Skip Navigation


Human Molecular Genetics Advance Access originally published online on June 9, 2004
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
13/15/1563    most recent
ddh173v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (62)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Cheng, H.
Right arrow Articles by Swaroop, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cheng, H.
Right arrow Articles by Swaroop, A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2004, Vol. 13, No. 15 1563-1575
DOI: 10.1093/hmg/ddh173
Human Molecular Genetics, Vol. 13, No. 15 © Oxford University Press 2004; all rights reserved

Photoreceptor-specific nuclear receptor NR2E3 functions as a transcriptional activator in rod photoreceptors

Hong Cheng1,2, Hemant Khanna2, Edwin C.T. Oh1,2, David Hicks4, Kenneth P. Mitton5 and Anand Swaroop1,2,3,*

1Neuroscience Graduate Program, 2Department of Ophthalmology and Visual Sciences and 3Department of Human Genetics, University of Michigan, Ann Arbor, MI, USA, 4Laboratoire de Physiopathologie Cellulaire et Moléculaire de la Rétine, INSERM Université Louis Pasteur E9918 Centre Hospitalier Universitaire Régional, 67091 Strasbourg, France and 5Eye Research Institute, Oakland University, Rochester, MI, USA

Received March 18, 2004; Accepted May 27, 2004


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
NR2E3, a photoreceptor-specific orphan nuclear receptor, is believed to play a pivotal role in the differentiation of photoreceptors. Mutations in the human NR2E3 gene and its mouse ortholog are associated with enhanced S-cones and retinal degeneration. In order to gain insights into the NR2E3 function, we performed temporal and spatial expression analysis, yeast two-hybrid screening, promoter activity assays and co-immunoprecipitation studies. The Nr2e3 expression was localized preferentially to the rod, and not to the cone, photoreceptor nuclei in rodent retina. The yeast two-hybrid screening of a retinal cDNA library, using NR2E3 as the bait, identified another orphan nuclear receptor NR1D1 (Rev-erb{alpha}). The interaction of NR2E3 with NR1D1 was confirmed by glutathione S-transferase pulldown and co-immunoprecipitation experiments. In transient transfection studies using HEK 293 cells, both NR2E3 and NR1D1 activated the promoters of rod phototransduction genes synergistically with neural retina leucine zipper (NRL) and cone–rod homeobox (CRX). All four proteins, NR2E3, NR1D1, NRL and CRX, could be co-immunoprecipitated from the bovine retinal nuclear extract, suggesting their existence in a multi-protein transcriptional regulatory complex in vivo. Our results demonstrate that NR2E3 is involved in regulating the expression of rod photoreceptor-specific genes and support its proposed role in transcriptional regulatory network(s) during rod differentiation.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The vertebrate retina is an intriguingly complex yet a relatively simple model to investigate molecular details underlying higher order functions of the central nervous system. It consists of seven major cell types (six neurons and one glia) that are organized in three morphologically distinct layers (1). Genesis of these cells from multi-potent progenitors proceeds in a predictable sequence during the development of the vertebrate retina (2,3). The intrinsic genetic program appears to be a major determinant of cell fate (4). The competence model of cell-fate determination proposes that as a heterogeneous pool of multi-potent progenitors passes through states of competence, it can produce a specific set of cell types (2). One can predict that at the molecular level this competence is acquired by the differential expression of transcriptional regulatory proteins, which act in a combinatorial and cooperative manner to modulate the expression of cell-type specific genes. It is also predicted that the functional maintenance and survival of retinal cells require a continuous and precise control of expressed genes (5). Intrinsic (e.g. genetic mutations) and extrinsic (e.g. light damage) insults that alter gene expression or function can lead to photoreceptor degeneration (6,7).

Rod and cone photoreceptors account for over 70% of all cells in the mammalian retina. In most mammals, rods are almost 20-fold higher in number compared with cones; however, the distribution of rods and cones varies greatly in different regions (8). The visual pigment in rods is rhodopsin, whereas different cone subtypes (L-, M- and S-cones in humans) have their respective cone pigments (9). In mice, however, only M- and S-cones are present, and a majority of cones can co-express both S- and M-opsin pigments (10). Several transcription factors appear to play critical roles in photoreceptor differentiation. The homeodomain protein Otx2, the retinoblastoma protein Rb and the thyroid hormone receptor-ß2 (TRß2) have been implicated in controlling photoreceptor cell fate (1113). The deletion of rod-specific neural retina leucine zipper protein Nrl (14,15) by gene targeting (Nrl–/–) results in complete lack of rod photoreceptors with a concomitant increase in S-opsin expressing cones (16). Another homeodomain protein Crx is essential for the terminal differentiation of photoreceptors but not for cell-fate determination (17). Nrl and Crx have been shown to interact with each other (18) and regulate the expression of several phototransduction genes (1922). Not surprisingly, mutations in human NRL or CRX result in retinopathies (2328).

Photoreceptor-specific nuclear receptor gene NR2E3 (also called PNR) was first identified by its homology to NR2E1 (also called TLX or tailless), which is involved in cell-fate determination in Drosophila and encodes an orphan receptor of the steroid/thyroid hormone receptor superfamily of ligand-activated transcription factors (29). Mutations in NR2E3 are associated with enhanced S-cone syndrome (ESCS), which is characterized by increased S-cones and reduced or undetectable rod function, suggesting a role in photoreceptor cell-fate determination (30). Studies of a post-mortem retina from an ESCS patient with homozygous NR2E3 mutation supported these findings (31). The NR2E3 mutations have also been reported in Goldmann–Favre syndrome and other retinal degenerative diseases (32). The rd7 mouse, carrying a deletion in the Nr2e3 gene, exhibits retinal dysplasia with increased number of S-cones and late-onset retinal degeneration (33,34). Retinal phenotypes of the ESCS patients and the rd7 mouse suggested that NR2E3 may be involved in suppressing the proliferation of cones (34).

Phenotypic similarities between the Nrl–/– and rd7 retina (16), the lack of Nr2e3 transcripts in the Nrl–/– retina (16), the comparison of gene profiles of the Nrl–/– (35) and rd7 (unpublished data) mouse retinas and the expression of Nrl in rods but not in cones (15) strongly advocated that Nr2e3 functions in rods and is downstream of Nrl in the transcriptional regulatory hierarchy. In order to understand the role of NR2E3, we sought to determine its temporal and spatial expression, identify possible interacting proteins and delineate its role in gene regulation. In this study, we report that: (i) NR2E3 is expressed preferentially in rod (and not in cone) photoreceptors; (ii) NR2E3 interacts with another orphan nuclear receptor NR1D1; (iii) NR2E3 synergistically activates the rod-specific gene promoters with NR1D1, NRL and CRX; and (iv) NR2E3, NR1D1, NRL and CRX are part of a multi-protein complex in nuclear extracts from the retina. Our studies demonstrate that NR2E3 functions as a transcriptional activator of rod-specific genes and suggest that it acts in concert with NRL and other transcription factors to facilitate rod differentiation.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Temporal and spatial expression of Nr2e3 in rodent retina
We first studied the temporal expression of Nr2e3 mRNA and protein in the mouse retina. The RT–PCR analysis of retinal RNA from various stages of development detected Nr2e3 transcripts as early as embryonic day (E) 16.5 (Fig. 1A). Immunoblot analysis of the retinal protein extracts revealed the presence of Nr2e3 protein at and after post-natal day (P) 0.5, though a faint band could be observed at E 18.5 upon over-exposure (Fig. 1B). The Nr2e3 expression peaked at P 6.5, at and around the onset of rhodopsin expression (data not shown).



View larger version (44K):
[in this window]
[in a new window]
 
Figure 1. Temporal expression of Nr2e3 in mouse retina. (A) RT–PCR analysis: mouse retinal RNA from developmental stages E 14.5–P 21.5 (as indicated) was reverse transcribed. The resulting cDNA was used as a template to amplify the 784 bp fragment corresponding to the Nr2e3 transcript using the following primers: forward, CCGGCTGAAGAAGTGCTTAC and reverse, GAGCAATTTCCCAAACCTCA. The housekeeping gene Hprt served as internal control. (B) Immunoblot assay: mouse retinal protein extracts (30 µg) from developmental stages E 18.5 to adult (as indicated) were analyzed by SDS–PAGE, followed by immunoblotting using anti-NR2E3 antibody (1 : 400). The same blot was also probed with monoclonal anti-ß-tubulin antibody (1 : 2000) (Santa Cruz Biotechnology).

