A., Carroll, M., Nixon, V.L., McDougall, A. and Jones, K.T. (2001) Simultaneous measurement of intracellular nitric oxide and free calcium levels in chordate eggs demonstrates that nitric oxide has no role at fertilization. Dev. Biol., 234, 216–230.[CrossRef][Web of Science][Medline]

  48. Di Agostino, S., Fedele, M., Chieffi, P., Fusco, A., Rossi, P., Geremia, R. and Sette, C. (2004) Phosphorylation of high mobility group protein A2 by Nek2 kinase during the first meiotic division in mouse spermatocytes. Mol. Biol. Cell, 15, 1224–1232.[Abstract/Free Full Text]

  49. Saunders, P.T., Sharpe, R.M., Williams, K., Macpherson, S., Urquart, H., Irvine, D.S. and Millar, M.R. (2001) Differential expression of oestrogen receptor alpha and beta proteins in the testes and male reproductive system of human and non-human primates. Mol. Hum. Reprod., 7, 227–236.[Abstract/Free Full Text]

  50. Matsuzawa, S., Takayama, S., Froesch, B.A., Zapata, J.M. and Reed, J.C. (1998) p53-inducible human homologue of Drosophila seven in absentia (Siah) inhibits cell growth: suppression by BAG-1. EMBO J., 17, 2736–2747.[CrossRef][Web of Science][Medline]

  51. Sourisseau, T., Desbois, C., Debure, L., Bowtell, D.D., Cato, A.C., Schneikert, J., Moyse, E. and Michel, D. (2001) Alteration of the stability of Bag-1 protein in the control of olfactory neuronal apoptosis. J. Cell Sci., 114, 1409–1416.[Abstract]

  52. Hu, G., Zhang, S., Vidal, M., Baer, J.L., Xu, T. and Fearon, E.R. (1997) Mammalian homologs of seven in absentia regulate DCC via the ubiquitin-proteasome pathway. Genes Dev., 11, 2701–2714.[Abstract/Free Full Text]

  53. Susini, L., Passer, B.J., Amzallag-Elbaz, N., Juven-Gershon, T., Prieur, S., Privat, N., Tuynder, M., Gendron, M.C., Israel, A., Amson, R. et al. (2001) Siah-1 binds and regulates the function of Numb. Proc. Natl Acad. Sci. USA, 98, 15067–15072.[Abstract/Free Full Text]

  54. Germani, A., Bruzzoni-Giovanelli, H., Fellous, A., Gisselbrecht, S., Varin-Blank, N. and Calvo, F. (2000) SIAH-1 interacts with alpha-tubulin and degrades the kinesin Kid by the proteasome pathway during mitosis. Oncogene, 19, 5997–6006.[CrossRef][Web of Science][Medline]

  55. Germani, A., Romero, F., Houlard, M., Camonis, J., Gisselbrecht, S., Fischer, S. and Varin-Blank, N. (1999) hSiah2 is a new Vav binding protein which inhibits Vav-mediated signaling pathways. Mol. Cell. Biol., 19, 3798–3807.[Abstract/Free Full Text]

  56. Nagano, Y., Yamashita, H., Takahashi, T., Kishida, S., Nakamura, T., Iseki, E., Hattori, N., Mizuno, Y., Kikuchi, A. and Matsumoto, M. (2003) Siah-1 facilitates ubiquitination and degradation of synphilin-1. J. Biol. Chem., 278, 51504–51514.[Abstract/Free Full Text]

  57. Zhang, J., Guenther, M.G., Carthew, R.W. and Lazar, M.A. (1998) Proteasomal regulation of nuclear receptor corepressor-mediated repression. Genes Dev., 12, 1775–1780.[Abstract/Free Full Text]

  58. Tanikawa, J., Ichikawa-Iwata, E., Kanei-Ishii, C., Nakai, A., Matsuzawa, S., Reed, J.C. and Ishii, S. (2000) p53 suppresses the c-Myb-induced activation of heat shock transcription factor 3. J. Biol. Chem., 275, 15578–15585.[Abstract/Free Full Text]

  59. Tiedt, R., Bartholdy, B.A., Matthias, G., Newell, J.W. and Matthias, P. (2001) The RING finger protein Siah-1 regulates the level of the transcriptional coactivator OBF-1. EMBO J., 20, 4143–4152.[CrossRef][Web of Science][Medline]

  60. Boehm, J., He, Y., Greiner, A., Staudt, L. and Wirth, T. (2001) Regulation of BOB.1/OBF.1 stability by SIAH. EMBO J., 20, 4153–4162.[CrossRef][Web of Science][Medline]

  61. Johnsen, S.A., Subramaniam, M., Monroe, D.G., Janknecht, R. and Spelsberg, T.C. (2002) Modulation of transforming growth factor beta (TGFbeta)/Smad transcriptional responses through targeted degradation of TGFbeta-inducible early gene-1 by human seven in absentia homologue. J. Biol. Chem., 277, 30754–30759.[Abstract/Free Full Text]