 
To examine the spatial localization of Nr2e3, we performed immunohistochemistry of mouse retina sections at P 2.5 (when the photoreceptors are developing) and P 21.5 (when the retina has differentiated terminally and the photoreceptors are functional) using the affinity-purified anti-NR2E3 antibody. At P 2.5, the expression of Nr2e3 was detected in the outer neuroblastic layer (Fig. 2A: a and b), consistent with its expression in the photoreceptors. Nr2e3 was detected specifically in the outer nuclear layer (ONL) of photoreceptors of P 21.5 mouse retina; this expression corresponded to the nuclei of rods, as determined by labeling with anti-rhodopsin antibody (a rod marker) (Fig. 2A: c–j) or PNA (peanut agglutinin; a cone marker) (data not shown).



View larger version (69K):
[in this window]
[in a new window]
 
Figure 2. Immunohistochemical analysis of rodent retina. (A) Immunohistochemistry of P 2.5 (a, b) and P 21.5 (c–e, low magnification and f–j, high magnification) mouse retina: mouse retinal sections were incubated with anti-NR2E3 antibody (1 : 200) and/or anti-rhodopsin monoclonal antibody (4D2, 1 : 1000). Alexa fluor 546 (or 488) conjugated goat anti-rabbit (or mouse) IgG was used as the secondary antibody. a, Nomarski image of the P 2.5 retinal section; b, the outer neuroblastic layer (ONBL) showing the Nr2e3 immunoreactivity (red); c, Nomarski image of P 21.5 retinal section; d, the cell nuclei staining with bisbenzimide (blue); e, ONL showing expression of Nr2e3 (green); f, Nomarski image of P 21.5 retinal section; g, the photoreceptor layer showing Nr2e3 signal (red); h, the outer segment (OS) of photoreceptors and ONL stained with anti-rhodopsin (green); i, overlay of images g and h showing localization of Nr2e3 to the nuclei of rhodopsin positive cells and j, control section stained with anti-NR2E3 antibody pre-incubated with the antigen (purified NR2E3 protein). Scale is as indicated. (B) Immunohistochemistry of retina from adult Nile rats (A. ansorgeii): adult Nile rat retina was incubated with anti-NR2E3, anti-rhodopsin and anti-cone arrestin antibodies followed by incubation with secondary anti-mouse IgG-Alexa488 or anti-rabbit IgG-Alexa568 antibodies. a, Nomarski image showing a clear bifurcation into two rows of superficially located cone cell bodies (cb) and four rows of more deeply positioned rod cell bodies (rb) within ONL at the level of the posterior pole; b, staining with anti-cone arrestin antibody reveals intense labeling of cone cells, extending from OS down through the cell bodies and is particularly visible in the large synaptic pedicles located in OPL; c, staining with anti-rhodopsin antibody shows annular staining of the inner ONL, corresponding to rod cell body membranes and very strong staining of rod OS. Staining is absent from the cone cell body rows (arrow) (faint immunoreactivity at this level is due to rod processes extending between cone cells); d, Nomarski image showing that the Nile rat retina is slightly thinner towards the periphery, but a single row of cone cells (cb) is still present; e, the NR2E3 immunoreactivity can be seen within OS and inner segments (IS), in ONL and in a sub-population of cells in INL (asterisk). The arrow points to a zone between IS and ONL where staining is absent; f, overlay of d and e shows that NR2E3 is present in rod cell bodies, but is not detectable in cone cell bodies (arrow). L, lens; INBL, inner neuroblastic layer; ONBL, outer neuroblastic layer; RPE, retinal pigment epithelium; GCL,: ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer; OS, outer segment of photoreceptors and IS, inner segment of photoreceptors.

 
To facilitate the visualization of potential differences in rod–cone distribution, we also performed immunohistochemical analysis of retinas dissected from adult Nile rats Arvicanthis ansorgeii, a diurnally active rodent which contains ~30% cones (unpublished data). The A. ansorgeii retina possesses six rows of nuclei in the central posterior retina (Fig. 2B: a). Immunostaining with an anti-cone arrestin antibody revealed intense labeling of the two outermost rows, which are constituted entirely by cone cell bodies (Fig. 2B: b). Cone arrestin was detected throughout these cells, from the outer segments (OS) to the level of the synaptic pedicle. In contrast, the anti-rhodopsin 4D2 antibody outlined cell bodies in deeper rows (hence identified as rods) as well as intensely staining OS (Fig. 2B: c). The retina shows progressive thinning to four or five rows at the periphery (Fig. 2B: d). The NR2E3 immunoreactivity was visible in the inner segments (IS), ONL and more intensely in a subset of cells within the inner nuclear layer (Fig. 2B: e). The labeling in INL probably represents Müller glia. The merging of Nomarski and antibody stained images showed that ONL staining co-localized with rod but not with cone cell bodies (Fig. 2B: f).

Interaction of NR2E3 with NR1D1, identified by the yeast two-hybrid screening
An NR2E3 bait (Fig. 3A; amino acid residues 1–227; LexA-NR2E3-N), which did not activate the reporter genes lacZ and HIS3 upon transformation into the yeast L40 strain, was used to screen a bovine retina cDNA library. Forty-seven clones were found to be positive by nutrition selection and ß-galactosidase filter lift assays. Sequence analysis revealed six cDNA clones from different plates corresponding to the bovine NR1D1 protein. Five of the six clones were of the same length (Gal4-AD-{Delta}NR1D1), and the sixth clone was shorter by only one amino acid residue. The Gal4-AD-{Delta}NR1D1 represented the residues 264–614 of the human NR1D1 protein and encoded the carboxyl-terminal 351 amino acids of the bovine NR1D1. This included the complete ligand-binding domain (LBD) and most of the hinge region, but was missing the DNA-binding domain (DBD) (Fig. 3A). The yeast cells containing Gal4-AD-{Delta}NR1D1 prey grew on minus-His media containing 25 mM aminotriazole (AMT) in combination with LexA-NR2E3-N bait, but not with LexA-Laminin bait (non-specific interaction control) (Fig. 3A).



View larger version (43K):
[in this window]
[in a new window]
 
Figure 3. Interaction of NR2E3 with NR1D1 by the yeast two-hybrid assay. (A) Upper panel: schematic representation of the different domains of NR2E3 and NR1D1 proteins, the bait (NR2E3-N) used for the yeast two-hybrid assay and the human {Delta}NR1D1 protein corresponding to the bovine Gal4-AD-{Delta}NR1D1 clone obtained in the yeast two-hybrid screen. DBD, DNA-binding domain and LBD, ligand-binding domain. Lower panel: specificity of NR2E3–NR1D1 interaction. Bait strains containing pHybLexA-Laminin or pHybLexA-NR2E3-N were transformed with the Gal4-AD-{Delta}NR1D1 (bovine) prey clone. Independent yeast transformants with LexA-NR2E3-N grew on both plus-His medium and minus-His medium containing 25 mM aminotriazole (AMT), but those with LexA-Laminin and Gal4-AD-{Delta}NR1D1 only grew on plus-His medium (non-specific interaction control). (B) Upper panel: schematic representation of the human NR1D1 protein (614 amino acids) and the amino- (NR1D1-N) and carboxyl-terminal (NR1D1-C) regions used to verify the interaction with NR2E3-N bait. Lower panel: bait strains containing LexA-Laminin or LexA-NR2E3-N were transformed with NR1D1 prey constructs. Individual yeast transformants of all three prey constructs grew on minus-Trp, minus-His medium containing 15 mM AMT with the LexA-NR2E3-N bait, but not with the LexA-Laminin bait (non-specific interaction control). Under these stringent conditions, the L40 yeast with c-Fos+c-Jun (positive control) grew, whereas Laminin+c-Jun did not grow (negative control). Filter lift assays for ß-galactosidase activity (blue) are shown on the right and confirmed the growth test results.

 
We then used prey constructs (with B42 activation domain) expressing the full-length (residues 1–614), amino- (residues 1–271) and carboxyl-terminal (residues 186–614) regions of the human NR1D1 protein for the yeast two-hybrid assays to examine their interaction with the NR2E3-N bait. The yeast cells containing any of the three NR1D1 ‘prey’ constructs grew on the selection media (minus-His) in the presence of NR2E3 and showed ß-galactosidase activity (Fig. 3B). The LexA-Laminin bait did not show interaction with the NR1D1 prey (negative control).

Interaction between NR2E3 and NR1D1, validated by the glutathione S-transferase pulldown assay and co-immunoprecipitation
To confirm the direct interaction of NR2E3 with NR1D1, the glutathione S-transferase (GST) pulldown assays were performed using full-length and different carboxyl-terminal deletions of NR1D1, generated by in vitro transcription/translation (Fig. 4A). GST–NR2E3 was able to bind to and retain the full-length and truncated NR1D1 proteins containing the DBD and part of the hinge region (residues 1–288), but not the shorter NR1D1 protein(s) having partial DBD deletion(s) (Fig. 4B).



View larger version (32K):
[in this window]
[in a new window]
 
Figure 4. (A) Schematic representation of the NR1D1 protein regions used for in vitro transcription/translation. (B) The GST pulldown assay: the [35S]-methionine labeled full-length or truncated NR1D1 proteins (as indicated) were prepared by in vitro translation and incubated with glutathione–Sepharose bound GST–NR2E3 or GST alone (control). Asterisk indicates the 35S-NR1D1 input control (20% of the total protein used for pulldown). The NR1D1, NR1D1-505 and NR1D1-288 proteins displayed binding to GST–NR2E3 but not to GST beads, whereas NR1D1-198 and NR1D1-139 did not bind to either GST or GST–NR2E3 beads. Molecular weight markers (in kDa) are indicated on the left. (C) Interaction between NR2E3 and NR1D1 in vivo: bovine RNE (500 µg) was incubated with anti-NR1D1 or anti-RP2 (control) antibody and the antigen–antibody complex was immunoprecipitated (IP) using Protein A–Sepharose beads. The beads were then suspended in Laemmli buffer and analyzed by SDS–PAGE followed by immunoblotting using anti-NR2E3 antibody. Lanes are: 1, RNE (20 µg); 2, IP with anti-NR2E3 antibody; 3 and 4, IP using an irrelevant antibody (anti-RP2) or no antibody as negative controls. The IgG heavy chain and the NR2E3 bands are indicated. Numbers on left indicate molecular weight markers in kDa.

 
To test whether NR2E3 and NR1D1 interact with each other in vivo, we performed co-immunoprecipitation experiments using bovine retinal nuclear extracts (RNEs). Immunoprecipitation using anti-NR1D1 polyclonal antibody, followed by immunoblot analysis with anti-NR2E3 antibody, detected a 42 kDa band corresponding to the expected size of NR2E3 (Fig. 4C). An irrelevant antibody (control) did not immunoprecipitate NR2E3 from RNE (Fig. 4C).

Synergistic activation of rhodopsin and Gnat1 promoters by NR2E3, NR1D1, NRL and CRX
The lack of normal rod photoreceptors and their degeneration in the ESCS patients and the rd7 mouse (3033), together with the NR2E3 expression in rods (Fig. 2) (36), prompted us to examine if NR2E3 is involved in regulating rod-specific gene expression. We first used the rhodopsin promoter-luciferase activity assay, as described earlier (37,38), and tested the effect of the NR2E3 expression in transient transfection experiments using HEK 293 cells. To determine the physiological relevance of NR2E3–NR1D1 interaction, we also included the NR1D1 expression construct in transfection assays. Neither NR2E3 nor NR1D1 alone had a significant effect on the activity of the rhodopsin promoter; however, three-fold activation was observed when NR2E3 and NR1D1 were co-transfected (Fig. 5A). Since NRL and CRX have been demonstrated to regulate the expression of rod-specific genes (1922), different combinations of NRL, CRX, NR2E3 and NR1D1 were tested using the same assay. We observed synergistic activation (72-fold) of the rhodopsin promoter when all four transcription factors were present (Fig. 5A). We then performed similar assays using expression constructs encoding NR2E3 with a partial (residues 1–108) or complete (residues 1–219) deletion of DBD. Unlike the full-length NR2E3, the deletion constructs did not show activation synergy with NRL, CRX or NR1D1 (data not shown). The loss of the NR2E3 function in these experiments was not due to the lack of protein production, as determined by immunoblot analysis of the transfected cells.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 5. Synergistic activation of rhodopsin and Gnat1 promoters by NR2E3, NR1D1, NRL and CRX. (A) HEK 293 cells were co-transfected with 0.3 µg of bovine rhodopsin –130 to +72/luciferase fusion construct (pGL2-BRP-130) together with the indicated amount of NR2E3, NR1D1, NRL and CRX expression plasmids. Luciferase activity was corrected for transfection efficiency using a ß-galactosidase internal control (pCMV-ß-gal) (0.3 µg) and shown as fold change, which was calculated as the ratio of each combination to the reporter construct with empty vector (lane 1). Error bars show the standard deviation, n=9. (B) Same as (A), except that the reporter construct was mouse Gnat1 –2857 to –1/luciferase fusion plasmid (pGL3-Gnat1).

 
We then wanted to determine if other rod-specific promoters could be transactivated by NR2E3 alone or in combination with NR1D1, NRL and/or CRX. Transient transfection studies in a HEK 293 cell line with a similar reporter construct but with the Gnat1 promoter [rod transducin (39), shown to be regulated by Nrl (35)] demonstrated that NR2E3 and NR1D1 only marginally increased the luciferase activity; however, almost 7-fold activation was observed when NRL and CRX were co-expressed (Fig. 5B). In contrast to the rhodopsin promoter, the Gnat1 promoter revealed less transactivation and the activity was not further enhanced in the presence of NR1D1.

NR2E3 and/or NR1D1 exhibited similar transactivation synergy with promoters of two other rod genes, Pde6{alpha} (cGMP phosphodiesterase {alpha}-subunit) and Cncg (cGMP gated channel) (data not shown). Our data strongly support a combinatorial and cooperative action of NR2E3 with NRL, CRX and/or NR1D1 in modulating the activity of rod-specific promoters.

A multi-protein complex containing NR2E3, NR1D1, NRL and CRX in retinal nuclei
To establish the in vivo relevance of NR2E3 in transcriptional regulation and its relationship with NR1D1, NRL and CRX, we performed co-immunoprecipitation experiments using bovine RNEs. When anti-NR1D1 or anti-NR2E3 antibodies were used for immunoprecipitation, the NRL immunoreactive bands were observed in the range of 29–35 kDa consistent with the previously reported migration pattern of NRL (15) (Fig. 6A). As predicted, NRL was not immunoprecipitated with an irrelevant antibody (control). Reverse experiments using anti-NRL antibody for immunoprecipitation showed the NR2E3 immunoreactive bands (42 kDa) (Fig. 6A). The immunoprecipitates with anti-NR2E3 and anti-NR1D1 antibodies also revealed bands with anti-CRX antibody (Fig. 6B). We could not detect NR1D1 in the immunoprecipitates with anti-NR2E3, anti-NRL or anti-CRX antibody. This is probably because of the low levels of NR1D1 protein. However, the anti-NR1D1 antibody was able to immunoprecipitate other proteins of the multi-protein complex from RNE (Figs 4C, 6A and B).



View larger version (47K):
[in this window]
[in a new window]
 
Figure 6. Co-immunoprecipitation of NR2E3, NR1D1, NRL and CRX from bovine RNEs. Bovine RNE (500 µg) was incubated with anti-NR1D1, anti-NR2E3, anti-NRL or anti-RP2 antibody (as indicated). IP was performed using Protein A–Sepharose beads. The immunoprecipitated proteins were analyzed by SDS–PAGE, followed by immunoblotting. RNE lane included 20 µg of the protein. (A) The immunoblot was probed with anti-NRL (lanes 1–4) or anti-NR2E3 (lanes 5 and 6) antibodies. Lanes are as indicated. The rabbit IgG heavy chain, multiple NRL isoforms (15) and NR2E3 band (36) are indicated. Molecular weight markers (in kDa) are shown on the left. (B) The immunoblot was probed with anti-CRX antibody. Lanes are as indicated. The rabbit IgG heavy chain and the doublet of CRX isoforms (20) are indicated.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Quantitatively precise expression of genes at the right time and in the right cell/tissue is essential for growth and differentiation. Transcription initiation requires the formation of an ‘enhanceosome’, which works together with the basal transcription factor machinery to initiate gene expression (40,41). Differential gene expression patterns are accomplished by the availability, amount and activity of tissue-specific transcriptional regulators (activators and repressors) that recruit the basal transcriptional complex to the promoter(s). The expression of phototransduction genes is stringently controlled since their enhanced or reduced expression can lead to retinal degeneration (6,7). NRL and CRX have been shown previously to play critical roles in rod differentiation and in regulating the expression of rod genes (1622). NR2E3 has emerged recently as a major photoreceptor-specific transcription factor because of its unique loss of function phenotypes in humans and mice. However, its precise function in photoreceptor development or gene regulation has not been determined. Here, we provide several lines of evidence to demonstrate that NR2E3 is a transcriptional activator of genes in rod photoreceptors and suggest its role during rod differentiation.