  62. Germani, A., Prabel, A., Mourah, S., Podgorniak, M.P., Di Carlo, A., Ehrlich, R., Gisselbrecht, S., Varin-Blank, N., Calvo, F. and Bruzzoni-Giovanelli, H. (2003) SIAH-1 interacts with CtIP and promotes its degradation by the proteasome pathway. Oncogene, 22, 8845–8851.[CrossRef][Web of Science][Medline]

  63. Elliott, D.J., Venables, J.P., Newton, C.S., Lawson, D., Boyle, S., Eperon, I.C. and Cooke, H.J. (2000) An evolutionarily conserved germ cell-specific hnRNP is encoded by a retrotransposed gene. Hum. Mol. Genet., 9, 2117–2124.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
R. J. Katzenberger, M. S. Marengo, and D. A. Wassarman
Control of Alternative Splicing by Signal-dependent Degradation of Splicing-regulatory Proteins
J. Biol. Chem., April 17, 2009; 284(16): 10737 - 10746.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
K. Nakayama, J. Qi, and Z. Ronai
The Ubiquitin Ligase Siah2 and the Hypoxia Response
Mol. Cancer Res., April 1, 2009; 7(4): 443 - 451.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
I. Ehrmann, C. Dalgliesh, A. Tsaousi, M. P. Paronetto, B. Heinrich, R. Kist, P. Cairns, W. Li, C. Mueller, M. Jackson, et al.
Haploinsufficiency of the germ cell-specific nuclear RNA binding protein hnRNP G-T prevents functional spermatogenesis in the mouse
Hum. Mol. Genet., September 15, 2008; 17(18): 2803 - 2818.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. Abada, T. Dreyfuss-Grossman, Y. Herman-Bachinsky, H. Geva, S.-R. Masa, and R. Sarid
SIAH-1 Interacts with the Kaposi's Sarcoma-Associated Herpesvirus-Encoded ORF45 Protein and Promotes Its Ubiquitylation and Proteasomal Degradation
J. Virol., March 1, 2008; 82(5): 2230 - 2240.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
K. A. Sergeant, C. F. Bourgeois, C. Dalgliesh, J. P. Venables, J. Stevenin, and D. J. Elliott
Alternative RNA splicing complexes containing the scaffold attachment factor SAFB2
J. Cell Sci., January 15, 2007; 120(2): 309 - 319.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
D. J Elliott and S. N Grellscheid
Alternative RNA splicing regulation in the testis.
Reproduction, December 1, 2006; 132(6): 811 - 819.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Santelli, M. Leone, C. Li, T. Fukushima, N. E. Preece, A. J. Olson, K. R. Ely, J. C. Reed, M. Pellecchia, R. C. Liddington, et al.
Structural Analysis of Siah1-Siah-interacting Protein Interactions and Insights into the Assembly of an E3 Ligase Multiprotein Complex
J. Biol. Chem., October 7, 2005; 280(40): 34278 - 34287.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. R. Moore and G. A. Bishop
Differential Regulation of CD40-Mediated TNF Receptor-Associated Factor Degradation in B Lymphocytes
J. Immunol., September 15, 2005; 175(6): 3780 - 3789.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. P. Venables, C. F. Bourgeois, C. Dalgliesh, L. Kister, J. Stevenin, and D. J. Elliott
Up-regulation of the ubiquitous alternative splicing factor Tra2{beta} causes inclusion of a germ cell-specific exon
Hum. Mol. Genet., August 15, 2005; 14(16): 2289 - 2303.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
C. D. Cohen, P. P. Doran, S. M. Blattner, M. Merkle, G. Q. Wang, H. Schmid, P. W. Mathieson, M. A. Saleem, A. Henger, M. P. Rastaldi, et al.
Sam68-Like Mammalian Protein 2, Identified by Digital Differential Display as Expressed by Podocytes, Is Induced in Proteinuria and Involved in Splice Site Selection of Vascular Endothelial Growth Factor
J. Am. Soc. Nephrol., July 1, 2005; 16(7): 1958 - 1965.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Haegebarth, D. Heap, W. Bie, J. J. Derry, S. Richard, and A. L. Tyner
The Nuclear Tyrosine Kinase BRK/Sik Phosphorylates and Inhibits the RNA-binding Activities of the Sam68-like Mammalian Proteins SLM-1 and SLM-2
J. Biol. Chem., December 24, 2004; 279(52): 54398 - 54404.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Material
Right arrow All Versions of this Article:
13/14/1525    most recent
ddh165v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (15)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Venables, J. P.
Right arrow Articles by Elliott, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Venables, J. P.
Right arrow Articles by Elliott, D. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?