The discovery of NR1D1 as an NR2E3-interacting protein adds a new dimension to the role of nuclear receptors in retinal development. NR1D1, encoded by the opposite strand of thyroid hormone receptor-{alpha} (TR{alpha}) gene, is an orphan nuclear receptor involved in cerebellar development (42,43). TRß2 and ligands of steroid/thyroid hormone receptors have been shown to affect cone differentiation (13,44). We now provide evidence that NR1D1 is expressed in the retina. Although we could not detect the NR1D1 protein in the mouse retina by immunoblotting or immunohistochemistry, its presence in the retinal cDNA preparations and association with rod-specific proteins in vivo by co-immunoprecipitation assay provides indirect evidence of its role in rod photoreceptors. Previous studies have suggested that Rev-erb{alpha} and -ß can act as transcriptional repressors (45,46). Our results show that NR1D1 (Rev-erb{alpha}) also functions as a transcriptional activator of rod genes in the presence of NR2E3, NRL and/or CRX. NR1D1 is emerging as an important component of the circadian clock (47,48). The expression levels of several phototransduction genes, including rhodopsin, display circadian rhythms (49,50). NR1D1 is, hence, a tempting candidate for circadian modulation of gene expression in the photoreceptors.

Although the overall pattern of activation of rhodopsin and Gnat1 promoters was similar in the presence of NR2E3, NR1D1, NRL and CRX, the quantitative response of the two promoters was significantly different. This differential effect of transcription factors on distinct promoters is not surprising. One reason for the difference between the expression levels of rhodopsin versus Gnat1 could be the length of promoter used in the assay (–130 to +72 for rhodopsin versus –2857 to –1 for Gnat1). In addition, it is the availability, amount and activity of the appropriate combinations of transcription factors that determine unique temporal, spatial and quantitatively precise expression of a particular gene. Rhodopsin is expressed at much higher levels than any other gene in the rods. Our data suggest that high levels of rhodopsin expression may require additional factors (e.g. NR1D1), which are not needed for the expression of other genes (e.g. Gnat1). It is also likely that certain transcription factors may affect the expression of only a few specific promoters. Differential expression may, therefore, result from variable interaction strength and the availability of the cis-regulatory elements at the promoter (40).

Previous studies have shown that NR1D1 can bind as monomer to the nuclear receptor half-site motif (PuGGTCA) preceded by an A/T rich sequence or as homodimer to direct repeats of core sequence separated by two nucleotides with an A/T rich 5' extension (51,52). NR2E3, on the other hand, requires dimeric direct repeats of AAGTCA half-sites to bind to DNA (29). Sequence analysis of the minimal rhodopsin promoter did not reveal the consensus NR2E3 or NR1D1 target sequences. Although the core motif AGGTCA without a 5' A/T rich sequence is present on the rhodopsin proximal promoter, we did not observe any obvious binding of NR2E3 or NR1D1 to this site as determined by electrophoretic mobility shift and supershift analysis using bovine RNEs (data not shown). Nevertheless, the NR2E3 variants lacking a part of or complete DBD could not mediate the transcriptional synergy observed with NRL, CRX and/or NR1D1. We suggest the following possibilities.

  1. The binding of NR2E3 and/or NR1D1 to DNA is not stable or binding sites are unavailable. Chromatin remodeling complexes, together with the binding of NRL and/or CRX to their cognate sequences, alter the DNA conformation thereby facilitating and stabilizing the binding of NR2E3.
  2. DBD of NR2E3 (and/or NR1D1) is involved in the interaction with NRL, CRX or other mediator proteins, thereby enhancing the transcriptional synergy. Many transcription factors, including nuclear receptors, do not directly bind to DNA but associate with other proteins through their DNA-binding domains to module gene expression (5356).
  3. As in the case of thyroid hormone receptors (56), NR2E3 may require heterodimerization for DNA-binding and transactivation of target gene promoters.
  4. Binding to an as yet unidentified ligand may be critical for the optimal functioning of NR2E3.
NR2E3 exhibited strong interaction with NR1D1 in the yeast two-hybrid screening experiments, whereas the interaction with NRL and CRX was weak or undetectable (data not shown). Nevertheless, these four transcription factors could be co-immunoprecipitated from retinal nuclei and synergistically (and/or cooperatively) activated rod-specific gene promoters in HEK 293 cells. These results indicate that the interaction of NR2E3 with NRL or CRX may not be direct and additional transcriptional regulatory proteins might be necessary for the formation of a stable complex in vivo. We suggest that the bridging proteins may not be specific to photoreceptors and/or could be part of the general transcriptional machinery, since the transactivation synergy is observed even in a HEK 293 cell line. Recently, another homeodomain protein QRX was identified as a Ret-1/PCE-binding protein and shown to act synergistically with CRX and NRL to activate rhodopsin promoter (57). Interestingly, QRX can interact directly with CRX but not with NRL. Identification of multiple proteins involved in rhodopsin gene transcription (Fig. 7) implies combinatorial and cooperative regulation and provides additional mechanisms for control, e.g. modulation of gene expression by different signaling pathways that affect the function of transcriptional regulators (58).



View larger version (46K):
[in this window]
[in a new window]
 
Figure 7. A model of transcription initiation complex at the rhodopsin promoter. Cis-regulatory elements upstream of the transcription start site in the rhodopsin promoter include Eopsin-1, Ret-1, BAT-1, NRE, Ret-4 and TATA-box. NRL is believed to bind to NRE as a homodimer. It interacts with TATA-binding protein (TBP) (unpublished data). NRL and CRX physically interact (18). CRX can bind to Ret-4 and BAT-1 elements. BAF and FIZ-1 function as repressors of CRX and NRL, respectively. The homeodomain proteins, RX, ERX, CRX and QRX, can bind to the Ret-1/PCE-1 element in vitro. It is unclear which of these occupies this element in vivo. QRX interacts with CRX but not with NRL (57). In this report, we show that NR2E3 and NR1D1 also participate in the transcriptional activation of the rhodopsin promoter. Combinatorial and synergistic actions of various regulatory proteins recruit and stabilize the initiation complex and facilitate the transcription by RNA polymerase II (RNAP II).

 
Preferential expression of Nr2e3 in rod photoreceptors, its concordance with rod differentiation and maturation, and its ability to activate rod-specific gene expression clearly demonstrate a significant function of Nr2e3 in rods. Microarray analysis of the retinal RNA from the rd7 mice also supports the role of Nr2e3 in regulating rod gene expression (unpublished data). Like NRL, NR2E3 is detected only in rod and not in cone photoreceptors in the human (36) and rodent retina (this report). Our studies, therefore, strongly support the hypothesis that NR2E3 is downstream of NRL in transcriptional regulatory pathways of rod differentiation and functional maintenance (16). We suggest that the loss of NR2E3 would lead to abnormal rods, which degenerate with time, as observed in the retinas of the ESCS patients and the rd7 mouse.

On the basis of the enhanced S-cone phenotype associated with the loss of the NR2E3 function in humans and mice, it has been proposed that NR2E3 acts as a repressor of cone proliferation or cone development (30). Our results do not rule out this possibility. It is possible that NR2E3 is expressed in early photoreceptor cells before the decision to become a rod or a cone is finalized in the mammalian retina. One can speculate that NR2E3 also acts as an active suppressor of cone genes in the rod photoreceptors. We also observed Nr2e3-like immunoreactivity in cells of the inner nuclear layer, presumably Müller glia, in A. ansorgeii retina (Fig. 2B); however, in the human (36) and mouse (Fig. 2A) retina NR2E3 staining was detected only in the rod photoreceptors. One previous in situ hybridization study using albino mouse and rhesus monkey retina had reported Müller glial expression of a splice variant of NR2E3 (59). Additional studies will be required to determine the role of NR2E3, if any, in these cells.

In summary, our results provide strong evidence in support of the role of NR2E3 in developing and in mature rod photoreceptors. We hypothesize that NR2E3 is a direct target of NRL in rods and that the two proteins work in concert (and with other transcription regulatory proteins) to initiate the cascade of regulatory events during the rod differentiation.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Plasmid constructs
The full-length NR2E3 (GenBank accession no. NM_014249), NR1D1 (NM_021724), NRL (NM_006177) and CRX (NM_000554) cDNAs were amplified from human retinal RNA by RT–PCR and cloned into the mammalian expression vector pcDNA4 His/Max C (Invitrogen). The NR2E3 cDNA was also cloned into Escherichia coli expression vector pGEX-4T-2 (Amersham Biosciences, Piscataway, NJ, USA) in-frame with GST. The luciferase reporter construct with bovine rhodopsin promoter (–130 to +72) in the pGL2-basic vector has been described earlier (19). The Gnat1 promoter region (–2857 to –1) (NT_039477) was amplified from the mouse genomic DNA with forward primer 5'-GCTAGCAGCCCCTCATCCCTTTTAAT-3' and reverse primer 5'-CTCGAGGGTCCCAGCAGCAGGCAAAG-3'. The product was cloned sequentially into pGEM-T-Easy (Promega, Madison, WI, USA) and then pGL3-basic vector (pGL3-Gnat1).

Recombinant protein production and antibody generation
The anti-NR2E3 antibody was generated against the recombinant NR2E3 protein produced in E. coli, as described (36). Rabbit polyclonal anti-NR1D1 antibody was raised against the linear peptide sequence 581ETSRFTKLLLKLPDLR596 of human NR1D1 (NP_068370) and affinity purified. The antibody recognized a protein of 70 kDa, corresponding to the predicted molecular mass of NR1D1, in immunoblots of bovine retinal extract (data not shown).

The anti-RP2 antibody, used as a control irrelevant antibody in the immunoprecipitation experiments, was generated in rabbit against E. coli-expressed RP2 protein and affinity purified (unpublished data).

Immunohistochemistry
Using mouse retina: frozen sections were obtained from mouse eyes embedded in OCT (Tissue-Tek, Miles Inc.). Sections were blocked for non-specific protein-binding with 10% goat serum in phosphate-buffered saline (PBS) at room temperature for 1 h and then incubated with the affinity-purified rabbit anti-NR2E3 (1 : 200) and mouse anti-rhodopsin (4D2) (1 : 1000) overnight at 4°C in PBS containing 5% goat serum (Sigma, St Louis, MO, USA). After washing with PBS+0.2% Triton X-100 (room temperature, 3x10 min), the sections were incubated with Alexa fluor 546- or 488-conjugated goat anti-rabbit or goat anti-mouse IgG secondary antibody (2 mg/ml) (Molecular Probes, Eugene, OR, USA) in PBS+5% goat serum. Control sections were processed simultaneously with a single primary antibody, pre-absorbed with the antigen (NR2E3 protein), or without the primary antibody.

Using A. ansoergii retina: adult Nile rats were sacrificed by CO2 anesthesia followed by decapitation, and the eyeballs enucleated and fixed by conventional means (4% paraformaldehyde in PBS overnight at 4°C). Frozen sections were obtained and permeabilized with 0.1% Triton X-100 for 5 min, then treated with blocking buffer (PBS containing 5% normal rabbit serum, 0.1% bovine serum albumin, 0.1% Tween 20 and 0.1% NaN3) for 30 min. Immunohistochemistry was performed using anti-NR2E3 (1 : 200) and mouse anti-rhodopsin 4D2 (1 : 1000) (60) or anti-cone arrestin antibodies (61). Primary antibodies were diluted in blocking buffer and incubated overnight; slides were washed thoroughly and antibody binding was visualized with secondary anti-mouse IgG-Alexa488 or anti-rabbit IgG-Alexa568 (Molecular Probes Ltd., Eugene, OR, USA) (10 µg/ml for 1 h). Slides were finally washed extensively and examined by laser scanning confocal microscopy (Zeiss LSM 510 v2.5 scanning device with Zeiss Axiovert 100 inverted microscope). Control experiments were performed by omitting the primary antibody.

The yeast two-hybrid screening
Screening of the bovine retina prey library by the yeast two-hybrid assay was performed as described (38), with minor modifications. The bait construct (pHybLex-NR2E3-N) was generated by cloning the amino-terminal region (residues 1–227) of the human NR2E3 cDNA into pHybLex/Zeo vector (Invitrogen, Carlsbad, CA, USA) in frame with the LexA gene. Yeast L40 was transformed sequentially with pHybLex-NR2E3-N and 10 µg of retinal cDNA. Double transformants were selected for the bait (using zeocin) and the prey vectors [minus-leucine (LEU) selection], and possible interactors [minus-Histidine (HIS) selection], by two rounds of growth on appropriate medium and then by filter lift assay for ß-galactosidase activity. The prey clones were again verified by retransformation of L40 yeast strains containing pHybLex/Zeo-Laminin (expressing LexA–laminin fusion protein) or pHybLex-NR2E3-N bait vectors to eliminate false positives. Clones positive for growth with pHybLex-NR2E3-N and negative with pHybLex/Zeo-Laminin were sequenced.

The yeast expression constructs expressing B42AD-NR1D1 hybrid proteins were generated by PCR with restriction sites added to primers and then cloned into the pYesTrp2 vector (Invitrogen). All constructs were sequence-verified. Tests with the pYesTrp2 prey vector used (minus-Trp) medium in place of (minus-Leu) for selection.

In vitro transcription/translation and the GST pulldown assay
NR1D1 cDNA fragments encoding the full-length and carboxyl-terminal deletion variants were cloned in pcDNA3.1 (Invitrogen), and translated in the presence of [35S] methionine (Amersham Biosciences) using the TNT-T7 Quick-Coupled in vitro transcription/translation system (Promega). The GST pulldown assays were performed using GST–NR2E3 beads and in vitro translated NR1D1 and its variants, as described (38).

Transient transfection and luciferase assays
HEK 293 cells (ATCC CRL-1573) were maintained in MEM (Invitrogen) supplemented with 10% fetal bovine serum, 1 mM sodium pyruvate, 0.1 mM non-essential amino acids, penicillin G (100 U/ml) and streptomycin (100 µg/ml) at 37°C in a humidified incubator with 5% CO2. Cells were transfected in 24-well plates (8x104 cells/well) using Fugene 6 (Roche, Indianapolis, IN, USA) according to manufacturer's instructions. Expression constructs for CRX, NRL, NR2E3 and NR1D1 were used for transfection. Luciferase assays were performed as described earlier (38). All transfections included the reporter construct pGL2-BRP-130 or pGL3-Gnat1 as well as pCMV-ß-gal to normalize for transfection efficiency. Luciferase expression was measured using luminescence-based assay system (Promega, Madison, WI, USA). The luciferase activity was calculated as fold change on the basis of the control transfections using empty vector and pGL2-BRP-130 or pGL3-Gnat1.

Co-immunoprecipitation experiments
Immunoprecipitation from the bovine RNE was carried out as described (38). The immunoprecipitates were subjected to SDS–PAGE followed by immunoblot analysis using appropriate antibodies. The immunoblots were developed using the enhanced chemiluminescence kit (Pierce, New York, NY, USA).


    ACKNOWLEDGEMENTS
 
We thank R. Molday, X. Zhu and C. Craft for providing antibodies, C.-H. Sung for the bovine retina prey library, J.S. Friedman, A.J. Mears, P.K. Swain and S. Zareparsi for constructive comments, M. Gillett for technical assistance, S. Ferrara for administrative support and Dr Douglas Forrest for stimulating discussions on nuclear receptors. This research was supported by grants from the National Institutes of Health (EY11115, EY07003 and EY014803), The Foundation Fighting Blindness and Research to Prevent Blindness (RPB). A.S. is Harold F. Falls Collegiate Professor and RPB Senior Scientific Investigator.


    FOOTNOTES
 
* To whom correspondence should be addressed at: Department of Ophthalmology and Visual Sciences, W.K. Kellogg Eye Center, University of Michigan, 1000 Wall Street, Ann Arbor, MI 48105, USA. Tel: +1 7347633731; Fax: +1 7346470228; Email: swaroop{at}umich.edu


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Dowling, J.E. (1987) The Retina—An Approachable Part of the Brain. Harvard University Press, Cambridge.

  2. Livesey, F.J. and Cepko, C.L. (2001) Vertebrate neural cell-fate determination: lessons from the retina. Nat. Rev. Neurosci., 2, 109–118.[CrossRef][Web of Science][Medline]

  3. Marquardt, T. and Gruss, P. (2002) Generating neuronal diversity in the retina: one for nearly all. Trends Neurosci., 25, 32–38.[CrossRef][Web of Science][Medline]

  4. Cayouette, M., Barres, B.A. and Raff, M. (2003) Importance of intrinsic mechanisms in cell fate decisions in the developing rat retina. Neuron, 40, 897–904.[CrossRef][Web of Science][Medline]

  5. Blau, H.M. (1992) Differentiation requires continuous active control. Annu. Rev. Biochem., 61, 1213–1230.[CrossRef][Web of Science][Medline]

  6. Pacione, L.R., Szego, M.J., Ikeda, S., Nishina, P.M. and McInnes, R.R. (2003) Progress toward understanding the genetic and biochemical mechanisms of inherited photoreceptor degenerations. Annu. Rev. Neurosci., 26, 657–700.[CrossRef][Web of Science][Medline]

  7. Rattner, A., Sun, H. and Nathans, J. (1999) Molecular genetics of human retinal disease. Annu. Rev. Genet., 33, 89–131.[CrossRef][Web of Science][Medline]

  8. Curcio, C.A., Sloan, K.R., Kalina, R.E. and Hendrickson, A.E. (1990) Human photoreceptor topography. J. Comp. Neurol., 292, 497–523.[CrossRef][Web of Science][Medline]

  9. Nathans, J., Merbs, S.L., Sung, C.H., Weitz, C.J. and Wang, Y. (1992) Molecular genetics of human visual pigments. Annu. Rev. Genet., 26, 403–424.[CrossRef][Web of Science][Medline]

  10. Applebury, M.L., Antoch, M.P., Baxter, L.C., Chun, L.L., Falk, J.D., Farhangfar, F., Kage, K., Krzystolik, M.G., Lyass, L.A. and Robbins, J.T. (2000) The murine cone photoreceptor: a single cone type expresses both S and M opsins with retinal spatial patterning. Neuron, 27, 513–523.[CrossRef][Web of Science][Medline]

  11. Nishida, A., Furukawa, A., Koike, C., Tano, Y., Aizawa, S., Matsuo, I. and Furukawa, T. (2003) Otx2 homeobox gene controls retinal photoreceptor cell fate and pineal gland development. Nat. Neurosci., 6, 1255–1263.[CrossRef][Web of Science][Medline]

  12. Zhang, J., Gray, J., Wu, L., Leone, G., Rowan, S., Cepko, C.L., Zhu, X., Craft, C.M. and Dyer, M.A. (2004) Rb regulates proliferation and rod photoreceptor development in the mouse retina. Nat. Genet., 36, 351–360.[CrossRef][Web of Science][Medline]

  13. Ng, L., Hurley, J.B., Dierks, B., Srinivas, M., Salto, C., Vennstrom, B., Reh, T.A. and Forrest, D. (2001) A thyroid hormone receptor that is required for the development of green cone photoreceptors. Nat. Genet., 27, 94–98.[Web of Science][Medline]

  14. Swaroop, A., Xu, J.Z., Pawar, H., Jackson, A., Skolnick, C. and Agarwal, N. (1992) A conserved retina-specific gene encodes a basic motif/leucine zipper domain. Proc. Natl Acad. Sci. USA, 89, 266–270.[Abstract/Free Full Text]

  15. Swain, P.K., Hicks, D., Mears, A.J., Apel, I.J., Smith, J.E., John, S.K., Hendrickson, A., Milam, A.H. and Swaroop, A. (2001) Multiple phosphorylated isoforms of NRL are expressed in rod photoreceptors. J. Biol. Chem., 276, 36824–36830.[Abstract/Free Full Text]

  16. Mears, A.J., Kondo, M., Swain, P.K., Takada, Y., Bush, R.A., Saunders, T.L., Sieving, P.A. and Swaroop, A. (2001) Nrl is required for rod photoreceptor development. Nat. Genet., 29, 447–452.[CrossRef][Web of Science][Medline]

  17. Furukawa, T., Morrow, E.M., Li, T., Davis, F.C. and Cepko, C.L. (1999) Retinopathy and attenuated circadian entrainment in Crx-deficient mice. Nat. Genet., 23, 466–470.[CrossRef][Web of Science][Medline]

  18. Mitton, K.P., Swain, P.K., Chen, S., Xu, S., Zack, D.J. and Swaroop, A. (2000) The leucine zipper of NRL interacts with the CRX homeodomain. A possible mechanism of transcriptional synergy in rhodopsin regulation. J. Biol. Chem., 275, 29794–29799.[Abstract/Free Full Text]

  19. Rehemtulla, A., Warwar, R., Kumar, R., Ji, X., Zack, D.J. and Swaroop, A. (1996) The basic motif-leucine zipper transcription factor Nrl can positively regulate rhodopsin gene expression. Proc. Natl Acad. Sci. USA, 93, 191–195.[Abstract/Free Full Text]

  20. Chen, S., Wang, Q.L., Nie, Z., Sun, H., Lennon, G., Copeland, N.G., Gilbert, D.J., Jenkins, N.A. and Zack, D.J. (1997) Crx, a novel Otx-like paired-homeodomain protein, binds to and transactivates photoreceptor cell-specific genes. Neuron, 19, 1017–1030.[CrossRef][Web of Science][Medline]

  21. Lerner, L.E., Gribanova, Y.E., Ji, M., Knox, B.E. and Farber, D.B. (2001) Nrl and Sp nuclear proteins mediate transcription of rod-specific cGMP-phosphodiesterase beta-subunit gene: involvement of multiple response elements. J. Biol. Chem., 276, 34999–35007.[Abstract/Free Full Text]

  22. Pittler, S.J., Zhang, Y., Chen, S., Mears, A.J., Zack, D.J., Ren, Z., Swain, P.K., Yao, S., Swaroop, A. and White, J.B. (2004) Functional analysis of the rod photoreceptor cGMP phosphodiesterase {alpha}-subunit gene promoter: Nrl and Crx are required for full transcriptional activity. J. Biol. Chem., 279, 19800–19807.[Abstract/Free Full Text]

  23. Bessant, D.A., Payne, A.M., Mitton, K.P., Wang, Q.L., Swain, P.K., Plant, C., Bird, A.C., Zack, D.J., Swaroop, A. and Bhattacharya, S.S. (1999) A mutation in NRL is associated with autosomal dominant retinitis pigmentosa. Nat. Genet., 21, 355–356.[CrossRef][Web of Science][Medline]

  24. Swain, P.K., Chen, S., Wang, Q.L., Affatigato, L.M., Coats, C.L., Brady, K.D., Fishman, G.A., Jacobson, S.G., Swaroop, A., Stone, E. et al. (1997) Mutations in the cone–rod homeobox gene are associated with the cone–rod dystrophy photoreceptor degeneration. Neuron, 19, 1329–1336.[CrossRef][Web of Science][Medline]

  25. Freund, C.L., Gregory-Evans, C.Y., Furukawa, T., Papaioannou, M., Looser, J., Ploder, L., Bellingham, J., Ng, D., Herbrick, J.A., Duncan, A. et al. (1997) Cone–rod dystrophy due to mutations in a novel photoreceptor-specific homeobox gene (CRX) essential for maintenance of the photoreceptor. Cell, 91, 543–553.[CrossRef][Web of Science][Medline]

  26. Freund, C.L., Wang, Q.L., Chen, S., Muskat, B.L., Wiles, C.D., Sheffield, V.C., Jacobson, S.G., McInnes, R.R., Zack, D.J. and Stone, E.M. (1998) De novo mutations in the CRX homeobox gene associated with Leber congenital amaurosis. Nat. Genet., 18, 311–312.[CrossRef][Web of Science][Medline]

  27. Swaroop, A., Wang, Q.L., Wu, W., Cook, J., Coats, C., Xu, S., Chen, S., Zack, D.J. and Sieving, P.A. (1999) Leber congenital amaurosis caused by a homozygous mutation (R90W) in the homeodomain of the retinal transcription factor CRX: direct evidence for the involvement of CRX in the development of photoreceptor function. Hum. Mol. Genet., 8, 299–305.[Abstract/Free Full Text]

  28. Rivolta, C., Berson, E.L. and Dryja, T.P. (2001) Dominant Leber congenital amaurosis, cone–rod degeneration, and retinitis pigmentosa caused by mutant versions of the transcription factor CRX. Hum. Mutat., 18, 488–498.[CrossRef][Web of Science][Medline]

  29. Kobayashi, M., Takezawa, S., Hara, K., Yu, R.T., Umesono, Y., Agata, K., Taniwaki, M., Yasuda, K. and Umesono, K. (1999) Identification of a photoreceptor cell-specific nuclear receptor. Proc. Natl Acad. Sci. USA, 96, 4814–4819.[Abstract/Free Full Text]

  30. Haider, N.B., Jacobson, S.G., Cideciyan, A.V., Swiderski, R., Streb, L.M., Searby, C., Beck, G., Hockey, R., Hanna, D.B., Gorman, S. et al. (2000) Mutation of a nuclear receptor gene, NR2E3, causes enhanced S cone syndrome, a disorder of retinal cell fate. Nat. Genet., 24, 127–131.[CrossRef][Web of Science][Medline]

  31. Milam, A.H., Rose, L., Cideciyan, A.V., Barakat, M.R., Tang, W.X., Gupta, N., Aleman, T.S., Wright, A.F., Stone, E.M., Sheffield, V.C. et al. (2002) The nuclear receptor NR2E3 plays a role in human retinal photoreceptor differentiation and degeneration. Proc. Natl Acad. Sci. USA, 99, 473–478.[Abstract/Free Full Text]

  32. Sharon, D., Sandberg, M.A., Caruso, R.C., Berson, E.L. and Dryja, T.P. (2003) Shared mutations in NR2E3 in enhanced S-cone syndrome, Goldmann–Favre syndrome, and many cases of clumped pigmentary retinal degeneration. Arch. Ophthalmol., 121, 1316–1323.[Abstract/Free Full Text]

  33. Akhmedov, N.B., Piriev, N.I., Chang, B., Rapoport, A.L., Hawes, N.L., Nishina, P.M., Nusinowitz, S., Heckenlively, J.R., Roderick, T.H., Kozak, C.A. et al. (2000) A deletion in a photoreceptor-specific nuclear receptor mRNA causes retinal degeneration in the rd7 mouse. Proc. Natl Acad. Sci. USA, 97, 5551–5556.[Abstract/Free Full Text]

  34. Haider, N.B., Naggert, J.K. and Nishina, P.M. (2001) Excess cone cell proliferation due to lack of a functional NR2E3 causes retinal dysplasia and degeneration in rd7/rd7 mice. Hum. Mol. Genet., 10, 1619–1626.[Abstract/Free Full Text]

  35. Yoshida, S., Mears, A.J., Friedman, J.S., Carter, T., He, S., Oh, E., Jing, Y., Farjo, R., Fleury, G., Barlow, C. et al. (2004) Expression profiling of the developing and mature Nrl–/– mouse retina: identification of retinal disease candidates and transcriptional regulatory targets of Nrl. Hum. Mol. Genet., 13, 1487–1503.[Abstract/Free Full Text]

  36. Bumsted O'Brien, K.M., Cheng, H., Jiang, Y., Schulte, D., Swaroop, A. and Hendrickson, A.E. (2004) The photoreceptor-specific nuclear receptor NR2E3 is specifically expressed in rod photoreceptors of fetal human retina. Invest. Ophthalmol. Vis. Sci., in press.

  37. Kumar, R., Chen, S., Scheurer, D., Wang, Q.L., Duh, E., Sung, C.H., Rehemtulla, A., Swaroop, A., Adler, R. and Zack, D.J. (1996) The bZIP transcription factor Nrl stimulates rhodopsin promoter activity in primary retinal cell cultures. J. Biol. Chem., 271, 29612–29618.[Abstract/Free Full Text]

  38. Mitton, K.P., Swain, P.K., Khanna, H., Dowd, M., Apel, I.J. and Swaroop, A. (2003) Interaction of retinal bZIP transcription factor NRL with Flt3-interacting zinc-finger protein Fiz1: possible role of Fiz1 as a transcriptional repressor. Hum. Mol. Genet., 12, 365–373.[Abstract/Free Full Text]

  39. Dryja, T.P., Hahn, L.B., Reboul, T. and Arnaud, B. (1996) Missense mutation in the gene encoding the alpha subunit of rod transducin in the Nougaret form of congenital stationary night blindness. Nat. Genet., 13, 358–360.[CrossRef][Web of Science][Medline]

  40. Carey, M. (1998) The enhanceosome and transcriptional synergy. Cell, 92, 5–8.[CrossRef][Web of Science][Medline]

  41. Roeder, R.G. (2003) The eukaryotic transcriptional machinery: complexities and mechanisms unforeseen. Nat. Med., 9, 1239–1244.[CrossRef][Web of Science][Medline]

  42. Lazar, M.A., Hodin, R.A., Darling, D.S. and Chin, W.W. (1989) A novel member of the thyroid/steroid hormone receptor family is encoded by the opposite strand of the rat c-erbA alpha transcriptional unit. Mol. Cell Biol., 9, 1128–1136.[Abstract/Free Full Text]

  43. Chomez, P., Neveu, I., Mansen, A., Kiesler, E., Larsson, L., Vennstrom, B. and Arenas, E. (2000) Increased cell death and delayed development in the cerebellum of mice lacking the rev-erbA(alpha) orphan receptor. Development, 127, 1489–1498.[Abstract]

  44. Kelley, M.W., Turner, J.K. and Reh, T.A. (1995) Ligands of steroid/thyroid receptors induce cone photoreceptors in vertebrate retina. Development, 121, 3777–3785.[Abstract]

  45. Coste, H. and Rodriguez, J.C. (2002) Orphan nuclear hormone receptor Rev-erb{alpha} regulates the human apolipoprotein CIII promoter. J. Biol. Chem., 277, 27120–27129.[Abstract/Free Full Text]

  46. Dussault, I. and Giguere, V. (1997) Differential regulation of the N-myc proto-oncogene by ROR{alpha} and RVR, two orphan members of the superfamily of nuclear hormone receptors. Mol. Cell. Biol., 17, 1860–1867.[Abstract/Free Full Text]

  47. Onishi, H., Yamaguchi, S., Yagita, K., Ishida, Y., Dong, X., Kimura, H., Jing, Z., Ohara, H. and Okamura, H. (2002) Rev-erbalpha gene expression in the mouse brain with special emphasis on its circadian profiles in the suprachiasmatic nucleus. J. Neurosci. Res., 68, 551–557.[CrossRef][Web of Science][Medline]

  48. Etchegaray, J., Lee, C., Wade, P.A. and Reppert, S. (2003) Rhythmic histone acetylation underlies transcription in the mammalian circadian clock. Nature, 421, 177–182.[CrossRef][Medline]

  49. LaVail, M.M. (1976) Rod outer segment disk shedding in rat retina: relationship to cyclic lighting. Science, 194, 1071–1074.[Abstract/Free Full Text]

  50. Bowes, C., van Veen, T. and Farber, D.B. (1988) Opsin, G-protein and 48-kDa protein in normal and rd mouse retinas: developmental expression of mRNAs and proteins and light/dark cycling of mRNAs. Exp. Eye Res., 47, 369–390.[CrossRef][Web of Science][Medline]

  51. Forman, B.M., Chen, J., Blumberg, B., Kliewer, S.A., Henshaw, R., Ong, E.S. and Evans, R.M. (1994) Cross-talk among ROR alpha 1 and the Rev-erb family of orphan nuclear receptors. Mol. Endocrinol., 8, 1253–1261.[Abstract/Free Full Text]

  52. Harding, H.P. and Lazar, M.A. (1995) The monomer-binding orphan receptor Rev-Erb represses transcription as a dimer on a novel direct repeat. Mol. Cell. Biol., 15, 4791–4802.[Abstract/Free Full Text]

  53. Pfahl, M. (1993) Nuclear receptor/AP-1 interaction. Endocr. Rev., 14, 615–618.

  54. Yang-Yen, H.F., Chambard, J.C., Sun, Y.L., Smeal, T., Schmidt, T.J., Drouin, J. and Karin, M. (1990) Transcriptional interference between c-Jun and the glucocorticoid receptor: mutual inhibition of DNA binding due to direct protein–protein interaction Cell, 62, 1205–1215.[CrossRef][Web of Science][Medline]

  55. Diamond, M.I., Miner, J.N., Yoshinaga, S.K. and Yamamoto, K.R. (1990) Transcription factor interactions: selectors of positive or negative regulation from a single DNA element. Science, 249, 1266–1272.[Abstract/Free Full Text]

  56. Zhang, X. and Pfahl, M. (1993) Hetero- and homodimeric receptors in thyroid hormone and vitamin A action. Receptor, 3, 183–191.[Web of Science][Medline]

  57. Wang, Q-L., Chen, S., Esumi, N., Swain, P.K., Haines, H.S., Peng, G., Melia, M.B., McIntosh, I., Heckenlively, J.R., Jacobson, S.G. et al. (2004) QRX, a novel homeobox gene, modulates photoreceptor gene expression. Hum. Mol. Genet., 13, 1025–1040.[Abstract/Free Full Text]

  58. Barolo, S. and Posakony, J.W. (2002) Three habits of highly effective signaling pathways: principles of transcriptional control by developmental cell signaling. Genes Dev., 16, 1167–1181.[Free Full Text]

  59. Chen, F., Figueroa, D.J., Marmorstein, A.D., Zhang, Q., Petrukhin, K., Caskey, C.T., Austin C.P. (1999) Retina-specific nuclear receptor: A potential regulator of cellular retinaldehyde-binding protein expressed in retinal pigment epithelium and Müller glial cells. Proc. Natl Acad. Sci. USA, 96, 15149–15154.[Abstract/Free Full Text]

  60. Hicks, D. and Molday, R.S. (1986) Differential immunogold-dextran labeling of bovine and frog rod and cone cells using monoclonal antibodies against bovine rhodopsin. Exp. Eye Res., 42, 55–71.[CrossRef][Web of Science][Medline]

  61. Zhu, X., Brown, B., Li, A., Mears, A.J., Swaroop, A. and Craft, C.M. (2003) GRK1-dependent phosphorylation of S and M opsins and their binding to cone arrestin during cone phototransduction in the mouse retina. J. Neurosci., 23, 6152–6160.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Neurosci.Home page
A. N. Riesenberg, Z. Liu, R. Kopan, and N. L. Brown
Rbpj Cell Autonomous Regulation of Retinal Ganglion Cell and Cone Photoreceptor Fates in the Mouse Retina
J. Neurosci., October 14, 2009; 29(41): 12865 - 12877.
[Abstract] [Full Text] [PDF]


Home page
Arch OphthalmolHome page
S. I. Pachydaki, C. C. Klaver, I. A. Barbazetto, M. S. Roy, P. Gouras, R. Allikmets, and L. A. Yannuzzi
Phenotypic Features of Patients With NR2E3 Mutations
Arch Ophthalmol, January 1, 2009; 127(1): 71 - 75.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
T. Langmann, C. C. L. Lai, K. Weigelt, B. M. Tam, R. Warneke-Wittstock, O. L. Moritz, and B. H. F. Weber
CRX controls retinal expression of the X-linked juvenile retinoschisis (RS1) gene
Nucleic Acids Res., November 1, 2008; 36(20): 6523 - 6534.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. A. Smyth, D. Di Lorenzo, and B. N. Kennedy
A Novel, Evolutionarily Conserved Enhancer of Cone Photoreceptor-specific Expression
J. Biol. Chem., April 18, 2008; 283(16): 10881 - 10891.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
G.-H. Peng and S. Chen
Crx activates opsin transcription by recruiting HAT-containing co-activators and promoting histone acetylation
Hum. Mol. Genet., October 15, 2007; 16(20): 2433 - 2452.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
E. C. T. Oh, N. Khan, E. Novelli, H. Khanna, E. Strettoi, and A. Swaroop
From the Cover: Transformation of cone precursors to functional rod photoreceptors by bZIP transcription factor NRL
PNAS, January 30, 2007; 104(5): 1679 - 1684.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Khanna, M. Akimoto, S. Siffroi-Fernandez, J. S. Friedman, D. Hicks, and A. Swaroop
Retinoic Acid Regulates the Expression of Photoreceptor Transcription Factor NRL
J. Biol. Chem., September 15, 2006; 281(37): 27327 - 27334.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
H. Cheng, T. S. Aleman, A. V. Cideciyan, R. Khanna, S. G. Jacobson, and A. Swaroop
In vivo function of the orphan nuclear receptor NR2E3 in establishing photoreceptor identity during mammalian retinal development
Hum. Mol. Genet., September 1, 2006; 15(17): 2588 - 2602.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. Srinivas, L. Ng, H. Liu, L. Jia, and D. Forrest
Activation of the Blue Opsin Gene in Cone Photoreceptor Development by Retinoid-Related Orphan Receptor {beta}
Mol. Endocrinol., August 1, 2006; 20(8): 1728 - 1741.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
A. Garelli, N. P. Rotstein, and L. E. Politi
Docosahexaenoic Acid Promotes Photoreceptor Differentiation without Altering Crx Expression.
Invest. Ophthalmol. Vis. Sci., July 1, 2006; 47(7): 3017 - 3027.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
B. Chang, H. Khanna, N. Hawes, D. Jimeno, S. He, C. Lillo, S. K. Parapuram, H. Cheng, A. Scott, R. E. Hurd, et al.
In-frame deletion in a novel centrosomal/ciliary protein CEP290/NPHP6 perturbs its interaction with RPGR and results in early-onset retinal degeneration in the rd16 mouse
Hum. Mol. Genet., June 1, 2006; 15(11): 1847 - 1857.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
O. Yaron, C. Farhy, T. Marquardt, M. Applebury, and R. Ashery-Padan
Notch1 functions to suppress cone-photoreceptor fate specification in the developing mouse retina
Development, April 1, 2006; 133(7): 1367 - 1378.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Akimoto, H. Cheng, D. Zhu, J. A. Brzezinski, R. Khanna, E. Filippova, E. C. T. Oh, Y. Jing, J.-L. Linares, M. Brooks, et al.
From the Cover: Targeting of GFP to newborn rods by Nrl promoter and temporal expression profiling of flow-sorted photoreceptors
PNAS, March 7, 2006; 103(10): 3890 - 3895.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
M. R. Roberts, A. Hendrickson, C. R. McGuire, and T. A. Reh
Retinoid X Receptor {gamma} Is Necessary to Establish the S-opsin Gradient in Cone Photoreceptors of the Developing Mouse Retina
Invest. Ophthalmol. Vis. Sci., August 1, 2005; 46(8): 2897 - 2904.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
D. R. Graham, P. A. Overbeek, and J. D. Ash
Leukemia Inhibitory Factor Blocks Expression of Crx and Nrl Transcription Factors to Inhibit Photoreceptor Differentiation
Invest. Ophthalmol. Vis. Sci., July 1, 2005; 46(7): 2601 - 2610.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. Qian, N. Esumi, Y. Chen, Q. Wang, I. Chowers, and D. J. Zack
Identification of regulatory targets of tissue-specific transcription factors: application to retina-specific gene regulation
Nucleic Acids Res., June 20, 2005; 33(11): 3479 - 3491.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
X. Shu, A.M. Fry, B. Tulloch, F.D.C. Manson, J.W. Crabb, H. Khanna, A.J. Faragher, A. Lennon, S. He, P. Trojan, et al.
RPGR ORF15 isoform co-localizes with RPGRIP1 at centrioles and basal bodies and interacts with nucleophosmin
Hum. Mol. Genet., May 1, 2005; 14(9): 1183 - 1197.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
G.-H. Peng, O. Ahmad, F. Ahmad, J. Liu, and S. Chen
The photoreceptor-specific nuclear receptor Nr2e3 interacts with Crx and exerts opposing effects on the transcription of rod versus cone genes
Hum. Mol. Genet., March 15, 2005; 14(6): 747 - 764.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
J. Chen, A. Rattner, and J. Nathans
The Rod Photoreceptor-Specific Nuclear Receptor Nr2e3 Represses Transcription of Multiple Cone-Specific Genes
J. Neurosci., January 5, 2005; 25(1): 118 - 129.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. M. Nishiguchi, J. S. Friedman, M. A. Sandberg, A. Swaroop, E. L. Berson, and T. P. Dryja
Recessive NRL mutations in patients with clumped pigmentary retinal degeneration and relative preservation of blue cone function
PNAS, December 21, 2004; 101(51): 17819 - 17824.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. S. Friedman, H. Khanna, P. K. Swain, R. DeNicola, H. Cheng, K. P. Mitton, C. H. Weber, D. Hicks, and A. Swaroop
The Minimal Transactivation Domain of the Basic Motif-Leucine Zipper Transcription Factor NRL Interacts with TATA-binding Protein
J. Biol. Chem., November 5, 2004; 279(45): 47233 - 47241.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
S. W. Pickrell, X. Zhu, X. Wang, and C. M. Craft
Deciphering the Contribution of Known cis-Elements in the Mouse Cone Arrestin Gene to its Cone-Specific Expression
Invest. Ophthalmol. Vis. Sci., November 1, 2004; 45(11): 3877 - 3884.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Yu, S. He, J. S. Friedman, M. Akimoto, D. Ghosh, A. J. Mears, D. Hicks, and A. Swaroop
Altered Expression of Genes of the Bmp/Smad and Wnt/Calcium Signaling Pathways in the Cone-only Nrl-/- Mouse Retina, Revealed by Gene Profiling Using Custom cDNA Microarrays
J. Biol. Chem., October 1, 2004; 279(40): 42211 - 42220.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
S. G. Jacobson, A. Sumaroka, T. S. Aleman, A. V. Cideciyan, S. B. Schwartz, A. J. Roman, R. R. McInnes, V. C. Sheffield, E. M. Stone, A. Swaroop, et al.
Nuclear receptor NR2E3 gene mutations distort human retinal laminar architecture and cause an unusual degeneration
Hum. Mol. Genet., September 1, 2004; 13(17): 1893 - 1902.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
13/15/1563    most recent
ddh173v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (62)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Cheng, H.
Right arrow Articles by Swaroop, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cheng, H.
Right arrow Articles by Swaroop, A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?